ID: 1166383885

View in Genome Browser
Species Human (GRCh38)
Location 19:42369849-42369871
Sequence TCCACACATCTCCCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166383885_1166383892 -2 Left 1166383885 19:42369849-42369871 CCTGTCCCAGGGAGATGTGTGGA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1166383892 19:42369870-42369892 GAGACTTGGGGGACGCTGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 155
1166383885_1166383896 15 Left 1166383885 19:42369849-42369871 CCTGTCCCAGGGAGATGTGTGGA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1166383896 19:42369887-42369909 GCCTGGGTTTGGATCCCAGAGGG 0: 1
1: 0
2: 6
3: 42
4: 224
1166383885_1166383898 25 Left 1166383885 19:42369849-42369871 CCTGTCCCAGGGAGATGTGTGGA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1166383898 19:42369897-42369919 GGATCCCAGAGGGTCTGCCCTGG 0: 1
1: 0
2: 1
3: 25
4: 268
1166383885_1166383893 -1 Left 1166383885 19:42369849-42369871 CCTGTCCCAGGGAGATGTGTGGA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1166383893 19:42369871-42369893 AGACTTGGGGGACGCTGCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1166383885_1166383894 4 Left 1166383885 19:42369849-42369871 CCTGTCCCAGGGAGATGTGTGGA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1166383894 19:42369876-42369898 TGGGGGACGCTGCCTGGGTTTGG 0: 1
1: 0
2: 1
3: 23
4: 267
1166383885_1166383895 14 Left 1166383885 19:42369849-42369871 CCTGTCCCAGGGAGATGTGTGGA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1166383895 19:42369886-42369908 TGCCTGGGTTTGGATCCCAGAGG 0: 1
1: 0
2: 2
3: 29
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166383885 Original CRISPR TCCACACATCTCCCTGGGAC AGG (reversed) Intronic
900130239 1:1084284-1084306 CCCACAGAGCACCCTGGGACTGG + Intronic
902905383 1:19552898-19552920 GCCACACCTCTTCCTGGGTCAGG - Intergenic
903623276 1:24713568-24713590 CTCACACATTTTCCTGGGACAGG + Intergenic
905871171 1:41405364-41405386 CCCAGCCCTCTCCCTGGGACAGG - Intergenic
906102865 1:43274191-43274213 CCCTCACCTCTCCCTGGGACTGG - Intergenic
906288582 1:44604363-44604385 TCCAGACATCTCCCTGGGTTGGG - Intronic
906447100 1:45911168-45911190 GCCTAACATTTCCCTGGGACTGG - Intronic
907282293 1:53359059-53359081 TCCACACTTGTCCATGAGACTGG - Intergenic
912855615 1:113166449-113166471 CACACACATCTACCTGGGAAGGG - Intergenic
915497578 1:156292770-156292792 TCCACACATTTCCCTTGGATGGG - Exonic
915898310 1:159828222-159828244 TCCACACATCACCCTGCCCCAGG - Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916362779 1:163990081-163990103 TCAACTCATCTCACTGGGACTGG + Intergenic
917136862 1:171796374-171796396 TCCACCAGTCTCCCTGGGACAGG + Intronic
917406418 1:174711816-174711838 TCCACCCATGGCCCTGGCACAGG + Intronic
919358033 1:196551355-196551377 TCCCCACATCTACCTGCCACTGG - Intronic
920734323 1:208517040-208517062 TGCACACAGCACCCTGGGCCTGG + Intergenic
921708682 1:218352032-218352054 TGCACACCTCTCCCAGGGCCAGG - Intronic
922717648 1:227885633-227885655 TTTACCCATCTCCCTGGGGCAGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924212300 1:241783047-241783069 TTCATACATCTCCCTGGGAGAGG - Intronic
