ID: 1166384287

View in Genome Browser
Species Human (GRCh38)
Location 19:42371516-42371538
Sequence CCTGACCTCCACAAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166384287_1166384297 3 Left 1166384287 19:42371516-42371538 CCCTACACCTTGTGGAGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1166384297 19:42371542-42371564 GGGATGAGGTAGCCAGGCTCGGG 0: 1
1: 0
2: 2
3: 26
4: 260
1166384287_1166384296 2 Left 1166384287 19:42371516-42371538 CCCTACACCTTGTGGAGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1166384296 19:42371541-42371563 TGGGATGAGGTAGCCAGGCTCGG 0: 1
1: 0
2: 1
3: 32
4: 286
1166384287_1166384295 -3 Left 1166384287 19:42371516-42371538 CCCTACACCTTGTGGAGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1166384295 19:42371536-42371558 AGGGCTGGGATGAGGTAGCCAGG 0: 1
1: 0
2: 3
3: 56
4: 425
1166384287_1166384298 7 Left 1166384287 19:42371516-42371538 CCCTACACCTTGTGGAGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1166384298 19:42371546-42371568 TGAGGTAGCCAGGCTCGGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 220
1166384287_1166384300 20 Left 1166384287 19:42371516-42371538 CCCTACACCTTGTGGAGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1166384300 19:42371559-42371581 CTCGGGCAGGACTGACAACATGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166384287 Original CRISPR CCTGACCTCCACAAGGTGTA GGG (reversed) Intronic
901293166 1:8140380-8140402 CTTGACCTCCCTAAGGTGTCTGG + Intergenic
901364429 1:8733716-8733738 CCTGACCCACAAAAGGTGTGTGG + Intronic
901936876 1:12632946-12632968 CCTGACCTCCGCTAGATGTGAGG - Intergenic
903199212 1:21719638-21719660 CCTGACCTCCCAAAAGTGTTGGG - Intronic
906926694 1:50125494-50125516 CCTGACCTGCATGTGGTGTAAGG + Intronic
915900773 1:159845241-159845263 CCTCACCTCCACAATCTATATGG + Intronic
916650288 1:166828817-166828839 CCTAAACTCCAAAAGGAGTAGGG - Intergenic
923086332 1:230705984-230706006 TCTGACCTGGACAAGGTGGAGGG - Exonic
924267198 1:242294965-242294987 CCTGACCTTAAAAAGGTGCATGG + Intronic
924502506 1:244650911-244650933 CTTGACCTCTACATGGTGAAGGG + Intergenic
1065901161 10:30209423-30209445 CCAGACCTAAACAAGGTCTATGG + Intergenic
1066717620 10:38303541-38303563 CCTGACCTTAAAAAGGTGCATGG - Intergenic
1067668282 10:48296945-48296967 CCTGACATTCACAAGGTATTTGG + Intergenic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1075275157 10:121086449-121086471 CCTGGCCTCCCCAAGGTGTGGGG - Intergenic
1075741556 10:124699298-124699320 CCTGACATCCACTGGGTGTGTGG - Intronic
1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG + Intronic
1083816620 11:65135951-65135973 CCTCAGCCCCACAAGGTGTTGGG + Intergenic
1084794170 11:71493386-71493408 CATGAGCTCAACAAGGTGCAGGG - Intronic
1087061358 11:93981666-93981688 TCTGACCTCCCCAAGGTCTGGGG - Intergenic
1091593405 12:1858718-1858740 CCTTACCAACACTAGGTGTATGG + Intronic
1091977482 12:4837068-4837090 CCTGCCCCCCACAAGGGGTGAGG + Intronic
1093211949 12:16318325-16318347 CCTCAGTTCCACAAGGTGGAAGG - Intergenic
1094809545 12:34124135-34124157 CCAGACCTACACAATATGTAGGG - Intergenic
