ID: 1166381886

View in Genome Browser
Species Human (GRCh38)
Location 19:42359005-42359027
Sequence TAGGGAAGTACAGGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381886 Original CRISPR TAGGGAAGTACAGGGGTGGC TGG Intronic
900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG + Intronic
901160752 1:7175096-7175118 CAGGAAAGTACAGGAGTGGGAGG + Intronic
902289375 1:15426621-15426643 CAGGGAAGGAGAGAGGTGGCAGG + Intronic
902482054 1:16717200-16717222 TTGGGAGGTACGGGGCTGGCAGG - Intergenic
902668136 1:17953551-17953573 AAGGGAAGTAGAGGGGAGTCAGG + Intergenic
904726144 1:32549762-32549784 AGGGGAAGTTCAGGGGTAGCAGG - Intronic
905464080 1:38139693-38139715 TGGGGGAGTACAGGGGGTGCTGG - Intergenic
905654058 1:39674750-39674772 TTGGGAAGTTCAGGCATGGCTGG - Intergenic
906163612 1:43669450-43669472 TAGGGATGTACAGGGAGGACTGG + Intronic
906584079 1:46961260-46961282 GAGGGAGGTACAGGAGTGGGAGG + Intergenic
907712982 1:56901599-56901621 TAAGGAAGTACAGAGGTAGTGGG - Intronic
908432401 1:64071952-64071974 TAGGGAAGCACCACGGTGGCGGG - Intronic
909138731 1:71835468-71835490 TAAGGAAGTAGAGAGGTTGCAGG - Intronic
909172498 1:72314646-72314668 TGGGCAATGACAGGGGTGGCTGG + Intergenic
909858814 1:80576228-80576250 TGGGCAAATACAGGGGTGGCTGG + Intergenic
910948451 1:92618423-92618445 AAGGGAATTACAGTGTTGGCTGG + Intronic
911713438 1:101101266-101101288 GAGGGCAGGACGGGGGTGGCAGG - Intergenic
911939241 1:104020424-104020446 TTGGGAGGTTCAGGGGTGGGAGG - Intergenic
912251921 1:108020568-108020590 TGGGCAATGACAGGGGTGGCTGG + Intergenic
912950549 1:114117610-114117632 TAGGGAAGCCCAGGGCTGGGAGG - Intronic
913518429 1:119623915-119623937 CAGGGAAGTACGGGAGGGGCCGG + Exonic
915706738 1:157851045-157851067 TAGGGAAGTAGTGGTCTGGCTGG - Intronic
916260230 1:162834537-162834559 CAGGGAGGTCCAGGAGTGGCAGG + Intronic
916915995 1:169407615-169407637 TAATTAAATACAGGGGTGGCTGG + Intronic
917922433 1:179762002-179762024 TAGGGAAGTGGAGGAGTGGGGGG - Intronic
919986956 1:202682078-202682100 CAGGGAGCTACAGAGGTGGCTGG - Intronic
920150253 1:203900490-203900512 TGGGGAAGTTCAGGCATGGCGGG - Intergenic
922145097 1:222935525-222935547 TCTGGAAAAACAGGGGTGGCAGG - Intronic
922412711 1:225391607-225391629 TTTGGAAGGACAGGGGTGGGGGG + Intronic
922608244 1:226904623-226904645 AAAAGAAGTCCAGGGGTGGCTGG - Intronic
922637275 1:227186514-227186536 AAGGGAGGTACAGAGGTGGCAGG + Intronic
922683182 1:227617907-227617929 TAGCTAAAGACAGGGGTGGCTGG - Intronic
924477184 1:244392630-244392652 TGGGTAATTACAGTGGTGGCTGG + Intergenic
924619575 1:245649038-245649060 TTGGGAAGGACAGCGCTGGCTGG - Intronic
1062908360 10:1195165-1195187 TGGGGAAGGACAGGGATGGGAGG - Intronic
1063327191 10:5116210-5116232 AAGGGAGGTACAGTGTTGGCTGG - Intronic
1064284268 10:13978821-13978843 TGGGAAAGTACAGGAGAGGCAGG + Intronic
1065767932 10:29049120-29049142 GAGGGAAGTAAATGGCTGGCTGG - Intergenic
1066679036 10:37918247-37918269 TAGGGAAACACAGGGATGACAGG + Intergenic
1067655465 10:48188326-48188348 AAGGGAAGAACAGGGGCGGTGGG + Intronic
1070512087 10:77170635-77170657 TAGGGAAGGAGAGGGGCGGAGGG - Intronic
1070900938 10:80028555-80028577 GAGAGAAGTAGAAGGGTGGCAGG - Intergenic
1070902674 10:80044322-80044344 GAGAGAAGTAGAAGGGTGGCAGG - Intergenic
1071378483 10:85034178-85034200 TGGGGGATGACAGGGGTGGCTGG - Intergenic
1071499174 10:86191468-86191490 GAGGGAAGAACAGGGGAGGGTGG - Intronic