1062957964 10:1552555-1552577 TCAACACATCTACTGGGGACAGG + Intronic
1064181140 10:13116872-13116894 TCCTCACATCTACATAGGACAGG - Intronic
1065833203 10:29633287-29633309 AGCACACATCTGCCTGGCACTGG + Intronic
1069239726 10:66124242-66124264 TCCACAAATCTCTCTAGGGCAGG + Intronic
1069639264 10:69944293-69944315 TCCTCACAGCAGCCTGGGACAGG + Intronic
1070857653 10:79620011-79620033 TCCACACATACCCCTAGGAAGGG - Intergenic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1076119349 10:127923076-127923098 TCCAGGCCTCTGCCTGGGACAGG - Intronic
1076760167 10:132600314-132600336 TCCACACATCTCTAGGGCACGGG + Intronic
1077081686 11:727238-727260 GCCACAGAACTCCCTGGGGCTGG + Exonic
1079125388 11:17714781-17714803 TGCACACCTCGCCCTGGGCCTGG - Intergenic
1080599404 11:33807789-33807811 TCAAATCATCTCCCTGGGAGAGG + Intergenic
1081252310 11:40850751-40850773 AACTCCCATCTCCCTGGGACAGG - Intronic
1083146040 11:60759603-60759625 TTCCCACATGTCCCTGGGAATGG + Intronic
1083365510 11:62139461-62139483 TGCTCACATCTCCCTGAGAAGGG + Intronic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1088177064 11:107065707-107065729 TCCACACATCTCAAAGGGACAGG + Intergenic
1089294304 11:117458726-117458748 TCCAGGCCTCTCCTTGGGACAGG - Intronic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1090155285 11:124430856-124430878 TCCAAACATATCCCTGGAAGGGG - Intergenic
1092209190 12:6635496-6635518 ACCACACATCCCCCAGGGCCAGG - Intronic
1092954886 12:13540806-13540828 TCCACACTCCTCCCTGGGGCCGG - Exonic
1095959851 12:47827486-47827508 TGCAGACATCTCCCTTGGGCAGG + Intronic
1097149908 12:56969074-56969096 TTCCCACATGTCCCTGGGAATGG - Intergenic
1097910663 12:64965901-64965923 TCCATACATATCCCTAGGAAGGG - Intergenic
1105620667 13:22062925-22062947 TCCATGCAGCTCCCTGGGCCTGG - Intergenic
1106137734 13:26986675-26986697 ACCACACTTCTCCCAGGGCCAGG - Intergenic
1106361854 13:29038664-29038686 AACTCCCATCTCCCTGGGACAGG - Intronic
1106387561 13:29302510-29302532 TCCATACATATCCCTAGGAAGGG + Intronic
1107914587 13:45136173-45136195 TCCTCACATCTCTATGGAACAGG - Intronic
1108171558 13:47747301-47747323 TCCACACACTTCACTGGAACTGG + Intergenic
1108383722 13:49879185-49879207 TCAGCTCATCTCACTGGGACTGG + Intergenic
1112344060 13:98576405-98576427 ACCTCACTTCTCCCGGGGACAGG + Intronic
1113396695 13:109954664-109954686 TCCCCAGATCCCCATGGGACAGG - Intergenic
1114560850 14:23589430-23589452 TCTACACATCTCTGTGAGACTGG + Intergenic
1117954962 14:61115689-61115711 ACCCAAAATCTCCCTGGGACTGG - Intergenic
1118232054 14:63961590-63961612 TCCAAAGATGCCCCTGGGACTGG + Exonic
1118304905 14:64647592-64647614 TCCACCCATCTCCCTTGGAAAGG - Intergenic
1119307690 14:73620907-73620929 TCAAGACTTCTCCCTGGGCCGGG + Intergenic
1119805106 14:77477370-77477392 TCTGCACATCTCCAAGGGACTGG + Intronic
1120386752 14:83855930-83855952 TCCTGTCATCTCCCAGGGACAGG - Intergenic
1122079440 14:99256834-99256856 CCCACACCCCTGCCTGGGACCGG + Intronic
1122557666 14:102590458-102590480 TCCACACACAGCCCTGGGATTGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1124401120 15:29348434-29348456 TCCACACTGCTCCCTGAGTCGGG - Intronic
1124603184 15:31151486-31151508 GCCACACAGCTCCTTGGCACAGG + Intronic
