ID: 1166381357

View in Genome Browser
Species Human (GRCh38)
Location 19:42356882-42356904
Sequence CCGTGGTGCCATGTATCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 78}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381345_1166381357 21 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381348_1166381357 13 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381342_1166381357 28 Left 1166381342 19:42356831-42356853 CCCAGGCCCATCGCCCCGCTCCT 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381349_1166381357 8 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381344_1166381357 22 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381346_1166381357 15 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381347_1166381357 14 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381343_1166381357 27 Left 1166381343 19:42356832-42356854 CCAGGCCCATCGCCCCGCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381352_1166381357 -4 Left 1166381352 19:42356863-42356885 CCGCATATGTGCCCGCTGGCCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381350_1166381357 4 Left 1166381350 19:42356855-42356877 CCATGCAGCCGCATATGTGCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381357 Original CRISPR CCGTGGTGCCATGTATCTGC TGG Exonic
900187696 1:1339998-1340020 GCGGGGTGACATGTAGCTGCGGG - Intronic
902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG + Exonic
904744228 1:32701600-32701622 CCATGGTGCCAGGCCTCTGCTGG + Intronic
905012023 1:34754328-34754350 CCAAGGTGCCCTGTATCAGCAGG - Intronic
908205603 1:61845077-61845099 CTGTGGTTTCAGGTATCTGCTGG + Intronic
910524168 1:88158227-88158249 CCGTGGTCCTATGTATTTGCTGG - Intergenic
912996366 1:114536039-114536061 CCGTGGCTGCATGTAGCTGCTGG - Intergenic
915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG + Intronic
920769062 1:208863355-208863377 CCGAAGCACCATGTATCTGCTGG - Intergenic
922993779 1:229939903-229939925 CCCTTGTGCCAGGTAGCTGCCGG + Intergenic
1066301588 10:34101993-34102015 GCCAGGTGCCATGTATATGCTGG - Intergenic
1069911322 10:71761607-71761629 CCATGGTGCCATGGAGCTGCAGG - Exonic
1070441221 10:76445446-76445468 CCGTGATGCCCTGCATCTGCAGG - Intronic
1075022739 10:118963552-118963574 CCGGGGTGCCCAGTGTCTGCGGG - Intergenic
1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG + Intronic
1080925556 11:36752542-36752564 CTGTGGTCCTATGTCTCTGCTGG + Intergenic
1082674776 11:56083475-56083497 CCCTGGTGGAATGTATCTTCAGG - Intergenic
1083458641 11:62796394-62796416 CAGGTGTGCCCTGTATCTGCTGG + Intronic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1093609731 12:21138837-21138859 CTGTGGTTTCATGTGTCTGCAGG + Intronic
1097172311 12:57123461-57123483 CTGTGGTGGCATGCATCTGTAGG - Intronic
1097648440 12:62264121-62264143 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG + Intergenic
1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG + Intergenic
1111560190 13:89934585-89934607 CCATGGTTTCATGTATCTCCTGG + Intergenic
1113076091 13:106469336-106469358 CCCGGGTGCCGTGTGTCTGCAGG - Intergenic
1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG + Intronic
1124358231 15:29014843-29014865 GCCTGGTGCCATGTACCTGTAGG - Intronic
1125928275 15:43581388-43581410 CAGTGATGCTATGTACCTGCAGG - Exonic
1125941441 15:43681223-43681245 CAGTGATGCTATGTACCTGCAGG - Intergenic
1128352747 15:66901981-66902003 CAGAGGTGCCATGTGTCTGATGG + Intergenic
1130543911 15:84840866-84840888 CCCGGGTGCCATGTCTCCGCCGG - Exonic
1132318104 15:100905000-100905022 CCTGGGTGCCATGTATCACCTGG - Intronic
1137249039 16:46729687-46729709 CCGTGTGGCTATGTCTCTGCAGG - Exonic
1138932026 16:61670717-61670739 CCATGGTTTCATGTATCTCCTGG - Intronic