1071758494 10:88573237-88573259 TAGGGAAGTCCAAGGATGCCAGG - Intronic
1072691237 10:97573387-97573409 TAAGGAAGTGGAGCGGTGGCAGG + Intronic
1073656438 10:105422779-105422801 AAGGGAATTACAGTGTTGGCTGG - Intergenic
1073995771 10:109313917-109313939 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1074978836 10:118602793-118602815 CAGGGAGGTCCAGGGATGGCCGG - Intergenic
1075606894 10:123818224-123818246 TGGGCGATTACAGGGGTGGCTGG - Intronic
1075707658 10:124511385-124511407 CTGGGAAGCACAGGGGTGGGTGG + Intronic
1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG + Exonic
1077437627 11:2550436-2550458 TAGGGAGGAACATGGGTGTCTGG - Intronic
1079095835 11:17509618-17509640 AAGGGAAGGACAGGGGGCGCCGG + Exonic
1080721504 11:34853718-34853740 TAGGGATGGAGAGGGATGGCAGG - Intronic
1081280545 11:41204435-41204457 TAGGTAAGTGCTGGGCTGGCTGG - Intronic
1081378392 11:42386722-42386744 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1081818298 11:45966106-45966128 TTGGGAAGAAAAGGGGTGCCAGG - Intronic
1082715454 11:56606521-56606543 AAGGGAGGTACAGTGTTGGCTGG + Intergenic
1082762283 11:57138932-57138954 TGGGCATGTACTGGGGTGGCAGG + Intergenic
1083093243 11:60221921-60221943 TGGGCAATGACAGGGGTGGCTGG - Intronic
1084363764 11:68684897-68684919 AAGGGAAGGACAGGGCGGGCGGG - Intronic
1084583172 11:70037226-70037248 CAGGGAAGGACAGGTGTGACAGG + Intergenic
1084600102 11:70140231-70140253 TAAGAAAGTAAAGGAGTGGCCGG + Intronic
1084694829 11:70746917-70746939 AAGGGGAGTACAGCGGTGGAGGG - Intronic
1084694860 11:70746995-70747017 GAGGGGAGTACAGGGGTAGGGGG - Intronic
1084694870 11:70747017-70747039 GAGGGGAGTGCAGGGGTGGAGGG - Intronic
1085254878 11:75166803-75166825 GAGGGAAGCACAGGGGTGGGAGG + Intronic
1088265525 11:107984395-107984417 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1088457805 11:110050532-110050554 TAGGGAAGACGAGGGGTGGGAGG - Intergenic
1089319258 11:117613875-117613897 TAGGCAAGGGGAGGGGTGGCTGG - Intronic
1089340544 11:117754478-117754500 TGGGGAAGCACAGGGGTGATGGG + Intronic
1090335194 11:125957328-125957350 CAGGGGAGGACAGGGGTGGGGGG + Exonic
1092093863 12:5825640-5825662 GAGGGAATTACAGTGTTGGCTGG + Intronic
1093981502 12:25480003-25480025 TGGGCAATGACAGGGGTGGCTGG + Intronic
1097077102 12:56403194-56403216 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1097437589 12:59570574-59570596 AAGGGAATTACAGTGTTGGCTGG - Intergenic
1097437729 12:59571461-59571483 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1097821245 12:64131113-64131135 TGAGCAAGAACAGGGGTGGCTGG + Intronic
1097924564 12:65112948-65112970 TTAGGAAGTACAGGATTGGCTGG - Intronic
1099508670 12:83507979-83508001 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1099825988 12:87779016-87779038 AAGGGGAGTACAGGGGAGGTGGG - Intergenic
1100083406 12:90879001-90879023 TGGGCAAGGACTGGGGTGGCTGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101543172 12:105683430-105683452 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1101618240 12:106358633-106358655 TAGGGAAGTGGAGACGTGGCCGG + Intronic
1101654162 12:106705426-106705448 TAGGGAAGGAAAGAGGTGGAGGG + Intronic
1102570825 12:113825986-113826008 GAGGGAAGCAGAGAGGTGGCAGG - Intronic
1102650638 12:114439877-114439899 TAGGGAAGTTCAGGGAGAGCTGG - Intergenic
1103035729 12:117654867-117654889 TGGGCAATGACAGGGGTGGCTGG - Intronic