1128360644 15:66959321-66959343 ACAACACACCTCCCTGGGCCAGG + Intergenic
1130954908 15:88621045-88621067 TCCACTCCTCTACCTGGGTCGGG - Intergenic
1130996873 15:88908937-88908959 TCCCCACATCTCCCTGAGGAGGG + Intronic
1131590829 15:93746824-93746846 TCCATACATTTCCCTAGGAAGGG + Intergenic
1131805310 15:96115791-96115813 TGCAAACATCTCCCTGGGGTTGG + Intergenic
1132209383 15:100008662-100008684 TGCCCAAGTCTCCCTGGGACAGG - Intronic
1132680960 16:1141587-1141609 TCCACACTGACCCCTGGGACTGG + Intergenic
1135534752 16:23284684-23284706 TCCTCACCTCTCCCTAGAACTGG - Intronic
1136364561 16:29803715-29803737 TCCTCACCCCTCCCTGGGACTGG - Intronic
1138544451 16:57707380-57707402 CCCAGACATCTCCCTGGGGCTGG - Intronic
1138567797 16:57846198-57846220 TCCACCCCTCTCCCTGGGTGGGG + Intronic
1141519885 16:84571649-84571671 TCCAATCATCCCCCTGGGATCGG + Intronic
1142550132 17:732988-733010 TCCCCACATCTGCCTGCGGCTGG + Intronic
1143129954 17:4671876-4671898 TCTCCACCTCTCCCTGGGAGGGG + Exonic
1146840883 17:36153384-36153406 GCCACCCATCTCCCTGGCTCTGG + Intergenic
1150958326 17:69887133-69887155 TACACACATGTCCCTGCGACAGG + Intergenic
1151375401 17:73685071-73685093 TGCACACCTCTCCCTGTGTCTGG - Intergenic
1151438851 17:74115281-74115303 ACCACAGATCTGCCTGAGACAGG - Intergenic
1151980823 17:77507414-77507436 TCCACTCACCTGCCTGAGACTGG - Intergenic
1152228164 17:79102203-79102225 TCCACACATATGCCTGGGTGAGG + Intronic
1153995284 18:10434775-10434797 TCCACACATTACCATGGGCCTGG + Intergenic
1154133899 18:11759765-11759787 TGCACACATCTCCCAAGGAGAGG - Intronic
1155188241 18:23406275-23406297 TTCACACATTTCCCTGGGCTGGG + Intronic
1157301461 18:46482796-46482818 TCTGCACCTCTCCCTGGGGCTGG - Intronic
1161627202 19:5334204-5334226 TCCTGACATCTCCCTGGTGCTGG + Intronic
1161716174 19:5877291-5877313 TCCACCCTTCTACCTGGGCCTGG + Intronic
1162822250 19:13230027-13230049 TACTCACCTCTCCCTGGAACTGG - Intronic
1163203231 19:15783083-15783105 TTCCCACATGTCCCTGGGAAGGG - Intergenic
1163604097 19:18264815-18264837 CCCAGACTTCTCCCTGGGAGAGG + Exonic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1164471361 19:28537382-28537404 TCCACATCTCTCACTGGGACTGG - Intergenic
1164563343 19:29309059-29309081 TACACACTTCTCCCAGGGAGGGG + Intergenic
1164815110 19:31192903-31192925 TCCACGCATCTCCCTGGCTTTGG - Intergenic
1165110509 19:33499487-33499509 GCCCTACATGTCCCTGGGACTGG + Intronic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
1167036624 19:46998799-46998821 TCCACACATCCCCGTTGGAGGGG - Intronic
925268377 2:2583393-2583415 TCCTCATCTCTCCCTGGGAGGGG - Intergenic
925317032 2:2934346-2934368 TCCCCGCATCTGTCTGGGACTGG + Intergenic
925650462 2:6084435-6084457 TCAACACATGTTCCTGGAACAGG - Intergenic
926724194 2:15984623-15984645 TCCACACGGCTCCCTGGGCATGG + Intergenic
927478087 2:23429294-23429316 TGCCCACATGTCCCTGGGAGAGG + Intronic
928220025 2:29395747-29395769 TCCTCACTCCTCCCTGGTACAGG - Intronic
929089150 2:38197614-38197636 TCCACAGAGCTCTCTGAGACAGG - Intergenic
929111557 2:38409174-38409196 TCCACCCACCTACCTGGCACAGG - Intergenic
932379500 2:71269480-71269502 TCCCTACATCTCCTTGGGAAGGG + Intergenic
932414722 2:71566667-71566689 TCCTGCCATCTCCCTGGGGCTGG + Intronic
