ID: 1166382406

View in Genome Browser
Species Human (GRCh38)
Location 19:42361935-42361957
Sequence ATCTATTACCAAATGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166382395_1166382406 16 Left 1166382395 19:42361896-42361918 CCAGCGTCTCCAGCCTGGGTGAC 0: 1
1: 4
2: 39
3: 336
4: 2263
Right 1166382406 19:42361935-42361957 ATCTATTACCAAATGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1166382398_1166382406 7 Left 1166382398 19:42361905-42361927 CCAGCCTGGGTGACAGGTGGATG 0: 1
1: 0
2: 14
3: 561
4: 10288
Right 1166382406 19:42361935-42361957 ATCTATTACCAAATGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1166382392_1166382406 29 Left 1166382392 19:42361883-42361905 CCTGGGGTGTGGTCCAGCGTCTC 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1166382406 19:42361935-42361957 ATCTATTACCAAATGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1166382400_1166382406 3 Left 1166382400 19:42361909-42361931 CCTGGGTGACAGGTGGATGTGGG 0: 1
1: 0
2: 0
3: 38
4: 343
Right 1166382406 19:42361935-42361957 ATCTATTACCAAATGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166382406 Original CRISPR ATCTATTACCAAATGGTGGT GGG Intronic
903299080 1:22365270-22365292 CTCTATTTCTGAATGGTGGTGGG + Intergenic
904926725 1:34055259-34055281 TTCTGTAACCAAATGGAGGTGGG + Intronic
905882109 1:41470690-41470712 ATTTATCCCCAAGTGGTGGTAGG + Intergenic
909247874 1:73311581-73311603 AACTATTAGCAAATGTTGATGGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910786864 1:91008425-91008447 ATCTACAAACAAATGGAGGTAGG + Intronic
910813803 1:91266464-91266486 ATCTATGACCAAATGGGTGTGGG - Intronic
910883930 1:91946701-91946723 ATCTAATACCAAATCCTAGTGGG + Intergenic
912073549 1:105843434-105843456 ATCTATTATCACATGGTGTGTGG - Intergenic
915433217 1:155883056-155883078 ATGTCTTACCACATGGTGGAGGG + Exonic
917381668 1:174417196-174417218 GTCCATTAATAAATGGTGGTTGG - Intronic
918309876 1:183278287-183278309 ATCTAGCACCAAATAGTGCTGGG - Intronic
918791629 1:188837727-188837749 ATCTATAAATAAATGGTGCTGGG + Intergenic
921650816 1:217675582-217675604 ATGTATTGCCAAATCTTGGTAGG + Intronic
924017750 1:239745650-239745672 ATCTACTTCTAAAGGGTGGTGGG - Intronic
1065600778 10:27366161-27366183 ATGTATTAACATATGATGGTTGG + Intergenic
1067373745 10:45708664-45708686 ATATACTAGCAAAAGGTGGTAGG - Intergenic
1067379939 10:45763569-45763591 ATATACTAGCAAAAGGTGGTAGG + Intronic
1067710398 10:48646588-48646610 ATTTTTTAACAAATGGTGTTGGG + Intronic
1067881574 10:50050430-50050452 ATATACTAGCAAAAGGTGGTAGG - Intergenic
1067887638 10:50104223-50104245 ATATACTAGCAAAAGGTGGTAGG + Intronic
1068229085 10:54147644-54147666 ATATAATACCAACTTGTGGTTGG + Intronic
1069576514 10:69533932-69533954 ATCTATGACCAAATGTCTGTGGG - Intergenic
1070667022 10:78352197-78352219 ATCTCTTAGATAATGGTGGTTGG + Intergenic
1073014721 10:100388820-100388842 ATCTATTGCCATATGTTGTTTGG - Intergenic