1103244833 12:119447620-119447642 TAGGTAATAACAGGGATGGCAGG + Intronic
1104147897 12:126053457-126053479 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1104453376 12:128889591-128889613 TTGGGAAGTACAGCGCTGGAAGG - Intronic
1106526073 13:30542383-30542405 GTGGGAGGCACAGGGGTGGCAGG - Intronic
1108416773 13:50205554-50205576 TAGGGAAGAACAGGGCTGACTGG - Intronic
1109583145 13:64366962-64366984 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1110810711 13:79808217-79808239 TAGGGAGGTCCTGGGGTGGCTGG - Intergenic
1111016354 13:82387089-82387111 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1111057690 13:82972230-82972252 TGGGCGATTACAGGGGTGGCTGG + Intergenic
1112331005 13:98476891-98476913 TGGAGAAGGCCAGGGGTGGCTGG - Intronic
1113656780 13:112072682-112072704 GAGGGAAGAACGGGGGAGGCGGG - Intergenic
1113884833 13:113653088-113653110 CAGGGCAGGACAGGGCTGGCAGG - Intronic
1114205968 14:20571563-20571585 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1117131014 14:52686956-52686978 TAAGGGAGTATAAGGGTGGCAGG + Intronic
1117596039 14:57328188-57328210 AAGGGAATTACAGTGTTGGCTGG - Intergenic
1118904487 14:70013731-70013753 TAGGAAAGTCCAGGGCTGTCTGG + Intronic
1119113474 14:71996777-71996799 TAGGGGAGGAAGGGGGTGGCGGG + Intronic
1119533439 14:75379909-75379931 TGGGGCAGTCCAGTGGTGGCAGG + Intergenic
1119738742 14:77000258-77000280 GAGGGAGGCACAGGGGTGGGTGG + Intergenic
1120081915 14:80226738-80226760 TGGGCAATGACAGGGGTGGCCGG + Intronic
1120231339 14:81844456-81844478 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1120594458 14:86416749-86416771 AAGGGAGTTACAGGGCTGGCTGG - Intergenic
1120973805 14:90231592-90231614 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1121827562 14:97022919-97022941 GAGGGAGGTACAGGGGAGGGAGG - Intergenic
1121931387 14:97975668-97975690 GAGGGAACTACAGAGGGGGCGGG + Intronic
1122505002 14:102226697-102226719 GCGGGAAGTCCAAGGGTGGCTGG + Intronic
1123099374 14:105785900-105785922 GAGGGAAGTGCTGAGGTGGCTGG - Intergenic
1123420100 15:20124501-20124523 TGGGGAGGTCCAGGGGTTGCAGG + Intergenic
1123445762 15:20329031-20329053 TGGGGAGGTCCAGGGGTTGCAGG - Intergenic
1123529323 15:21131037-21131059 TGGGGAGGTCCAGGGGTTGCAGG + Intergenic
1123944075 15:25230514-25230536 TAGGGAAGACCAGGGGTGCCCGG + Intergenic
1127354119 15:58181824-58181846 TAGGAAAGAGCAGGGTTGGCTGG + Intronic
1128326237 15:66725933-66725955 AAGGTAAGTGAAGGGGTGGCAGG - Intronic
1129236072 15:74224438-74224460 TCTGGAAGCACAGGGGTGGAGGG - Intergenic
1129698862 15:77756030-77756052 GTGGGAAGTAGGGGGGTGGCAGG + Intronic
1130209475 15:81910049-81910071 CAGGGAAGAACAGTGGTGCCAGG - Intergenic
1131111161 15:89766177-89766199 TGGGGAAGTAAAGGAGGGGCTGG - Intronic
1131636352 15:94236878-94236900 TAGGGAAGTGGAGGTGCGGCAGG + Intronic
1132150819 15:99457045-99457067 TAGGGAGCTACACGGGTGTCAGG - Intergenic
1133162340 16:3920428-3920450 CAGGGAAGTCCAGGGGTCCCTGG + Intergenic
1134199049 16:12182547-12182569 CAGGGTAGTACTGAGGTGGCAGG + Intronic
1136720983 16:32319577-32319599 TGGGGAGGTCCAGGGGTTGCAGG + Intergenic
1136778257 16:32882829-32882851 TGGGGAGATAAAGGGGTGGCAGG - Intergenic
1136839368 16:33525863-33525885 TGGGGAGGTCCAGGGGTTGCAGG + Intergenic
1136892363 16:33978685-33978707 TGGGGAGATAAAGGGGTGGCAGG + Intergenic