934706372 2:96484454-96484476 TCCTGACATCTCCTTGTGACTGG + Intergenic
934992066 2:98928950-98928972 GCCACACCTCTCCATGGGGCTGG - Intronic
935313341 2:101806927-101806949 GCAGCACATCTCCCTGGGCCTGG + Intronic
936081576 2:109436040-109436062 TCCAGCCATCTCCCTGTGGCTGG - Intronic
938655274 2:133425150-133425172 TCCAAACATCTCCCTGGTTAGGG + Intronic
942867598 2:180694587-180694609 TCCATAGCTCTCCCTGTGACAGG + Intergenic
944440765 2:199741024-199741046 TCAACACAACTCCCTGAGGCAGG + Intergenic
946786065 2:223245969-223245991 TCCACTCCTCTTCATGGGACAGG - Intergenic
947049212 2:226023440-226023462 CCCACAAATCTCCCTGAAACTGG - Intergenic
948427735 2:237898456-237898478 TGCTCCCATCCCCCTGGGACTGG - Intronic
948953188 2:241268428-241268450 TCCACACACAGCCCAGGGACAGG + Intronic
1169041430 20:2498725-2498747 TCCTCACAACTCCCTGAGATGGG + Intronic
1173374154 20:42468520-42468542 TCCACACATCTCCATAGAGCAGG + Intronic
1174282647 20:49450374-49450396 TCCCCACCCCTCCCTGGCACAGG + Intronic
1176365354 21:6029577-6029599 TCCCCACATACCCCTGGGCCGGG + Intergenic
1178722624 21:35023447-35023469 TCCACCCACCCACCTGGGACAGG - Intronic
1179176020 21:39008941-39008963 TCCACCCCTCTCCCTGTGTCCGG + Intergenic
1179190591 21:39118901-39118923 TCCACCCATTTCCCTGGGTAGGG - Intergenic
1179525890 21:41975613-41975635 ACCCCACGTCTCCTTGGGACAGG - Intergenic
1179621354 21:42618235-42618257 TCCACACATCTGGCTGGGCGTGG + Intergenic
1180150779 21:45946144-45946166 TCAACACATCCCCCTGGCATGGG + Intergenic
1181679435 22:24483013-24483035 TCCACACATCCCTCTGGCTCAGG + Intergenic
1184116558 22:42426040-42426062 TCTACACTGCTCCCTGGGTCTGG - Intronic
1184226176 22:43130010-43130032 ACCACACCTCTCCCTGTGAGCGG - Intergenic
1184325801 22:43783372-43783394 CACACACCTCTCCCTGGGAATGG - Intronic
1184878655 22:47291304-47291326 TCCACACAGCCCCCTGGGATGGG + Intergenic
1184993002 22:48183208-48183230 TCCACACATCTCTGGGTGACTGG - Intergenic
949217138 3:1583539-1583561 GCCACGGATCTCCCTGGGAAAGG - Intergenic
952105617 3:30066112-30066134 TCCACAAATCTCCATGGCAGGGG + Intergenic
952257345 3:31706838-31706860 TCCACTCATTTCCCTGTCACAGG + Intronic
953264194 3:41370450-41370472 TCAGCTCATCTCACTGGGACTGG + Intronic
953407600 3:42667195-42667217 CCCACAGATCTCCTTGGGAGGGG - Intergenic
954045533 3:47926538-47926560 TCTACACATCTATCAGGGACAGG + Intronic
955870561 3:63433958-63433980 ACCACACACCTCCCTAAGACTGG + Intronic
956383027 3:68686076-68686098 AACTCCCATCTCCCTGGGACAGG - Intergenic
959308338 3:104697175-104697197 AGCTCACATCTCCCTGAGACTGG + Intergenic
960760170 3:121064313-121064335 TCAGCTCATCTCACTGGGACTGG - Intronic
964335461 3:155649571-155649593 ATCACACAGCACCCTGGGACAGG + Intronic
966493631 3:180556090-180556112 CCCATTCATCTCACTGGGACTGG + Intergenic
967089145 3:186120254-186120276 TGCCCACATCTACCTGGCACTGG - Intronic
967566495 3:190979500-190979522 TCCACACATCTCTAGGGCACAGG - Intergenic
968598828 4:1499609-1499631 GCCACGCCTCCCCCTGGGACAGG + Intergenic
968673445 4:1864427-1864449 TGCACACATCTCCATGGAAACGG + Intergenic
968952494 4:3702231-3702253 GCCACACATCTCCCGAGGGCAGG + Intergenic
970692588 4:18636632-18636654 AACACAGATCTCCCTGGGAATGG - Intergenic
