ID: 1166389550

View in Genome Browser
Species Human (GRCh38)
Location 19:42401550-42401572
Sequence GGGGACTGGCCCTCCCTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166389550_1166389562 24 Left 1166389550 19:42401550-42401572 CCTGCAAGGGAGGGCCAGTCCCC 0: 1
1: 0
2: 0
3: 26
4: 179
Right 1166389562 19:42401597-42401619 GCAGCAGCAAAAGGCAGCGGTGG 0: 1
1: 0
2: 1
3: 57
4: 461
1166389550_1166389559 15 Left 1166389550 19:42401550-42401572 CCTGCAAGGGAGGGCCAGTCCCC 0: 1
1: 0
2: 0
3: 26
4: 179
Right 1166389559 19:42401588-42401610 GCCGCAGCAGCAGCAGCAAAAGG 0: 1
1: 2
2: 18
3: 264
4: 811
1166389550_1166389552 -10 Left 1166389550 19:42401550-42401572 CCTGCAAGGGAGGGCCAGTCCCC 0: 1
1: 0
2: 0
3: 26
4: 179
Right 1166389552 19:42401563-42401585 GCCAGTCCCCGTCCCTGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 137
1166389550_1166389561 21 Left 1166389550 19:42401550-42401572 CCTGCAAGGGAGGGCCAGTCCCC 0: 1
1: 0
2: 0
3: 26
4: 179
Right 1166389561 19:42401594-42401616 GCAGCAGCAGCAAAAGGCAGCGG 0: 1
1: 3
2: 4
3: 79
4: 789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166389550 Original CRISPR GGGGACTGGCCCTCCCTTGC AGG (reversed) Exonic
900375645 1:2353406-2353428 TGGAACTGGCCCACCCTTCCAGG + Intronic
900667633 1:3826023-3826045 CCGGGCTGGGCCTCCCTTGCAGG + Intronic
904411455 1:30327531-30327553 AGACACTGGCCCTGCCTTGCTGG + Intergenic
905358146 1:37399183-37399205 GGGATCTGGCCCTACCTTGGGGG - Intergenic
907404811 1:54247394-54247416 GGGGCCTGGCCATCTCATGCAGG + Intronic
907577583 1:55541158-55541180 GGAGACTGGCACTTCCTTTCTGG - Intergenic
910156419 1:84224858-84224880 GGGGACAGGCCTTCCCTGCCTGG - Intronic
911041890 1:93597887-93597909 GGGGACTGGTCCTAGCTTGCTGG + Intronic
914225705 1:145718053-145718075 AGGGCCTGGCCCAGCCTTGCAGG + Intergenic
922076866 1:222253765-222253787 GGTGTCTGGCCATCCCTGGCTGG - Intergenic
922173431 1:223176664-223176686 GGGGACTGGCTCTGTCTTTCAGG + Intergenic
922800326 1:228362082-228362104 GGGGATGGGCCCTCCCTCCCAGG - Intronic
923295395 1:232590119-232590141 GGGGACTTGACTTCCCTTGTGGG - Intergenic
1064196377 10:13247161-13247183 AGGGACTGGCACACCTTTGCAGG + Intergenic
1067216441 10:44308086-44308108 AGGGACTGCCCCTCCCAGGCTGG - Intergenic
1069424008 10:68273641-68273663 GGAGACTCCCTCTCCCTTGCTGG - Intergenic
1073276166 10:102313434-102313456 GCTAGCTGGCCCTCCCTTGCTGG + Intronic
1074031627 10:109694789-109694811 GGGGACTGGCACTTCAGTGCAGG + Intergenic
1075716701 10:124559787-124559809 TGGCACAGGCCTTCCCTTGCAGG + Intronic
1076614788 10:131748183-131748205 GGGCACTGGCACTTCCCTGCTGG + Intergenic