1137638289 16:50006565-50006587 TGGGGAAATACAGGGGGTGCAGG + Intergenic
1138372743 16:56540270-56540292 TAGAGCAGTTAAGGGGTGGCAGG - Intergenic
1139596632 16:67961993-67962015 CAGGGAAGAACACGGCTGGCAGG + Intronic
1140783057 16:78314108-78314130 TAAGAAAGTACAGGAGAGGCCGG + Intronic
1141220797 16:82067884-82067906 AAGGGTAGTCCAGGAGTGGCTGG - Intronic
1142218478 16:88841458-88841480 AAGGGAAGGACGGGGGAGGCAGG - Intronic
1142343307 16:89537988-89538010 CAGGGAAGTACAGGGGCAGTCGG - Intronic
1203005449 16_KI270728v1_random:198193-198215 TGGGGAGGTCCAGGGGTTGCAGG - Intergenic
1203080679 16_KI270728v1_random:1144938-1144960 TGGGGAGATAAAGGGGTGGCAGG - Intergenic
1203136999 16_KI270728v1_random:1734314-1734336 TGGGGAGGTCCAGGGGTTGCAGG - Intergenic
1203149533 16_KI270728v1_random:1826148-1826170 TGGGGAGGTCCAGGGGTTGCAGG + Intergenic
1144643699 17:16954096-16954118 GAGGGAAGACCAGAGGTGGCTGG + Intronic
1145205091 17:20980287-20980309 GAGGGAAGACCAGAGGTGGCTGG - Intergenic
1145831110 17:27917015-27917037 TAGGGATGTATAGGGATGACAGG + Intergenic
1148464067 17:47854161-47854183 TTGAGAAGAAGAGGGGTGGCAGG - Intronic
1149792571 17:59492200-59492222 TGGGGAAGAGCAGGGCTGGCAGG + Intergenic
1152473338 17:80502632-80502654 TGGGGAAGCACATGGGTGGGGGG - Intergenic
1153217584 18:2834811-2834833 TGGGAAATGACAGGGGTGGCTGG + Intergenic
1153859904 18:9192022-9192044 CAGGGAAGTACCAGGGTGGTTGG - Intronic
1154127095 18:11701240-11701262 TGGGGAGGTACAGGGGAGGTAGG + Intronic
1155443931 18:25890985-25891007 TAGGGGAGGGCAGGGGTGGCTGG + Intergenic
1156527924 18:37784576-37784598 TATGGAACTACCAGGGTGGCCGG - Intergenic
1156596152 18:38550565-38550587 TAGGGAAGGAGAGAGGTGGCTGG - Intergenic
1157786281 18:50485947-50485969 AAGAGAAGCACAGGGGTGGTGGG - Intergenic
1159559002 18:69974572-69974594 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1159721698 18:71899167-71899189 TGGAGAAATACATGGGTGGCTGG - Intergenic
1161793747 19:6375100-6375122 TAGGGAGCTCCAGGTGTGGCTGG + Exonic
1162282373 19:9709509-9709531 CAGGGAAGAACAGTTGTGGCAGG - Intergenic
1163282989 19:16328397-16328419 TGGGGAAGGTGAGGGGTGGCAGG - Intergenic
1163799258 19:19355058-19355080 TAGGGCAGAACAGGGCTGGCTGG - Intronic
1164519699 19:28969307-28969329 AAGGATAGTTCAGGGGTGGCAGG - Intergenic
1166381886 19:42359005-42359027 TAGGGAAGTACAGGGGTGGCTGG + Intronic
1166549789 19:43657616-43657638 TGGGGGAGTACAGGGGTGTGTGG - Intronic
1166993980 19:46710618-46710640 TAGGGGAGCAGAAGGGTGGCGGG - Intronic
1167007738 19:46786803-46786825 GAGGGAAAGGCAGGGGTGGCAGG + Intronic
1167114879 19:47483400-47483422 CAGGGGAGGGCAGGGGTGGCAGG + Intronic
1167652257 19:50738784-50738806 GAGGGAAGAACAAGGATGGCAGG - Intergenic
926802509 2:16671486-16671508 TAGGGAAGGAAAGTGGAGGCAGG + Intergenic
927031170 2:19121898-19121920 TATGGAACTACAAAGGTGGCCGG + Intergenic
927699520 2:25259061-25259083 TAGGGAAGTGTAGGGTTGGCTGG - Intronic
928877628 2:36059111-36059133 TAGGGAACTACCTGGGAGGCAGG - Intergenic
928993793 2:37264510-37264532 TAGGGGAGTGGAGGGGTGGGAGG + Intronic
929366025 2:41157634-41157656 TAGCCAAGCACAGTGGTGGCAGG + Intergenic
929392121 2:41481753-41481775 TAGGAAAGTACAGTGGTGAAAGG + Intergenic
929825584 2:45307053-45307075 TAGGAAAGTACAAGGGTTTCAGG + Intergenic
931378816 2:61733151-61733173 TAGAGAAGTAAAAGAGTGGCTGG + Intergenic
933394369 2:81712566-81712588 TGGGCAATGACAGGGGTGGCTGG + Intergenic