1073306252 10:102505101-102505123 ATTTATTTCCAACTGGAGGTGGG - Intronic
1077448320 11:2614611-2614633 GTCTTTTAACAAATGGTGCTGGG - Intronic
1081018872 11:37917692-37917714 ATCTATAACCAAATTCTTGTTGG + Intergenic
1081019237 11:37922717-37922739 ATCTACTACCAAATGCTGGGGGG + Intergenic
1081507268 11:43731677-43731699 ATCTGTTTCCAAATTCTGGTGGG - Intronic
1085828287 11:79871629-79871651 ATCGAAGACCAAATGGTTGTAGG - Intergenic
1089039048 11:115428302-115428324 ATGTATTGCCACATGGTAGTAGG - Intronic
1097475441 12:60049934-60049956 ATCTATTAATAAATTGTGGCTGG - Intergenic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1099880587 12:88462415-88462437 CTCTATTAATAAATGGTGTTAGG - Intergenic
1100925587 12:99544158-99544180 AGATATTACCATGTGGTGGTTGG - Intronic
1105491965 13:20897522-20897544 AAATATTAGCAAATGTTGGTTGG - Intronic
1106182819 13:27383115-27383137 ATATATTACCAAATGCTGGAGGG - Intergenic
1106310729 13:28551858-28551880 ATCTTTTACAAAATGGTGGGGGG - Intergenic
1107204868 13:37772242-37772264 ATCTATTACCTAAGAGTGGGAGG + Intronic
1109198176 13:59402253-59402275 GTGTATTACCAACTGGTTGTAGG + Intergenic
1110154504 13:72298186-72298208 ATCTATTTCCAAATGAGGTTAGG + Intergenic
1112883274 13:104135576-104135598 TTATATTACCAAATGCTGGTGGG - Intergenic
1114331658 14:21643026-21643048 ATCTAATAGCAAATGCTGCTGGG + Intergenic
1120698831 14:87675363-87675385 TTCTATTGCCAAATGCTTGTGGG - Intergenic
1121572079 14:94953951-94953973 AGCTATTTCCAAAGGTTGGTGGG - Intergenic
1128591141 15:68898485-68898507 ATCTTTTTCCTAATGGTAGTAGG - Intronic
1134566213 16:15254169-15254191 ATTTACTACCAAATGATAGTGGG + Intergenic
1134736282 16:16502529-16502551 ATTTACTACCAAATGATAGTGGG - Intergenic
1135167900 16:20156773-20156795 CTCTAGGACAAAATGGTGGTAGG + Intergenic
1135454307 16:22584336-22584358 ATCAATTACTAAAATGTGGTAGG + Intergenic
1137227773 16:46531760-46531782 ATCTCTGACCAAATGTTGGTGGG + Intergenic
1146012481 17:29206993-29207015 TTATATAACCAAATGGTGGGGGG + Intergenic
1148102040 17:45098168-45098190 ATCTATTTCCAAAGGAAGGTGGG - Intronic
1149293000 17:55235412-55235434 ATCTATATCCACAGGGTGGTGGG + Intergenic
1153499145 18:5730554-5730576 AGCTATTTCCAAGTGGTGGATGG - Intergenic
1154141597 18:11828867-11828889 ATCTATTCTCATATGGTTGTGGG + Intronic
1155672852 18:28392953-28392975 GTCAATTACCAGATGGTTGTAGG - Intergenic
1158005455 18:52667255-52667277 ATCTACTACCATTTGGGGGTTGG - Intronic
1160626125 18:80207528-80207550 AAGTATTATCAAATGGTGATTGG - Intronic
1165536685 19:36453547-36453569 ATCTATTAGCAAATGATTGTAGG - Intronic
1166382406 19:42361935-42361957 ATCTATTACCAAATGGTGGTGGG + Intronic
926366211 2:12135324-12135346 ATTTATTAATAAATGGTGTTGGG - Intergenic
928875517 2:36034087-36034109 ATCCATTTCTAAGTGGTGGTAGG - Intergenic
931049221 2:58391550-58391572 ATATATTACCATGTGGTGGCAGG + Intergenic
