ID: 1166385595

View in Genome Browser
Species Human (GRCh38)
Location 19:42378845-42378867
Sequence TTGGATAATTGCCCTTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166385587_1166385595 26 Left 1166385587 19:42378796-42378818 CCAGCAGGGCTAGGTCTCAACTC No data
Right 1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG No data
1166385590_1166385595 -1 Left 1166385590 19:42378823-42378845 CCAGCCCCGCATGCTGGATAACT No data
Right 1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG No data
1166385586_1166385595 27 Left 1166385586 19:42378795-42378817 CCCAGCAGGGCTAGGTCTCAACT No data
Right 1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG No data
1166385594_1166385595 -7 Left 1166385594 19:42378829-42378851 CCGCATGCTGGATAACTTGGATA No data
Right 1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG No data
1166385593_1166385595 -6 Left 1166385593 19:42378828-42378850 CCCGCATGCTGGATAACTTGGAT No data
Right 1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG No data
1166385589_1166385595 0 Left 1166385589 19:42378822-42378844 CCCAGCCCCGCATGCTGGATAAC No data
Right 1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG No data
1166385592_1166385595 -5 Left 1166385592 19:42378827-42378849 CCCCGCATGCTGGATAACTTGGA No data
Right 1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166385595 Original CRISPR TTGGATAATTGCCCTTATGA TGG Intergenic
No off target data available for this crispr