933791972 2:85890012-85890034 TAAGAAAGTAAAGTGGTGGCTGG + Intergenic
935564198 2:104589457-104589479 TGGGGGATGACAGGGGTGGCTGG + Intergenic
936148302 2:109996450-109996472 TGGGGAGGTCCAGGGGTTGCAGG + Intergenic
936196375 2:110374918-110374940 TGGGGAGGTCCAGGGGTTGCAGG - Intergenic
936610333 2:113996316-113996338 AAGGGAATTACAGTGTTGGCTGG - Intergenic
936710150 2:115122263-115122285 CAGGGAAAAACAGGGGTGGGAGG - Intronic
937078526 2:119124429-119124451 GTGGGAAGGACAGGGGCGGCAGG + Intergenic
937336981 2:121068180-121068202 TAGGGAAGGACAAGTATGGCAGG - Intergenic
938084655 2:128390852-128390874 TAGGGACCTCGAGGGGTGGCAGG - Intergenic
938162441 2:128997765-128997787 TTGGGAAGTATAGGGATGCCAGG + Intergenic
939069183 2:137518678-137518700 TGGGCAATGACAGGGGTGGCTGG - Intronic
940039803 2:149348379-149348401 AGAGGAAGTACAGGGGTGGGTGG + Intronic
941330559 2:164173772-164173794 TGGGCAATGACAGGGGTGGCTGG + Intergenic
946424720 2:219587654-219587676 TAAGAAAGTAAAGTGGTGGCTGG + Intergenic
947740156 2:232481244-232481266 AAGGGAAGGAGAGGGGTGGTAGG - Intronic
948941833 2:241200704-241200726 TAGGGGAGTCCAGAAGTGGCAGG + Intronic
1168761460 20:352949-352971 GAGGGAAACACAGGGTTGGCCGG + Intronic
1168869599 20:1117200-1117222 CAGAGAGGTACAGGGCTGGCAGG + Intronic
1169387776 20:5165718-5165740 TAAGGAAGGACAGGGGCCGCTGG + Intronic
1169586673 20:7093439-7093461 TGGGCAAGCACTGGGGTGGCTGG - Intergenic
1170496466 20:16929988-16930010 TAGGAAAGTAGAAGGGTGGTGGG - Intergenic
1170569622 20:17625454-17625476 CAGGGAAGCACAGGTGGGGCCGG - Intronic
1170635577 20:18101293-18101315 GAGGGACTTACAGGGGTGGCAGG + Intergenic
1171329963 20:24328851-24328873 TTGGCAATTACAGGGGTGGCTGG + Intergenic
1171461692 20:25301646-25301668 CAGGGCAGTACAGAGGAGGCCGG + Intronic
1172764197 20:37342460-37342482 TGGGCAAGTACAGGGGCTGCAGG - Intergenic
1174301858 20:49588229-49588251 GAGGGAAGAGCAGGGATGGCAGG - Intergenic
1175284494 20:57828915-57828937 TAGGGCAGCACAGGGGCCGCTGG + Intergenic
1175295800 20:57907960-57907982 TGGGCAAAGACAGGGGTGGCTGG - Intergenic
1175514666 20:59561342-59561364 TAGGGCAGAACAAGGGTGGTAGG + Intergenic
1175573617 20:60042819-60042841 GAGGGAAGTTCAGGGGTGGGAGG + Intergenic
1176298294 21:5085911-5085933 TAGGGAGGTGCAGGGGTCCCAGG + Intergenic
1176667090 21:9697779-9697801 TGGGGAAGTAGAGCGATGGCGGG + Intergenic
1177001181 21:15615134-15615156 TAGTGAAATACAGTGGTGACTGG + Intergenic
1177913279 21:27057002-27057024 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1178005940 21:28219641-28219663 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1178425527 21:32476343-32476365 TAGGGAAGTTCAAGAGGGGCCGG + Intronic
1179710652 21:43211238-43211260 TAGAGGAGTAGAGGTGTGGCAGG + Intergenic
1180551787 22:16546733-16546755 TGGGGAGGTCCAGGGGTTGCAGG - Intergenic
1181181472 22:21071423-21071445 TAGGGAAGGGTAAGGGTGGCTGG + Intergenic
1181343457 22:22200606-22200628 TAGGGAAGGGGAGGAGTGGCAGG - Intergenic
1181352219 22:22267190-22267212 TGGGGAGGTCCAGGGGTTGCAGG + Intergenic
1182765824 22:32757631-32757653 AAGGGAGTTACAGTGGTGGCTGG + Intronic
1183849505 22:40572843-40572865 GATTGAATTACAGGGGTGGCGGG - Intronic
1184603461 22:45557574-45557596 TGGGCAATGACAGGGGTGGCTGG + Intronic
949970123 3:9397272-9397294 TTGGGAGGGAAAGGGGTGGCTGG - Intergenic
951229183 3:20157146-20157168 TTGGGAAGTTGAGGGGTGGGAGG + Intergenic