932840884 2:75081349-75081371 ATTTTTCACCATATGGTGGTGGG - Intronic
934049275 2:88196923-88196945 ATATGTTACTAAAGGGTGGTAGG + Intergenic
935130004 2:100254687-100254709 ATCTTTTAACCAATGGTGGTGGG + Intergenic
936496805 2:113029500-113029522 ATCTATTAGCAAAGATTGGTAGG - Intronic
937080661 2:119137424-119137446 ATCTATAAGCAAATGGGGGGAGG - Intergenic
938608707 2:132924016-132924038 ATCTTTTACCCACTGGTTGTGGG - Intronic
939096760 2:137841151-137841173 ACCTGTTTCCTAATGGTGGTTGG + Intergenic
941471043 2:165887325-165887347 AACTATTACCAACTGCTGATGGG + Intronic
942368956 2:175260188-175260210 AACTATCTCCAAAGGGTGGTTGG - Intergenic
943610444 2:190027148-190027170 CTCTTTTAACAAATGGTGTTGGG - Intronic
943783582 2:191851182-191851204 GTTTAATACCAAAAGGTGGTAGG + Intergenic
943847110 2:192664874-192664896 ATCTACTCACAAATGGGGGTAGG + Intergenic
944546663 2:200805576-200805598 ATGTATTTCCCAATGTTGGTGGG + Intergenic
1170427391 20:16248212-16248234 ATCAATTCCCAAAAAGTGGTAGG + Intergenic
1176052150 20:63125507-63125529 ATCTAAGACCACATGGTTGTGGG + Intergenic
1176078342 20:63259354-63259376 AACAATTCCAAAATGGTGGTGGG - Intronic
1180938674 22:19642430-19642452 ATCTGTTCCCAAAAGGAGGTGGG - Intergenic
1182980305 22:34664123-34664145 ATCATTTAACAAATGGTGCTGGG + Intergenic
949768167 3:7550101-7550123 ATCCATTACTAAGTGGGGGTGGG - Intronic
952181989 3:30926609-30926631 ATCTCTTAGCTAATGGTGTTTGG + Intergenic
952626743 3:35415034-35415056 ATCTACTAGCAAAAGCTGGTGGG - Intergenic
957414906 3:79889332-79889354 ATATTTTACAAAATGGTGCTGGG - Intergenic
959382443 3:105657689-105657711 CTATTTTACAAAATGGTGGTTGG - Exonic
961060588 3:123825255-123825277 ATCTATTAAGAAATGTTGGTAGG + Intronic
963177919 3:142321072-142321094 ATCTTTCAGCAAATGGTGCTGGG - Intronic
963988244 3:151622825-151622847 ATCTATTTCAAATTGGGGGTAGG + Intergenic
964644902 3:158948589-158948611 ATTTCTTACCAAGTGGTGCTCGG + Intergenic
965534062 3:169806190-169806212 GTCTTTTAACAAATGGTGTTAGG + Intronic
965548358 3:169938190-169938212 ATCTATTAACATATAGTTGTGGG - Intronic
966271623 3:178114598-178114620 ATCTTTCAACAAATGGTGGTGGG + Intergenic
967752596 3:193131289-193131311 GTCTATGACCAGTTGGTGGTAGG - Intergenic
967987166 3:195104018-195104040 AACTATTTCCAACTGGTGTTTGG + Intronic
972637770 4:40899505-40899527 ATCTATGACCAGATGGTCTTGGG + Intronic
974317453 4:60300360-60300382 TCCTATTAACAAATGGTGCTAGG + Intergenic
982752370 4:159177737-159177759 ATCTATACCCAAATGGTGAAGGG - Intronic
984139085 4:175979763-175979785 ATCAATTACAAATTTGTGGTTGG - Intronic
985984032 5:3498693-3498715 ATCTATTATTAAATGGTGCTGGG + Intergenic
986089106 5:4485801-4485823 ATCTTTCAACAAATGGTGCTGGG + Intergenic
987932186 5:24415448-24415470 AAATATTACATAATGGTGGTGGG - Intergenic
988521139 5:31946553-31946575 ATCTATCACTCACTGGTGGTAGG - Intronic
988917296 5:35907470-35907492 ATGTCTCACCAAATTGTGGTGGG + Intronic