1076837057 10:133026370-133026392 GGAGCCTGGGCCTGCCTTGCTGG - Intergenic
1077169368 11:1159439-1159461 GGGGTCTGGTCCCCCCATGCTGG + Intronic
1077200008 11:1302051-1302073 AGGGGCTGGCCCTGCCTTGAAGG + Intronic
1077319461 11:1934769-1934791 GGGGCCTGGCCCTGCCTTTGGGG + Intronic
1077398142 11:2336722-2336744 GGGGCCTAGCTCTCCCTTGGGGG + Intergenic
1077410051 11:2399762-2399784 GGGCCCTGGTCCTCCCTTTCAGG + Intergenic
1077454292 11:2669036-2669058 GAGGACGGGCCTTCCCATGCCGG - Intronic
1078355477 11:10628918-10628940 GGGAACTGGGTCTGCCTTGCTGG + Intronic
1081860346 11:46329931-46329953 GGGGACTGCAGCTCCATTGCTGG - Intergenic
1084760285 11:71266451-71266473 GGGAACTGGCCCTACCTGGGCGG - Intergenic
1089560258 11:119340074-119340096 GGGGAGTGGCGCCCCCTGGCGGG + Intronic
1089748075 11:120630851-120630873 GGGCAAGGCCCCTCCCTTGCTGG + Intronic
1089973108 11:122710440-122710462 TGAGACTGGACCTGCCTTGCAGG - Intronic
1090441297 11:126727606-126727628 GGGGTCTGGCCCTCCCACCCTGG + Intronic
1092145426 12:6211371-6211393 GGGATCTTGGCCTCCCTTGCTGG + Intronic
1096614085 12:52821932-52821954 AGAGACTGGCCCTCCCTTGACGG + Exonic
1097190677 12:57217999-57218021 GGGGCCTGGGCCCCCATTGCGGG - Intronic
1102009337 12:109608321-109608343 GGGCACTGGCCCTGACATGCAGG + Intergenic
1104374118 12:128249104-128249126 CATGACTGCCCCTCCCTTGCAGG - Intergenic
1105210238 13:18253136-18253158 GGGGCCAGGCCCTCCCTTACTGG - Intergenic
1105217455 13:18297529-18297551 GGTGCCGGGCCCTGCCTTGCCGG + Intergenic
1105801110 13:23903790-23903812 CGAGACTGGCCTTCCCTCGCTGG - Intergenic
1109207459 13:59498175-59498197 AGGGACTTGACCTACCTTGCTGG - Intergenic
1116524841 14:45891759-45891781 GGCAACTGGCTCTCCCTTACAGG - Intergenic
1119420077 14:74503173-74503195 GGGGCCTGGCCCAGCCCTGCAGG + Intronic
1121616787 14:95319132-95319154 GGGAGCTGCCCCTCCCCTGCAGG - Intronic
1122120780 14:99552354-99552376 AGGGCCTGGTCCTGCCTTGCTGG - Intronic
1122323022 14:100866867-100866889 GGGGACTGGGATTCCCTTCCTGG + Intergenic
1122436783 14:101706209-101706231 GGGGCCTGCCCCGCCCATGCAGG + Intergenic
1122539893 14:102492257-102492279 GAGGACTGGCACTCCCTGGCAGG - Intronic
1122823578 14:104359123-104359145 GGGAACATGCCCTCCCTTGCCGG + Intergenic
1122959814 14:105089324-105089346 GGGCACAGGCCTGCCCTTGCAGG - Intergenic
1123037498 14:105477427-105477449 GGGGCCTGGCCTTCCCATGAGGG + Intronic
1125761130 15:42096129-42096151 GGTGTCTGGCCCTCCCGTACTGG - Intergenic
1127983590 15:64051590-64051612 AGGCACTGGCCCTGCCCTGCAGG + Intronic
1128609301 15:69061236-69061258 GGGGACTGGCCCTCCCCGTCAGG + Intronic
1128674195 15:69596693-69596715 GGGGTCTGGCCCACCCCAGCTGG + Intergenic
