ID: 1166381350

View in Genome Browser
Species Human (GRCh38)
Location 19:42356855-42356877
Sequence CGGGCACATATGCGGCTGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381350_1166381360 7 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381350_1166381364 23 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381364 19:42356901-42356923 CTGGGGGGACTTACCGCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1166381350_1166381361 8 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381350_1166381363 20 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381363 19:42356898-42356920 CTGCTGGGGGGACTTACCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
1166381350_1166381359 6 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381350_1166381358 5 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381350_1166381357 4 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381350 Original CRISPR CGGGCACATATGCGGCTGCA TGG (reversed) Exonic
902580788 1:17406206-17406228 CAGGCATCTTTGCGGCTGCAGGG + Intergenic
907638387 1:56159491-56159513 ATGGCACATATGCATCTGCATGG - Intergenic
908215994 1:61952547-61952569 AGGGCACATATGCATGTGCAAGG + Intronic
915589763 1:156863979-156864001 CAGGCACATGTGCAGGTGCATGG + Intronic
921625317 1:217372879-217372901 CAGGCACTTATGAGGCTGCAGGG - Intergenic
921935870 1:220796576-220796598 CTGGCACATATTAGGGTGCATGG + Intronic
923262823 1:232283791-232283813 GGGGCACATCTGGGGCTGCAGGG - Intergenic
1075068935 10:119308158-119308180 CGGGCACTTATGTTCCTGCAAGG - Intronic
1075624150 10:123949751-123949773 CAGGCAAATATACTGCTGCAAGG + Intergenic
1076948188 10:133665625-133665647 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076949177 10:133668935-133668957 CTGGCACCTGGGCGGCTGCAGGG - Intronic
1076950161 10:133672234-133672256 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076951146 10:133675533-133675555 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076952136 10:133678843-133678865 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076953124 10:133682153-133682175 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076954108 10:133685452-133685474 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076955092 10:133741804-133741826 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076956082 10:133745114-133745136 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076958059 10:133751733-133751755 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076959043 10:133755032-133755054 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076960032 10:133758342-133758364 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1076961016 10:133761641-133761663 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1083628461 11:64083924-64083946 GGGGCACATATGCGGCAGCCCGG + Intronic
1094473205 12:30822552-30822574 CGGGCACAGCGGCGGCTGCCCGG - Intergenic
1096255837 12:50061948-50061970 GGGGCACAGCTGGGGCTGCAGGG - Intronic
1101778242 12:107813394-107813416 GGGGCACATAAGCAGCTCCATGG - Intergenic
1107673296 13:42769151-42769173 AGGGCACAGATGCTGCAGCATGG + Intergenic
1122799200 14:104221409-104221431 AGGGCACCTGTGCGGATGCAGGG - Intergenic
1125068938 15:35528714-35528736 CAGGCACATATGCGTATGCTAGG - Intronic
1128075750 15:64824306-64824328 CGGGCATAGAGGCGGCGGCAGGG - Exonic
1128568812 15:68718669-68718691 CAGGCACACATGTGGCTCCATGG - Intronic
1138190686 16:55011160-55011182 GGGACACAGAAGCGGCTGCAGGG + Intergenic
1164433370 19:28207609-28207631 GGGGCACACATGCTGCAGCAGGG + Intergenic
1166381350 19:42356855-42356877 CGGGCACATATGCGGCTGCATGG - Exonic
1167144792 19:47675312-47675334 TGGGCACATATGTGGATGCCAGG + Intronic
1168332449 19:55578432-55578454 CGGGCGCACCTGCGGCAGCACGG - Exonic
928261602 2:29772466-29772488 TTGGCACATATGCAGATGCAGGG + Intronic
942481197 2:176390199-176390221 CTGGCACATGTGCAGGTGCAGGG - Intergenic
948542810 2:238702413-238702435 GGGGCACACATGCGTCTGCCCGG - Intergenic
1174521052 20:51131100-51131122 CGGGCAATTGTGCCGCTGCATGG + Intergenic
1174560730 20:51428914-51428936 ACGGCACATATTTGGCTGCACGG - Intronic
1175515719 20:59568638-59568660 GGGGCACACATGAGGGTGCAGGG - Intergenic
1184572211 22:45332596-45332618 CAGGCAGATATGCTTCTGCACGG + Exonic
1184803440 22:46776426-46776448 TGGGCACAGCTGCGGCTGCGTGG + Intronic
953881386 3:46693164-46693186 CTGGGACATATGCGACAGCAGGG - Intronic
959528814 3:107408667-107408689 CATGCACACATGCAGCTGCAGGG - Intergenic
961719240 3:128881414-128881436 CCGGCACATATGCAGCGGGAGGG - Intronic
968674923 4:1871911-1871933 CGGGCACAGGTGCAGCCGCAGGG - Intronic
979648848 4:123106927-123106949 CAGGCACACAAGCTGCTGCATGG + Intronic
985452632 4:190069725-190069747 CTGGCACCTGGGCGGCTGCAGGG - Intergenic
1009477708 6:64114931-64114953 GGGGCATGTATGGGGCTGCAGGG - Intronic
1023843257 7:44108177-44108199 CGGGCACAGGTGGGGTTGCAAGG - Intronic
1035227903 7:157443654-157443676 CGGGCAGCGATGGGGCTGCAGGG - Intergenic
1057914413 9:99044654-99044676 GGGGCAGATATGTGCCTGCAGGG - Intronic
1060886391 9:127155459-127155481 AGGGCACATCAGGGGCTGCATGG + Intronic
1188614900 X:32145474-32145496 CAGACACATTTGCTGCTGCAAGG - Intronic
1189328070 X:40125161-40125183 CTGGCACATAGCAGGCTGCAGGG - Intronic
1194209312 X:91051250-91051272 CGGGCAAACTTGCAGCTGCAAGG + Intergenic