971318930 4:25589620-25589642 TGCACAAATCTCCCTGTGCCAGG - Intergenic
971430029 4:26556143-26556165 AACTCCCATCTCCCTGGGACTGG - Intergenic
974031324 4:56779311-56779333 TTCACACATCTCCCAGGGAATGG - Intergenic
975153441 4:71045184-71045206 TCCGTACATATCCCTGGGAAGGG + Intergenic
976123542 4:81808601-81808623 TCCACTCATTTCCATGGGGCAGG + Intronic
978118381 4:105049686-105049708 TCCATACATACCCCTGGGAAAGG + Intergenic
979128925 4:117014467-117014489 TCCAAACATTTCCCTGGCATGGG + Intergenic
980563078 4:134502177-134502199 TGCAGACATCTGCATGGGACTGG + Intergenic
980729825 4:136811608-136811630 TCCACTCTGGTCCCTGGGACTGG + Intergenic
982075932 4:151737322-151737344 TCCACACATCTCCAGGGCAGGGG - Intronic
983133977 4:164056863-164056885 ACCTCCCATCTCCCTAGGACAGG + Intronic
983398609 4:167234556-167234578 TCCACTCAGCTCCCTGCGCCCGG + Exonic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
988336097 5:29910453-29910475 TCCACAAATCTCTCTGGCAGGGG + Intergenic
992473858 5:77083384-77083406 CCCATTCATCTCCCTGGCACAGG + Intronic
993901977 5:93590348-93590370 TCCTCACCTCTCTCTGGGAAAGG - Intronic
994774293 5:104024757-104024779 TGCACACATCGCCCCGGGCCAGG + Intergenic
997713034 5:136022231-136022253 TCCTCATATTTCACTGGGACAGG - Intergenic
998200966 5:140120266-140120288 TACACACATCTCCTTGAGAGTGG + Exonic
999150866 5:149424974-149424996 TCCACAAAGCTCCATGGGAAGGG - Intergenic
999754429 5:154653760-154653782 TCCACACATCCACTTGGGATTGG + Intergenic
1001299810 5:170525352-170525374 TCCACACAACTCTATGGGGCAGG - Intronic
1005534172 6:26738026-26738048 TCCACATAGCCCACTGGGACTGG + Intergenic
1005536623 6:26763628-26763650 TCCACATAGCCCACTGGGACTGG - Intergenic
1005807790 6:29491198-29491220 TCCATCCATCTTCCTGAGACAGG - Intergenic
1005886965 6:30104289-30104311 TCCACACTTCCCCCTGGGTGGGG - Intronic
1005916110 6:30352960-30352982 TCCTCCCATCTGCCTGGGCCTGG + Intergenic
1007488226 6:42197341-42197363 CCCACACATCTCACTGGGGCCGG - Intergenic
1007805812 6:44445029-44445051 TCCACATTTCTCCCTGGAAGGGG - Intronic
1007928381 6:45668495-45668517 GCCACATACCTCCCAGGGACTGG + Intergenic
1008785146 6:55158823-55158845 AACTCCCATCTCCCTGGGACAGG + Intronic
1009007523 6:57806042-57806064 TCCACATAGCCCACTGGGACTGG - Intergenic
1010447090 6:75960211-75960233 CCAACTCATCTCACTGGGACTGG - Intronic
1010819353 6:80395472-80395494 TCCACACATCTCTCTGGTAGGGG - Intergenic
1011329953 6:86193069-86193091 TCTTCATTTCTCCCTGGGACTGG - Intergenic
1011522852 6:88228752-88228774 TCCATACTGCTGCCTGGGACTGG - Intergenic
1013669957 6:112390160-112390182 TCCAAAGATATCCCTGGGAAGGG + Intergenic
1013956826 6:115852102-115852124 TCAGCGCATCTCACTGGGACTGG + Intergenic
1014315172 6:119855638-119855660 TCCACCCATGTCCCTGGAAAGGG - Intergenic
1015695593 6:135976423-135976445 TCCACACCTCTACCTGGGGAAGG + Intronic
1016388089 6:143548539-143548561 TCCACACACCAGCCTGGGCCAGG + Intronic
1016424082 6:143915729-143915751 TCCACACATCTCTATGGCAGGGG - Intronic
1018924396 6:168196122-168196144 TCCTCACATCTGCCTGGAAGTGG + Intergenic
1020852693 7:13377129-13377151 TCCCAACTTCTCCCTGGAACAGG - Intergenic
1021013110 7:15496139-15496161 TCCACTCATCTCCATGAGAGGGG - Intronic