994245898 5:97475970-97475992 GTGTATTTCCAAATGGTAGTTGG + Intergenic
998762286 5:145445854-145445876 AAATATTAGCAAATGCTGGTGGG + Intergenic
999665449 5:153908255-153908277 ATCTATTAAAAAAAAGTGGTTGG + Intergenic
1001121408 5:168983751-168983773 ATCTATTTCCAAAAGGTTTTTGG + Intronic
1001701979 5:173713207-173713229 TTCTATTTCCAAATGGATGTGGG + Intergenic
1003218708 6:4137216-4137238 ATATATTACAAAGTGGTAGTTGG + Intergenic
1004007908 6:11653794-11653816 TTTTATTACCACACGGTGGTGGG + Intergenic
1007668155 6:43528819-43528841 ATCTCTTACCATATGGAGGTAGG + Exonic
1011064859 6:83314151-83314173 ATATATTACTAAATTATGGTGGG + Intronic
1012163870 6:95923966-95923988 ATTTAGGACCAAATGGTGGGAGG + Intergenic
1015172837 6:130273175-130273197 ATATATTTACAAATGATGGTAGG + Intronic
1015647074 6:135403988-135404010 GCCTACTACCAAATGGTAGTAGG + Intronic
1016320205 6:142834764-142834786 ATTTACTACCAATTTGTGGTGGG + Intronic
1016413278 6:143806158-143806180 ATCTGTTAACAAATAGTGGCAGG - Intronic
1018234688 6:161712852-161712874 TTCTATGACCAGATGGTGGTGGG + Intronic
1020626946 7:10592872-10592894 ATGTTTTACAAAATGTTGGTGGG - Intergenic
1022879796 7:34574604-34574626 ATATATTACCTTATGGTGGCTGG + Intergenic
1023325175 7:39046933-39046955 GTCTGTTAACAAATGGTGCTGGG - Intronic
1024758989 7:52571443-52571465 ATCTATTACTAAGAGATGGTGGG - Intergenic
1028510036 7:91614395-91614417 ATTTATTATCAGTTGGTGGTGGG - Intergenic
1031340880 7:120599144-120599166 ATCTATTTTTAAATCGTGGTTGG + Intronic
1037870224 8:22487325-22487347 ACCTATTACAAAATGCTGGCTGG + Intronic
1039133059 8:34289849-34289871 ATCTATGAATAAATGGTGGTGGG + Intergenic
1039387541 8:37149325-37149347 ATCTATTCCAAAGTGGAGGTGGG + Intergenic
1040803318 8:51367419-51367441 CTATATTACCAATTGCTGGTGGG + Intronic
1045900786 8:107277506-107277528 ATCTATTTTGAAATGGTTGTGGG - Intronic
1045972304 8:108092706-108092728 CTCTATAACTAGATGGTGGTGGG - Intergenic
1045994673 8:108349033-108349055 ATATATTAATAAATGGAGGTGGG + Intronic
1050800506 9:9606687-9606709 TTCTATTACCCCCTGGTGGTTGG - Intronic
1054858172 9:69923583-69923605 ATTTCTTACCAAATTGTTGTAGG - Intergenic
1055269194 9:74536995-74537017 ATATATTACCAAGTGGTTGTAGG - Intronic
1055687722 9:78795338-78795360 ATCTGTTCCTAGATGGTGGTGGG - Intergenic
1056871130 9:90280381-90280403 ATCTTTTACCTAAGGGTTGTGGG - Intergenic
1187363082 X:18645790-18645812 TTCTATTACCAAATGAGGATGGG - Intronic
1188934501 X:36157264-36157286 ATCTATATCCAAATGTTGATGGG - Intergenic
1189054480 X:37685300-37685322 ATCTTTTCCCACTTGGTGGTGGG + Intronic
1191822662 X:65329782-65329804 CCCTATTACTAAATGGTGCTGGG - Intergenic
1193491627 X:82157123-82157145 ATCTCTTATAAAATGTTGGTGGG - Intergenic
1196944351 X:120809262-120809284 ATATATTTTCAATTGGTGGTTGG + Intergenic
1201367218 Y:13220904-13220926 CTCTGTTACTAAATGGTGCTGGG - Intergenic
1202101411 Y:21311866-21311888 ATCTTTTTCAAAATGATGGTAGG + Intergenic