1095505585 12:42894560-42894582 ACTGAACTCTACAAGGTGTCAGG + Intergenic
1100680501 12:96914767-96914789 CCTGAACTGCTCAAGGTGCAAGG - Intronic
1101718012 12:107328043-107328065 CATGGCCTCCACTAGATGTAAGG + Intronic
1102131738 12:110536293-110536315 CCTGATCTCCAGGAGGGGTAGGG - Exonic
1106058336 13:26260488-26260510 CCTCACCTCCATGAGGTGTAAGG + Intronic
1108015226 13:46067841-46067863 CTTGAGCTCCACAAGTTCTAAGG - Intronic
1118361979 14:65064515-65064537 CCTGACCCCAACAGGATGTAGGG - Intronic
1119294422 14:73521427-73521449 CCTGTCCACCACCAGGTGGATGG - Intronic
1120408587 14:84121040-84121062 CCTGAAGCCCACAAGGTGGAGGG + Intergenic
1121740918 14:96251841-96251863 CCTGGCCCCCACAAGGGGTTTGG + Intronic
1121905002 14:97731672-97731694 CCTAACCTCCACATTGTTTAAGG - Intergenic
1123212810 14:106777155-106777177 ACTGACTTTCACAAGATGTAAGG - Intergenic
1125573141 15:40736452-40736474 CCTGATCTCAGCAAGGTCTAAGG + Exonic
1130881736 15:88061418-88061440 GCTGCCCTCCACAAGGTGTGGGG + Intronic
1134039521 16:11057769-11057791 CTTGACCTCCAAAAGATTTAAGG - Intronic
1134323798 16:13188412-13188434 CCTGACCTCAGAAAGGTGTGGGG + Intronic
1140254265 16:73321385-73321407 CCTGACCTCCTCAGGTTGTTGGG + Intergenic
1141548500 16:84788300-84788322 TCTGACGTTCACAAGCTGTATGG + Intergenic
1144718166 17:17448900-17448922 ACTGACCTCCACATGCTGCAGGG + Intergenic
1147610781 17:41800872-41800894 CCTGACCGCCTCCAGGTGCAGGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1157626925 18:49058561-49058583 CTTGACCTCCACAAAGTGCTTGG + Intronic
1158812479 18:61053741-61053763 CCTGACCTCTAAATGGTCTAAGG + Intergenic
1161788504 19:6343706-6343728 CATGACCTCCACTAGATGAAAGG + Intergenic
1165785338 19:38458358-38458380 CCTGAGAACCCCAAGGTGTATGG - Intronic
1166384287 19:42371516-42371538 CCTGACCTCCACAAGGTGTAGGG - Intronic
925055344 2:852990-853012 CCTGAACTCCACAGGGAGGAGGG + Intergenic
925505030 2:4553070-4553092 CCTGTCCTACATAAGGCGTAAGG + Intergenic
931819183 2:65934619-65934641 CCTCCCCTCCACTAGGTGTAAGG - Intergenic
932692082 2:73921646-73921668 CCGGACCTCCACATGGAGAAGGG + Intergenic
939825945 2:147015633-147015655 CCTGACCCCCACATTGTTTAAGG + Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
943218747 2:185076097-185076119 CCTCACCTCCCCAACATGTAGGG + Intergenic
943218756 2:185076126-185076148 CCTCACCTCCCCAACATGTAGGG + Intergenic
943218765 2:185076155-185076177 CCTCACCTCCCCAACATGTAGGG + Intergenic
944117744 2:196207532-196207554 CCTGACCTTCACCAGGTGTTCGG + Intronic
944825722 2:203481357-203481379 CATGCCCTCCACAAGGTGTTGGG + Intronic
948093979 2:235319028-235319050 CCTGCCCTGCTCATGGTGTAAGG + Intergenic
948297714 2:236875297-236875319 TCTCCCCTTCACAAGGTGTATGG - Intergenic
1168750480 20:278273-278295 GCTGACCTCCCCAAGGTGCCAGG + Intronic
1175414014 20:58789604-58789626 CCTGTCCTCCATAATGGGTATGG - Intergenic
1175676872 20:60953754-60953776 CTTGACATCCCCAAGCTGTAAGG + Intergenic
1176071458 20:63228869-63228891 CCTGAACTCCAAAAGGAGGAGGG + Intergenic
1178677153 21:34640901-34640923 CCTGAACACCAGAAGGTTTATGG - Intergenic
1179727174 21:43347101-43347123 CCAGAGCTCCCCAAGGGGTACGG - Intergenic