952216102 3:31279248-31279270 TAGGGAGTTAGAGGGGTTGCGGG - Intergenic
953309433 3:41863012-41863034 AAGGGAAGGACAGGCCTGGCTGG - Intronic
953982697 3:47420528-47420550 CAGGGCAGGGCAGGGGTGGCAGG + Intronic
956158330 3:66321615-66321637 TAGGGAAGTACAGATGAAGCAGG + Intronic
957754692 3:84470219-84470241 TGGGCAATTACAGGGGTGGCTGG - Intergenic
957754812 3:84471116-84471138 AAGGGAATTACAGTGTTGGCTGG + Intergenic
960975723 3:123172117-123172139 AAGGGAAGAACAGGGTTGGGTGG - Intronic
963630413 3:147724012-147724034 TGGGCAATGACAGGGGTGGCTGG - Intergenic
964501745 3:157355452-157355474 CAGGGAACTCTAGGGGTGGCTGG + Intronic
968618112 4:1591401-1591423 CTGGCAAGTACAGGGGTGGCTGG - Intergenic
970642731 4:18085215-18085237 TAGGCAAGGTCAGGGGTGGGGGG + Intergenic
972575817 4:40350352-40350374 TAGGCAAGGATAGGGGAGGCAGG - Intronic
972806022 4:42530120-42530142 TGGGTAATGACAGGGGTGGCTGG - Intronic
974565006 4:63569993-63570015 AAGGGAATTACAGTGTTGGCTGG + Intergenic
976025893 4:80687872-80687894 TGGGGAAGCACAGGGGGGTCAGG + Intronic
977533238 4:98225036-98225058 CAGGGAAGTGCAGTGGTGGTGGG - Intergenic
978182116 4:105811432-105811454 TATGGGAGTAAAGGAGTGGCAGG + Intronic
978341475 4:107724756-107724778 TGGGCAATGACAGGGGTGGCTGG + Intergenic
978772053 4:112466995-112467017 TGGGCAATGACAGGGGTGGCTGG + Intergenic
979138775 4:117146467-117146489 AAGGGAAATACAGTGTTGGCAGG + Intergenic
980629746 4:135415953-135415975 AAGGGAGTTACAGGGTTGGCTGG + Intergenic
980681884 4:136173147-136173169 CAGGGAAGTCCAGTGTTGGCTGG + Intergenic
983185172 4:164692366-164692388 TGGGCAATGACAGGGGTGGCTGG - Intergenic
985737276 5:1591504-1591526 TAGGGAAGAAAAGGGATTGCTGG - Intergenic
986746380 5:10748407-10748429 TAGGGAAGGTCAGGGTTGTCGGG + Intronic
987121411 5:14771455-14771477 CAGGGAAGTCCAGCGGTGGCAGG - Intronic
987153287 5:15062459-15062481 TGGGCAATGACAGGGGTGGCCGG - Intergenic
987475921 5:18392525-18392547 TAGGGGATTACATGGGTGTCTGG - Intergenic
988714995 5:33816728-33816750 GAGGAAAGCACAGGGGTGTCTGG + Intronic
989002549 5:36776220-36776242 TGAGTAAGTACTGGGGTGGCTGG - Intergenic
990332167 5:54738874-54738896 TGGGGAAGTAGAGAGGAGGCAGG - Intergenic
990921112 5:60968846-60968868 GAGGGTAGTAGAGGGGTGGTGGG - Intronic
991946246 5:71900917-71900939 TGGGCAAGGACAGGGGTGGCTGG - Intergenic
992171020 5:74102246-74102268 GAGGGAAGTAGAGGGGGGGAGGG - Intergenic
992217824 5:74543178-74543200 GAGGGAAGTTCACGGGTGACGGG + Intergenic
993231679 5:85245863-85245885 AAGGGAGTTACAGGGTTGGCTGG - Intergenic
993791882 5:92219701-92219723 TGGGCAATGACAGGGGTGGCTGG - Intergenic
995675750 5:114660537-114660559 ATGGGATGGACAGGGGTGGCTGG - Intergenic
996375707 5:122804659-122804681 TATGGAAGTACAAATGTGGCCGG - Intronic
996835248 5:127784505-127784527 AAGGGAGGTACAATGGTGGCAGG + Intergenic
997328642 5:133043198-133043220 TAGGGAAGTAGATGGTGGGCAGG - Intergenic
997569403 5:134914610-134914632 TAGGGAAGTACAGTTGTGATGGG + Intronic
998815824 5:146013312-146013334 TTGGGAAGCACAGGGGCTGCTGG + Intronic
999351476 5:150875624-150875646 TGGGCAATTACAGGGGTGGCTGG - Intronic
1000024350 5:157346014-157346036 TGGGGAAGTGTAGGGGTGGGAGG - Intronic
1000417071 5:160994693-160994715 TGGGTGATTACAGGGGTGGCTGG - Intergenic
1002483932 5:179522334-179522356 GAGGGAACTGCAGGGGTGGGTGG + Intergenic
1002500631 5:179645147-179645169 GAGGGAACTGCAGGGGTGGGTGG - Intergenic