1129245389 15:74276105-74276127 GGGGTGTGGCTCTGCCTTGCTGG + Intronic
1129484239 15:75853841-75853863 TGGGACTGGGCCTCCGTTTCTGG + Intronic
1131516686 15:93083000-93083022 GCGCACAGGCCCTCCCTTTCTGG - Intronic
1132029820 15:98430388-98430410 GGGGTCTGTCCCTCACTTGGAGG + Intergenic
1132926204 16:2430209-2430231 GGGGAGTGGCGCTTCCTTTCAGG + Intronic
1136272124 16:29154478-29154500 AGGGCCTGGACCTCCATTGCTGG + Intergenic
1136556750 16:31011420-31011442 GGGGACCGGCGCCCCATTGCAGG - Intergenic
1137244257 16:46689613-46689635 GGGGCCTGGCTCTCACTGGCCGG + Intergenic
1142118540 16:88374192-88374214 GTGCACTGGCTCTCCCTTGCTGG - Intergenic
1142499434 17:324003-324025 AGGGTCTGGGCCTGCCTTGCAGG - Intronic
1142713964 17:1738028-1738050 GGAGACTGGCCCTGCCCAGCCGG + Exonic
1144793210 17:17873442-17873464 GGGGGCTGGTCACCCCTTGCTGG - Intronic
1146654846 17:34629004-34629026 GGGCCCTGGCCCTCCCTGCCAGG - Exonic
1147165102 17:38588895-38588917 GGGGACAGGCTCTCCCTAGGAGG + Intronic
1147659273 17:42108577-42108599 GGCGACCGGCTGTCCCTTGCAGG - Intronic
1149582661 17:57762132-57762154 GGCCACTGCCCCTCCCCTGCAGG - Intergenic
1149735291 17:58988214-58988236 GGGGAGTCGCCCTATCTTGCAGG + Intronic
1151461002 17:74253841-74253863 GGGCTCTGGCCCTTCCTTGTTGG + Intronic
1151603138 17:75118873-75118895 GTGGACTTGCCCTCACTTGGTGG - Intronic
1152145540 17:78566480-78566502 GGAGACGGGCCCTCCCTCCCTGG + Intronic
1152225434 17:79090565-79090587 GGGGAAGGGGCCTCCCTTGTGGG - Intronic
1152566920 17:81104468-81104490 GGGGACTGCCCCTGGCTGGCGGG - Intronic
1157616829 18:48992091-48992113 GGCGGCTGGCCCTCGCCTGCAGG - Intergenic
1158858554 18:61569469-61569491 GGAGACAGGCCCACGCTTGCTGG + Intergenic
1160584040 18:79903025-79903047 GGGGGCTGCCCCTGCCGTGCAGG - Exonic
1160860735 19:1236408-1236430 AGGGCCTGGCGCTACCTTGCAGG - Intronic
1160903728 19:1442137-1442159 TGGGACTGGACCTGCCTGGCTGG + Intergenic
1162094555 19:8302749-8302771 AGGGACTTACCCTCCCATGCTGG - Intronic
1162834887 19:13309937-13309959 GGGGACAGGGCCTCCTTTGGGGG - Intronic
1163146279 19:15380730-15380752 GTGGAGTGGCCCTCCGTTGGTGG - Intronic
1163157235 19:15446121-15446143 GGGGCCAGGCCCACCCTTGAAGG - Intronic
1163440843 19:17321952-17321974 GGGGACTGGGACTCCCCAGCTGG - Exonic
1166094904 19:40532320-40532342 GCTGACTGGCCCTGCCTTGGGGG + Intronic
1166389550 19:42401550-42401572 GGGGACTGGCCCTCCCTTGCAGG - Exonic
1166724382 19:45017234-45017256 TGGGACTGGCCCTGCCTAACGGG + Intronic
1166829868 19:45632802-45632824 GGGCACTTGCCCTCCTTTTCGGG + Intronic
1167201263 19:48067121-48067143 GGGGACTGACCCTCTCATTCAGG - Intronic
924985029 2:263489-263511 GGGGACCGGCCCTTCCCTTCCGG + Intronic
927198740 2:20565584-20565606 GGGGACAGCCCCTCCCGGGCAGG + Intronic
927697903 2:25250612-25250634 GGGGAGGGTGCCTCCCTTGCTGG + Intronic
928070486 2:28210162-28210184 GAGGACAGGCCTTCCCTTGCAGG - Intronic
933771680 2:85748621-85748643 GGAGTCTGTCCCTCCATTGCTGG - Intergenic
934296865 2:91749154-91749176 GGTGCCGGGCCCTGCCTTGCCGG - Intergenic
935137618 2:100321698-100321720 CGGGGCCGGCCCTCCCTCGCCGG + Exonic
942292518 2:174486819-174486841 GGGTCCTGGTTCTCCCTTGCGGG - Intronic
947565507 2:231190587-231190609 GGGGACTGACTCTCCATTGCAGG + Intergenic
947771319 2:232672581-232672603 GTGGACTGGCACCCACTTGCTGG - Intronic
947935043 2:233997444-233997466 GGGGACTGACCCTCCACAGCTGG + Intronic
947999610 2:234557115-234557137 GTGGCCTGGTCCTCCCTGGCAGG + Intergenic
948046974 2:234952245-234952267 GGGGCTTTGCACTCCCTTGCGGG + Intronic
948999073 2:241601999-241602021 GCTGACTGCCCTTCCCTTGCAGG - Exonic
1170934650 20:20799124-20799146 GGGGAGTGGTCCTCCCAGGCTGG + Intergenic
1171249243 20:23636184-23636206 AGGGAATGGCCCTCCTGTGCAGG + Intronic
1171291385 20:23984826-23984848 GGGGCCAGGCCCTCCCTTACTGG - Intergenic
1172795502 20:37534423-37534445 GGGGAGAGGCCCTCCCTGCCAGG - Intergenic
1174463481 20:50699485-50699507 CGGGCATGGCCCTCCCTTGAGGG - Intergenic
1176108604 20:63401027-63401049 GGGGACCGGCCCCTCCTTGCTGG + Intergenic
1176126504 20:63477762-63477784 GGGGGCTGGGCCTCCCTGTCTGG - Intergenic
1176178527 20:63739499-63739521 GGGAACGGGCCCTCCCCGGCGGG + Intronic
1176217561 20:63955594-63955616 GGGCGCTGCCCCTCCCTTCCGGG - Intronic
1176386398 21:6140348-6140370 AGGGACAGGGCCTCCCCTGCAGG - Intergenic
1176630553 21:9133046-9133068 GGGGCCTGGCCATGACTTGCAGG - Intergenic
1179737075 21:43397904-43397926 AGGGACAGGGCCTCCCCTGCAGG + Intergenic
1180766014 22:18346267-18346289 GGGGCCAGGCCCTCCCTTACTGG + Intergenic
1180780299 22:18516111-18516133 GGGGCCAGGCCCTCCCTTACTGG - Intergenic
1180813015 22:18773432-18773454 GGGGCCAGGCCCTCCCTTACTGG - Intergenic
1181199193 22:21207748-21207770 GGGGCCAGGCCCTCCCTTACTGG - Intergenic
1181400572 22:22648109-22648131 GGGGCCAGGCCCTCCCTTACTGG + Intergenic
1181461530 22:23088805-23088827 GTGGCCTTGCTCTCCCTTGCTGG + Intronic
1181601998 22:23958334-23958356 GGGGACAGGCCCTTCCTCGCTGG - Exonic
1181606511 22:23982973-23982995 GGGGACAGGCCCTTCCTCGCTGG + Exonic
1181702553 22:24629207-24629229 GGGGCCAGGCCCTCCCTTACTGG + Intergenic
1182563968 22:31184054-31184076 GGGGGCTGCCCCTCCCTTCCCGG + Intronic
1183027370 22:35075781-35075803 GGGGAGTGGCACTCACTTTCTGG + Intronic