1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG + Intronic
1140906304 16:79412298-79412320 CCGTGGTACCAGGTATGTGCAGG + Intergenic
1141336071 16:83156591-83156613 CCATGGTGCCTTTTATCTGGAGG - Intronic
1150626918 17:66847875-66847897 CCTTGGTGCTGTGCATCTGCTGG - Intronic
1151039523 17:70842500-70842522 CTGTGGTGCCATGTATTCCCTGG - Intergenic
1152376832 17:79922892-79922914 CCGTGGTGCACTGTAGCTGTTGG - Intergenic
1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG + Intronic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1158615293 18:58981527-58981549 CCTTGATGCCATGCATCAGCTGG - Exonic
1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG + Intergenic
1162003537 19:7763445-7763467 TCTTGTGGCCATGTATCTGCTGG - Exonic
1164905755 19:31966645-31966667 GAGTGGGGCCATGTACCTGCCGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167513776 19:49910829-49910851 CAGTGGTGCCATCTATCAGCAGG + Intronic
931118172 2:59187157-59187179 CAGTGGAGGCATCTATCTGCTGG - Intergenic
931176307 2:59858500-59858522 CCCTGGGGCCATGTGTCTGAGGG - Intergenic
931640418 2:64376204-64376226 TGGTGGTGCCATGTTTGTGCTGG - Intergenic
936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG + Intergenic
947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG + Intronic
947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG + Intergenic
947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG + Intergenic
947878105 2:233480941-233480963 CCGGGGGGCCATGGATCTGCGGG + Intronic
1174100650 20:48123963-48123985 CCGTGCTGCTATGTAACTGTGGG - Intergenic
1175697935 20:61116593-61116615 CCTGGGTGCCAAGTTTCTGCTGG - Intergenic
1180665322 22:17506263-17506285 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1183684593 22:39354435-39354457 CCTTGGTGCCATGGATATCCAGG - Intronic
949518239 3:4826421-4826443 CCGTGGTGCCAGCTAACTTCAGG - Intronic
956797945 3:72732960-72732982 CCTTGGTGCCAAGTATCAGCAGG - Intergenic
962113724 3:132478629-132478651 ACGTGGTGGCATGTACCTGGTGG + Intronic
962702243 3:138010789-138010811 CCCTGCTCCCATGTATGTGCAGG - Intronic
964807040 3:160621652-160621674 CATTGGTGCTATGTATGTGCAGG + Intergenic
966912679 3:184568353-184568375 CCGTCCTGCCATGTATCTGCAGG - Intronic
981103671 4:140857020-140857042 CAGTGGTAGCCTGTATCTGCTGG - Intergenic
985306693 4:188550320-188550342 CCTTGGTGGCATGTTTATGCTGG - Intergenic
985587980 5:750787-750809 CTGTGGGGCCATGTAGCTGTGGG - Intronic
988099749 5:26660919-26660941 CCGTGGTGCTTTGTTTCTTCTGG - Intergenic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
999981387 5:156960967-156960989 CCGTAGTGCCATGCATCCTCAGG - Intronic
1000663456 5:163965040-163965062 CCATTGTGTCATGTTTCTGCAGG - Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1013512703 6:110859022-110859044 ACTTGGGGTCATGTATCTGCCGG - Intronic
1031921773 7:127607492-127607514 CTGTGGTTTCAGGTATCTGCTGG - Intergenic
1033246443 7:139720361-139720383 CCCTGGGCCCATGGATCTGCTGG + Intronic
1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG + Intronic
1049891694 9:75603-75625 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1050755783 9:9001508-9001530 CTGTGGTGCCATTTATCTAGAGG - Intronic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1053733121 9:41076694-41076716 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG + Intronic
1055372614 9:75616559-75616581 CCATCTTCCCATGTATCTGCTGG - Intergenic
1061078412 9:128355551-128355573 TCGAGGTGCCAGGTATGTGCAGG + Exonic
1189684160 X:43546380-43546402 GCGTGGTGGCATGTGTCTGTAGG - Intergenic
1194552527 X:95319645-95319667 CCCTGGTGCCACCTGTCTGCTGG + Intergenic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic