ID: 1166381352

View in Genome Browser
Species Human (GRCh38)
Location 19:42356863-42356885
Sequence ACGGCCAGCGGGCACATATG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381352_1166381360 -1 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381352_1166381363 12 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381363 19:42356898-42356920 CTGCTGGGGGGACTTACCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
1166381352_1166381361 0 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381352_1166381364 15 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381364 19:42356901-42356923 CTGGGGGGACTTACCGCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1166381352_1166381358 -3 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381352_1166381359 -2 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381352_1166381357 -4 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381352 Original CRISPR ACGGCCAGCGGGCACATATG CGG (reversed) Exonic
900947019 1:5836818-5836840 ACCCCCAGCCGGCACATTTGGGG + Intergenic
906728940 1:48064717-48064739 ACAGACAGCAGGCACATCTGTGG - Intergenic
906809273 1:48809661-48809683 ACAGCCTGCAGGCACAAATGAGG - Intronic
907335229 1:53695214-53695236 ACGGCCTGTGGTCACATAAGTGG - Intronic
912026008 1:105173317-105173339 CAGGCCAATGGGCACATATGTGG + Intergenic
921603115 1:217128009-217128031 GTGGCCAGCGAGCACATGTGTGG - Intronic
1062960102 10:1567100-1567122 AAGGCCAGTGGGCACCCATGTGG + Intronic
1073276350 10:102315022-102315044 ACAGCCACTGGTCACATATGGGG + Intronic
1083744033 11:64725374-64725396 AAGGCCAGTGGGGACACATGGGG + Intergenic
1111516677 13:89342206-89342228 ACTGGCAGCGGGCACAGGTGAGG - Intergenic
1122458822 14:101878892-101878914 ACGGCCAGCTGGCACAGTCGGGG + Intronic
1124603069 15:31150757-31150779 ACAGCCAGCAGGCACAGATATGG + Intronic
1128388225 15:67165457-67165479 ACGGCCAGGGGGCAGAGATTGGG - Intronic
1132367420 15:101267589-101267611 CCAGCCAGCGGGCAGATGTGGGG + Intergenic
1134043533 16:11085291-11085313 ATGGTCAGAGGGCACATCTGTGG + Intronic
1135056810 16:19238720-19238742 AGGCCCTGCAGGCACATATGTGG - Intronic
1141780132 16:86153907-86153929 ACGCACAGCGGGCACCTTTGTGG - Intergenic
1142012848 16:87725727-87725749 ACGAGCAGCAGGCACATGTGAGG + Intronic
1145242793 17:21249469-21249491 ACAGCCAGCGGCCTCATATTGGG + Intronic
1147282697 17:39375794-39375816 ACTGCCAACAGGCACATTTGGGG - Intronic
1163683835 19:18699650-18699672 AGGGCCAGCTGGCACAGGTGTGG - Intronic
1166381352 19:42356863-42356885 ACGGCCAGCGGGCACATATGCGG - Exonic
934774415 2:96928019-96928041 ACGGCAGGCTGGCACATGTGTGG + Intronic
938781756 2:134590868-134590890 ACAGCCTGCAGGCACAGATGGGG + Intronic
949041417 2:241851638-241851660 ACCGCAGGCAGGCACATATGTGG + Intronic
1176853951 21:13947487-13947509 ACGGCCCCCAGCCACATATGGGG + Intergenic
1184709229 22:46238666-46238688 ACAGCCAGCTGGCACACAAGAGG - Exonic
958627529 3:96645554-96645576 ACTGTCAGTGGGCACATGTGAGG - Intergenic
969824447 4:9746559-9746581 CATGCCTGCGGGCACATATGAGG - Intergenic
984710174 4:182878289-182878311 GCTGCCAGCGGGCAAAAATGTGG + Intergenic
996920765 5:128765160-128765182 GGGGCCAGCTGGCACATATGGGG + Intronic
999109248 5:149103635-149103657 AGGGCCAACAGGCACATGTGTGG + Intergenic
1013081990 6:106821275-106821297 AGGCCCAGAGGACACATATGGGG + Intergenic
1019513689 7:1430446-1430468 ACTGCCAGCGGGCACACACCAGG - Intronic
1024627488 7:51220465-51220487 ACGGCCACCGTGGACAGATGCGG + Intronic
1024708240 7:51985250-51985272 AGGGGCAGAGGGCACAGATGGGG + Intergenic
1037183789 8:16037294-16037316 ACAGCCAGGTGCCACATATGTGG - Intergenic
1053268731 9:36735267-36735289 ACGGCCAGGGTGGACAGATGGGG - Intergenic
1191162255 X:57342639-57342661 ACGTTCAGGGGGCACATATGCGG + Intronic