1003378137 6:5598043-5598065 TGGGCAAGGAAAGGGGTGGCAGG - Intronic
1003848461 6:10198102-10198124 TAGGGAAGAACTGGGTTGGCTGG - Intronic
1004173117 6:13314314-13314336 TAGGGAATTGCAGGGATGGGGGG + Intronic
1005897805 6:30192672-30192694 TAGAGAAATACAGGTGAGGCTGG - Intronic
1006088950 6:31616521-31616543 CAGGTAAGTACAGGGGAGGTTGG - Intronic
1007523771 6:42473241-42473263 GAGGGAGGTACAGAGGGGGCTGG - Intergenic
1007623871 6:43231398-43231420 TAGGGAAGTAAGAGGGTGACAGG - Intergenic
1008996345 6:57664633-57664655 TCGGCAATGACAGGGGTGGCTGG - Intergenic
1009184866 6:60563426-60563448 TTGGCAATGACAGGGGTGGCTGG - Intergenic
1009851817 6:69208163-69208185 TGGGCAATAACAGGGGTGGCTGG + Intronic
1010818731 6:80389201-80389223 TAGGTGATAACAGGGGTGGCTGG - Intergenic
1010938142 6:81885631-81885653 TAGGCAATGACACGGGTGGCTGG + Intergenic
1011039247 6:83012508-83012530 TGGGCAATGACAGGGGTGGCTGG + Intronic
1012408391 6:98927643-98927665 TAGGGCAGTCCATGGCTGGCTGG + Intronic
1013219900 6:108068875-108068897 TAAGGAAGTACACAGGTGCCAGG - Intronic
1013295283 6:108753388-108753410 TGGGGAGGTATAAGGGTGGCTGG - Intergenic
1015191267 6:130475080-130475102 AAGGGAGCTACAGTGGTGGCTGG - Intergenic
1015443186 6:133271770-133271792 TGGGCAATGACAGGGGTGGCTGG + Intronic
1016576161 6:145571796-145571818 TGGGCAATGACAGGGGTGGCTGG + Intronic
1017788624 6:157776211-157776233 TTGGGAAGCACAGGGGCGACAGG + Intronic
1018534928 6:164809713-164809735 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1018811395 6:167300708-167300730 TGGGGAAGCACAGGCCTGGCTGG - Intronic
1018890172 6:167977243-167977265 CAGGGAAGTCCAGGGGTGGGAGG - Intergenic
1019109080 6:169695348-169695370 TGGGGAAGAACAGGTTTGGCAGG + Intronic
1021334076 7:19376679-19376701 TATGGACGTACAGAAGTGGCAGG - Intergenic
1022529539 7:31058217-31058239 TTGGACAGTACAGGGATGGCTGG + Intronic
1025115762 7:56256535-56256557 TGGGGCAGTCCAGGAGTGGCAGG + Intergenic
1026200163 7:68207425-68207447 TGGGGCAGTCCAGGAGTGGCAGG + Intergenic
1027614981 7:80411079-80411101 TAGGTCAGTTGAGGGGTGGCCGG - Intronic
1029711718 7:102303584-102303606 TAGGGAAGTGTAGGGGTGCTGGG - Intronic
1029896606 7:103990046-103990068 GAGGGAAGGAGAGGGGCGGCAGG + Intergenic
1030354638 7:108528398-108528420 TGGGGAAGTACAGGTGTGGCTGG - Intronic
1030931181 7:115524890-115524912 TTGGCAATGACAGGGGTGGCTGG + Intergenic
1032185622 7:129722819-129722841 TCAGGATGTACAGGAGTGGCAGG + Intronic
1033642188 7:143272191-143272213 TAGGGAAGTACAGGGAGGGAGGG - Intergenic
1034274148 7:149816752-149816774 CAGGCAAGTCCAGAGGTGGCAGG - Intergenic
1034367146 7:150560858-150560880 TAAGCAAGGACAGGTGTGGCTGG + Intergenic
1035146410 7:156821779-156821801 TGGGCAATGACAGGGGTGGCTGG - Intronic
1035243938 7:157550354-157550376 GAGGGAACGGCAGGGGTGGCGGG + Intronic
1035689719 8:1552107-1552129 CAGGGAAGTCCAGGAGTGGGTGG - Intronic
1035695263 8:1591241-1591263 TAGGGAATTACAGGGAAGGGAGG + Intronic
1036147163 8:6264644-6264666 TAAGATAGTACAGTGGTGGCCGG - Intergenic
1037281395 8:17246608-17246630 TAGGGAAGTAGAAAGGGGGCGGG - Exonic
1037888247 8:22606462-22606484 GAGTGAAGTACAGGTGTGGTGGG - Intronic
1038934204 8:32230401-32230423 CTGAGAAGTGCAGGGGTGGCAGG - Intronic
1039527156 8:38226974-38226996 TGGGCAATGACAGGGGTGGCAGG + Intronic
1040460614 8:47644235-47644257 TATGCAAGTAAAGGGATGGCTGG - Intronic