1183282272 22:36938116-36938138 GGGGACCGGCCCTCAATTGGAGG - Exonic
1183347700 22:37317129-37317151 GCTGACTGGCTGTCCCTTGCAGG + Intergenic
1184130554 22:42514403-42514425 GGGGAGCAGCCCTCCCCTGCGGG - Intronic
1184140733 22:42576233-42576255 GGGGAGCAGCCCTCCCCTGCGGG - Intergenic
1184160119 22:42692829-42692851 GGGCACTGGGCCGCCCTTCCCGG - Exonic
1185317194 22:50184324-50184346 GGGGCCGGGGCCTCCCTTCCTGG + Intergenic
1203227632 22_KI270731v1_random:87158-87180 GGGGCCAGGCCCTCCCTTACTGG + Intergenic
949401384 3:3668622-3668644 TGGGGTTGGCCCTCCCTTACGGG - Intergenic
950544699 3:13631449-13631471 GGGGACTTGCTCACCCTTGCAGG - Exonic
950670290 3:14521787-14521809 GGTGACTGGCCCTTCCCTACAGG - Exonic
950841598 3:15973489-15973511 GGCGACTGGCTCTCCCTTACAGG + Intergenic
954333863 3:49904886-49904908 GGGGACTCCCCCTTCCTTCCTGG + Intronic
954386064 3:50244725-50244747 GGGGCCTTGCCCTCTCTTGTAGG + Intronic
958758363 3:98276449-98276471 GGCAACTGGCTCTCCCTTACAGG - Intergenic
960577551 3:119242822-119242844 GGGGGCTGCCCCCCACTTGCCGG - Intergenic
961492749 3:127266617-127266639 GGGAACAAGCTCTCCCTTGCTGG + Intergenic
961596939 3:128025369-128025391 GGTGACTGTCCCTCCCTCACAGG + Intergenic
961637183 3:128341010-128341032 GGGCCCTGGCCCTGCTTTGCTGG + Intronic
961825077 3:129595060-129595082 GAGGACTGGCCCTACCTACCTGG - Intronic
962390288 3:134965996-134966018 GTGCACTGGCCCTTCCTTTCAGG + Intronic
962616302 3:137130252-137130274 GAGTACTGGCCCTCCCATGAGGG + Intergenic
967126356 3:186427947-186427969 AGGCAATGACCCTCCCTTGCAGG + Intergenic
967478218 3:189945009-189945031 GGGGACTGACTCTCTCTTCCAGG + Intergenic
967814713 3:193788942-193788964 GGGGACTTGCCTTTCCCTGCAGG + Intergenic
969398796 4:6939922-6939944 GGGGACTGGCCTTGCTTTTCAGG + Intronic
969581437 4:8067845-8067867 GAGGACTGTCCCTCCCTCTCAGG + Intronic
973588931 4:52420611-52420633 GGAGGCTGGCCCTCACTTGCAGG - Intergenic
973920672 4:55681769-55681791 GGGCACTGGCCCTCCCTCTGGGG + Intergenic
975897214 4:79107044-79107066 GGGGGATGGACATCCCTTGCTGG + Intergenic
975916480 4:79331527-79331549 GGGGACTAGACTTCCCTTGTAGG - Intergenic
979719166 4:123878982-123879004 GGGGACTAGCCTGCCTTTGCAGG + Intergenic
986553396 5:8983633-8983655 AGAGACTGGGCCTCCCTTTCAGG + Intergenic
987090576 5:14505307-14505329 GGGGGTTGTCCCTGCCTTGCAGG - Intronic
987313307 5:16701135-16701157 GGGGACTTGCCCTCCCCAGACGG - Exonic
995545019 5:113221467-113221489 GGGGACTGGACTGCCTTTGCAGG + Intronic
1001201731 5:169723834-169723856 GTTGACTGTCCCTTCCTTGCTGG + Intronic
1002139934 5:177132578-177132600 GGGGACTCGGCCTCCCTGGGCGG + Intergenic