1180869449 22:19138090-19138112 CCTGAGTTACACAAGGTGTGGGG + Intronic
1183810729 22:40254990-40255012 CCCGAACTCCACAAGGTCCATGG - Intronic
949102381 3:161742-161764 CCTGACCTACAAATTGTGTAAGG - Intergenic
952526011 3:34211318-34211340 TCTGCCCTCCACAAGGAGGAAGG - Intergenic
959449410 3:106480795-106480817 CCTGACGTCCTCAGGGGGTAGGG + Intergenic
963538801 3:146561456-146561478 CATGTCCTTCACAAGGTGTCAGG + Intergenic
963821960 3:149906901-149906923 CCTCAGCTCCACAAAGTGTTGGG + Intronic
977667685 4:99659606-99659628 CCTGCCCTCCACAATGGGGAGGG - Intergenic
977681321 4:99801555-99801577 CCTGAATTCCAAAAGGTGGAGGG + Intergenic
981004326 4:139859932-139859954 CCTGAGCGCCACAGGGTGCAAGG + Intronic
986053486 5:4112329-4112351 GCTGGCCTCCACAAAGTGTCAGG + Intergenic
986772749 5:10988534-10988556 CGTGACCTGCCCAAGGTGTGTGG + Intronic
987698577 5:21364918-21364940 CCTGAACAACACAAGGTTTAGGG - Intergenic
988754073 5:34226610-34226632 CCTGAACAACACAAGGTTTAGGG + Intergenic
994831492 5:104788448-104788470 CCTGATCTCCATATGGAGTAGGG + Intergenic
1002519779 5:179785873-179785895 TCTAACCTCCACAATGTTTAAGG + Intronic
1004451567 6:15752824-15752846 CCTGCACTCCTCAAGGTGTCAGG + Intergenic
1005552251 6:26933451-26933473 CCTGAACAACACAAGGTTTAGGG + Intergenic
1007139125 6:39554155-39554177 CCGGACCAGCACAAGGTGTGGGG + Intronic
1008728598 6:54452580-54452602 CCTCACCTCCCCAAAGTGCAGGG - Intergenic
1010924782 6:81731547-81731569 CCTCACCTCCACATGGGGTGAGG + Intronic
1012982254 6:105843068-105843090 ACTGACCTTCTCAAGGAGTAAGG - Intergenic
1015924690 6:138296939-138296961 GCTCACCTCCACCAGGTGTGGGG - Exonic
1017809985 6:157977609-157977631 CCAGACCTGCACATGGTGGAAGG - Intergenic
1019545039 7:1570074-1570096 CCTGACTTCCGGAAGGTGGACGG - Intronic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1019824413 7:3271973-3271995 AATGACCTCCACAAGCAGTAAGG + Intergenic
1025614120 7:63103484-63103506 CCTGAGCCCCACAATGTGAATGG - Intergenic
1026348885 7:69498457-69498479 CCTGCCCTCCATAATGTGTTGGG + Intergenic
1029653091 7:101906910-101906932 ACTGACCTCCAAAAGGGGTCCGG - Intronic
1031347762 7:120690568-120690590 CCTGCCCTTCACCAGGTGAATGG - Intronic
1041774025 8:61504652-61504674 CCTGACCTCCACCCACTGTATGG + Intronic
1047953251 8:129953240-129953262 CCTGACCTTCCCAAGCTGGAAGG - Intronic
1048453871 8:134559605-134559627 ACTGACCTCCACAGGGTCAAAGG + Intronic
1048738030 8:137523401-137523423 CCTCACCTCCACATTGTTTAGGG + Intergenic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1060162070 9:121372971-121372993 CCTAAGCACCACAAGGTGTTGGG - Intergenic
1060402666 9:123357391-123357413 CCAGAGCTCCACAGGCTGTAGGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1062665258 9:137667389-137667411 CCTGACCTCCACATGGCCTGGGG - Intronic
1188006150 X:25016858-25016880 CCTGACCTCTCCAGGGTGGAAGG + Intergenic
1192447869 X:71224048-71224070 CTTCACCTCCTCCAGGTGTAGGG - Exonic
1196645836 X:118116792-118116814 CCTGACCTCACCAGGGTGTGGGG + Intronic
1196767602 X:119262382-119262404 CCCTACCTCCAAAAGGTGGAAGG - Intergenic
1198719406 X:139599539-139599561 CCTGCCCTCCACAAAGTCTCAGG + Intronic