1042047077 8:64665221-64665243 TCAAGAAGTACAGGGGTGGGAGG + Intronic
1042182345 8:66103670-66103692 TAAGGAAGTGCTGGGGTGGCGGG - Intergenic
1043732045 8:83694675-83694697 AAGGGAATCACAGAGGTGGCTGG + Intergenic
1049201613 8:141343323-141343345 CAGGAAAGAACAGGGGGGGCTGG - Intergenic
1049589708 8:143451868-143451890 GCGGGAAGTACAGGGATGGTAGG - Intronic
1050906577 9:11013065-11013087 CAAGGAAGTGCAGGTGTGGCTGG - Intergenic
1052100938 9:24445621-24445643 TGGGCAATGACAGGGGTGGCAGG + Intergenic
1055051885 9:71989629-71989651 TAGGGAAGTCCAAGGGAGTCTGG - Intergenic
1056156777 9:83845996-83846018 TGGGCAATGACAGGGGTGGCTGG - Intronic
1056353759 9:85777530-85777552 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1056579859 9:87882914-87882936 TAGGGAAGGGCAGGGCAGGCAGG + Exonic
1057004843 9:91548008-91548030 TGGGAAATGACAGGGGTGGCTGG + Intergenic
1057207926 9:93184521-93184543 TAGGGAAGCCCGGGGGTGGGAGG - Intergenic
1057722608 9:97545101-97545123 TAGAGGAATACATGGGTGGCTGG - Intronic
1058020134 9:100077730-100077752 AAGGGAGGTACAGTGTTGGCTGG + Intronic
1058823224 9:108752021-108752043 TTGAGAAGGACAGGGGTGGTGGG + Intergenic
1058985702 9:110207260-110207282 TGGGGAAGAGCAGGGGAGGCGGG - Intronic
1060030831 9:120213498-120213520 TAGAGGAGAACAGAGGTGGCTGG + Intergenic
1060292589 9:122318220-122318242 TTGGGAAGTAGTGGGGTGGGGGG - Intronic
1061382740 9:130268221-130268243 GAGGGAAGAGCAGGGGTGGGAGG - Intergenic
1061423430 9:130484403-130484425 TAGGGGTGGCCAGGGGTGGCTGG - Intronic
1203659006 Un_KI270753v1:23983-24005 TGGGGAAGTAGAGCGATGGCGGG - Intergenic
1185474261 X:404382-404404 CAAAGAAGTGCAGGGGTGGCCGG - Intergenic
1188472941 X:30560647-30560669 AAAGGAAGTACAGGGGTGGGGGG + Intronic
1189606318 X:42681927-42681949 TGGGGCAGTACAGTGGTGGTGGG + Intergenic
1189689995 X:43606683-43606705 TTGGGAAATACAGTGGTGGATGG - Intergenic
1190476515 X:50833361-50833383 TAGAAAAGAACAGGGCTGGCCGG + Intergenic
1191095609 X:56670382-56670404 TGGGAAATGACAGGGGTGGCTGG + Intergenic
1191832656 X:65431529-65431551 TGGGCAATTATAGGGGTGGCTGG + Intronic
1192801799 X:74472914-74472936 TAGCAAAGCACAGTGGTGGCAGG - Intronic
1193356351 X:80523912-80523934 TAGGCGATGACAGGGGTGGCTGG - Intergenic
1194179373 X:90694249-90694271 AAGGGAGGTACAGTGTTGGCTGG - Intergenic
1194210514 X:91064030-91064052 AAGGGAATTACAGTGCTGGCTGG + Intergenic
1194604276 X:95961063-95961085 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1195100843 X:101552544-101552566 TCTGGAAGGGCAGGGGTGGCAGG + Intronic
1195378949 X:104253716-104253738 TAGCGAAGGAAAGGGGTCGCTGG + Intronic
1196160266 X:112474880-112474902 CAGGGAGGTAGAGAGGTGGCAGG + Intergenic
1197084105 X:122452713-122452735 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1197182198 X:123548571-123548593 TAGGCAATGACAGGGGTGGCTGG - Intergenic
1199024484 X:142920514-142920536 TGGGCAATGACAGGGGTGGCTGG - Intergenic
1200101576 X:153691232-153691254 TGGGGACATAAAGGGGTGGCAGG + Intronic
1200521366 Y:4212814-4212836 TTGGGCAATACAGGGGTGGCTGG - Intergenic
1200526039 Y:4276422-4276444 AAGGGAGGTACAGTGTTGGCTGG - Intergenic
1200745820 Y:6903189-6903211 AAGGGAGTTACAGTGGTGGCTGG - Intergenic
1201529561 Y:14977118-14977140 TGGGCAATGACAGGGGTGGCTGG + Intergenic
1201690092 Y:16753478-16753500 TATGGAAATTAAGGGGTGGCTGG - Intergenic
1201987426 Y:19985293-19985315 TGGGGCAGGGCAGGGGTGGCGGG + Intergenic