1005730517 6:28692822-28692844 GGAGACTGGCGCTCACGTGCTGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006899713 6:37492060-37492082 GGAGATGGGCCCTTCCTTGCAGG - Intronic
1006990633 6:38212131-38212153 CAGGAGTGGCCCTCCCTTGGTGG + Intronic
1007069218 6:39022754-39022776 GGGGTGTGGCCCTCCCTCCCAGG - Intronic
1007582406 6:42967330-42967352 GAGTACTGGCCCTCCCTAGGAGG - Intronic
1010198589 6:73263556-73263578 GGAGTCTGGACCTCCCTTGGTGG - Intronic
1011780791 6:90787213-90787235 GGAGACTCCCCCGCCCTTGCTGG + Intergenic
1013789992 6:113825708-113825730 GGTGACTGTCTCTCCCTTGAAGG + Intergenic
1017134363 6:151135175-151135197 AAGGACTGACTCTCCCTTGCTGG - Intergenic
1019334188 7:475277-475299 GGGGACGGCCCCGCCCTGGCTGG + Intergenic
1019433205 7:1009191-1009213 GGGCACTGGCCCTGCCTGGGAGG - Intronic
1020096141 7:5370677-5370699 GGGCACTGTCCCTCCCCGGCGGG + Exonic
1020231392 7:6321823-6321845 AGGGTCTCGCTCTCCCTTGCAGG + Intergenic
1022465711 7:30652280-30652302 TGGGACAGGCCCTGGCTTGCTGG + Intronic
1023487028 7:40698365-40698387 GGGGGCTTGCCCTGACTTGCAGG + Intronic
1023870433 7:44260429-44260451 GGGGCCTGGCCTGCCCTTGGTGG - Intronic
1024742152 7:52365839-52365861 TGGGACAGGCCCTCACTGGCAGG + Intergenic
1029493630 7:100885469-100885491 GGGGAAGGGGCCTCCCTAGCAGG - Intronic
1032097945 7:128948832-128948854 GGTGACTGGCCCTGGCTTCCTGG + Exonic
1038195332 8:25361760-25361782 GGGGAATGACTCTCCCTGGCCGG - Intronic
1041377382 8:57217545-57217567 GGGGACTGCCCGTCCCCGGCGGG + Intergenic
1043853925 8:85244042-85244064 GGGGACTGGACCGCCTTTGCAGG + Intronic
1047706920 8:127508654-127508676 GGTGACTTGACATCCCTTGCTGG - Intergenic
1049205920 8:141363593-141363615 GGGGTCTGGCCTTCCATGGCCGG - Intronic
1050018265 9:1258732-1258754 GGGGAGTGACTCTCCCGTGCTGG + Intergenic
1056591861 9:87970757-87970779 GGGATCTGGCCCTCCCTACCTGG + Exonic
1060114470 9:120929200-120929222 GGGCCCCGGCCCTGCCTTGCCGG - Intergenic
1061281156 9:129598136-129598158 GGGAAATGGCTCTCCCTTTCTGG + Intergenic
1061506429 9:131034262-131034284 AGGGACTGCCCCTGCCTTGGAGG - Intronic
1061561327 9:131405796-131405818 GGAGAGTAGCTCTCCCTTGCAGG + Intronic
1061988741 9:134145880-134145902 GGGGCCTTGCCATCCCCTGCTGG + Intronic
1062049298 9:134438783-134438805 AGGGACGGGGCCTCCGTTGCGGG + Intronic
1062382098 9:136291419-136291441 GAGCTCTTGCCCTCCCTTGCGGG + Exonic
1185764109 X:2710670-2710692 GGGGACTTGCCCTGACTTGCTGG + Intronic
1193599775 X:83496167-83496189 GGGAATAGGCACTCCCTTGCCGG + Intergenic
1199672820 X:150161081-150161103 GGGGACTGCCCTTCCCTTTGGGG - Intergenic
1201064926 Y:10088670-10088692 GGGGACAGGGCCACCCATGCAGG + Intergenic