1021561415 7:21972128-21972150 CCCACTCAGGTCCCTGGGACTGG + Intergenic
1022500740 7:30881082-30881104 TGCAAACATCTCCCTGGGGCTGG + Intronic
1024138059 7:46430619-46430641 TCCACACATCTCTAGGGGAAGGG + Intergenic
1024792706 7:52984966-52984988 TCCACACATCTCCAGGGAAGGGG - Intergenic
1026834143 7:73627023-73627045 TCCACCCACCTCCCTTGGCCGGG + Intergenic
1028892691 7:96006050-96006072 TCCACACAAATTCCTGTGACAGG - Intronic
1029995181 7:105000926-105000948 GCCACCCCTATCCCTGGGACAGG + Intergenic
1032659708 7:133969966-133969988 AACTCCCATCTCCCTGGGACAGG - Intronic
1037730973 8:21523892-21523914 TCCACACATCTCCCAGGGGCTGG - Intergenic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1040400497 8:47045223-47045245 TCCATACATATCCCTAGGAAGGG + Intergenic
1041602137 8:59731729-59731751 CCCTCACATGCCCCTGGGACTGG - Intergenic
1043295095 8:78652497-78652519 TCCTCCCATCTGCCTGGGGCTGG + Intergenic
1043385901 8:79747650-79747672 TCCAGACATCTTCCTGGGCAAGG - Intergenic
1049746713 8:144266179-144266201 TCCTCCCCTCTCCCGGGGACGGG + Intronic
1049979666 9:892523-892545 CCCCCACATGTCCCTGGAACAGG + Intronic
1050274590 9:3983693-3983715 TCCACACATCTCTATGGCAGGGG - Intronic
1051726102 9:20089284-20089306 TCCACACTTCTCACTGGGGAGGG + Intergenic
1051863354 9:21651475-21651497 AACTCCCATCTCCCTGGGACAGG - Intergenic
1053574433 9:39344586-39344608 TCCACACATCTCCAGGGCAGGGG - Intergenic
1053838997 9:42172834-42172856 TCCACACATCTCCAGGGCAGGGG - Intergenic
1054117460 9:61179215-61179237 TCCACACATCTCCAGGGCAGGGG - Intergenic
1054590295 9:67003351-67003373 TCCACACATCTCCAGGGCAGGGG + Intergenic
1057185018 9:93052697-93052719 TCCACCCTTGGCCCTGGGACAGG + Intergenic
1057939201 9:99266108-99266130 TCCATCCAGCTCCCTGGGAAGGG - Intergenic
1060295302 9:122339149-122339171 TCTCCTCATCTCCCTGGGTCTGG + Intergenic
1061887947 9:133602188-133602210 GCCACACTTCTACCTGGGTCTGG + Intergenic
1062409053 9:136412972-136412994 TCCACACCTCCCGCTGGGAGGGG - Intronic
1062444676 9:136588604-136588626 TCCAAACATCTCCCTGTCTCCGG - Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1186700830 X:12088011-12088033 TTAACAAAGCTCCCTGGGACAGG - Intergenic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1189322240 X:40094171-40094193 TCCACCCAGCTCGCTGGGCCCGG + Intronic
1189581819 X:42414419-42414441 TCCACACATACCCCTAGGAAGGG - Intergenic
1192068258 X:67909858-67909880 CCCACACCTCTCCCTCAGACAGG - Intergenic
1192277535 X:69648738-69648760 TCCATACATGTCCCTAGGAAGGG - Intronic
1192373786 X:70538456-70538478 GCCTCACGTCTCCCTGAGACTGG - Intronic
1193556779 X:82963534-82963556 TCTACACAACTGCTTGGGACAGG - Intergenic
1194419837 X:93660534-93660556 TCAGCTCATCTCACTGGGACTGG + Intergenic
1194559585 X:95403918-95403940 AACTCCCATCTCCCTGGGACAGG + Intergenic
1196281273 X:113825857-113825879 CCGACTCATCTCACTGGGACTGG - Intergenic
1198036610 X:132807239-132807261 TATTCACATCTTCCTGGGACAGG - Intronic
1199932025 X:152532469-152532491 TCCACAAATCTCTTTGAGACAGG - Intergenic
1200599011 Y:5182973-5182995 TCCGCACATATCCCTAGGAAGGG - Intronic
1201863452 Y:18624660-18624682 TCCTCCCATCTGCCTGGGGCTGG - Intergenic
1201869870 Y:18695718-18695740 TCCTCCCATCTGCCTGGGGCTGG + Intergenic