ID: 1166390989

View in Genome Browser
Species Human (GRCh38)
Location 19:42408860-42408882
Sequence GACCTGGGTAGCGACAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166390989 Original CRISPR GACCTGGGTAGCGACAGTCA GGG Intronic
901251501 1:7783683-7783705 GACGTGGGGAGCGAGAGGCAGGG - Intergenic
903357557 1:22757327-22757349 GAGGTGGGTAGAGACAGTCAGGG + Intronic
904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG + Intergenic
906933973 1:50195736-50195758 GACCTGGGTAGCGCCGGTTGGGG - Exonic
909353066 1:74676218-74676240 GACCTGTGGAGTGAGAGTCAGGG + Intergenic
920167220 1:204044478-204044500 GACCTGGGTAGGGAGTGTGATGG + Intergenic
922035231 1:221841181-221841203 CACCTGGGTAGTGAATGTCAGGG - Intergenic
923623789 1:235598007-235598029 GTCTTGGGTAGCCAGAGTCAGGG - Intronic
1071875235 10:89837342-89837364 GACCTGGGTGGCGACGCTCGTGG + Intergenic
1077489142 11:2852552-2852574 GACCTGGGTGGGGACAGGAAAGG - Intergenic
1081146474 11:39566715-39566737 GACCTGGGCAGCGACAATAAGGG + Intergenic
1083988815 11:66234024-66234046 GGCCTAGGAAGGGACAGTCAAGG + Intronic
1103743625 12:123107637-123107659 GGCCCTGGTAGCGAGAGTCATGG - Intronic
1106366131 13:29082697-29082719 GACCTGGGTATGGAGGGTCACGG + Intronic
1106871439 13:34026184-34026206 GACCTGGGTAGGGGCAGTGTGGG - Intergenic
1108014930 13:46064767-46064789 AACCTGGGTAGCCACGTTCAAGG + Intronic
1119264099 14:73253995-73254017 GACCTGGGTAGCAGCAGGGAAGG + Intronic
1126864375 15:52921338-52921360 GACCTGGGAAGCATCAGTCAAGG + Intergenic
1128366649 15:67008298-67008320 TACCTGGGTAGCTGCAGGCAGGG - Intergenic
1128457693 15:67841501-67841523 GACCTGGGGAGCCACTGCCAGGG + Intergenic
1133117995 16:3589224-3589246 GTCCCGGGGAGCGACAGTCACGG + Exonic
1133911443 16:10069908-10069930 GACCTGGGAAGGAACAGTTAAGG + Intronic
1141804492 16:86333905-86333927 GTCCTGGGGAGAGACAGGCAAGG + Intergenic
1148751683 17:49948955-49948977 GACCGGGGTGGGGACATTCAAGG - Intergenic
1149998889 17:61419814-61419836 GACCTGGATGGGGACAGACAGGG - Intergenic
1151655394 17:75493449-75493471 GGGCTGGTTAGCGACACTCAGGG + Intronic
1151829333 17:76540436-76540458 GACCTGTGGAGGGACAGTGAGGG + Intronic
1155415480 18:25594497-25594519 GACCTGCTTAGTTACAGTCATGG - Intergenic
1156890389 18:42184138-42184160 GAGTTGGGTAGCCACAGACAAGG - Intergenic
1158755683 18:60321546-60321568 GACCTTGGTTGAGACACTCAAGG + Intergenic
1161966404 19:7551308-7551330 GACCTGGGAAGCGGCTGTCCAGG - Intronic
1162909098 19:13839975-13839997 GCACTGGGTAGGGAAAGTCAGGG + Intergenic
1163254760 19:16148920-16148942 GCCCAGGGTAGGGACAGACAAGG - Intronic
1166390989 19:42408860-42408882 GACCTGGGTAGCGACAGTCAGGG + Intronic
1167468553 19:49663039-49663061 GACCGGGGCAGGGACAGACAGGG + Intronic
927668563 2:25049751-25049773 GACCTGTCCAGCGAGAGTCAGGG + Intronic
929626877 2:43418470-43418492 TACCTGGCTAGCTGCAGTCAGGG - Intronic
937301186 2:120843363-120843385 TGCCTGGGTAGCCACAGTGATGG - Intronic
946250039 2:218406259-218406281 GGCCTGGGTAGGGGCAGTCCTGG + Intergenic
1174858927 20:54071856-54071878 GCCCTGGGTTGAGACAGACAAGG + Intergenic
1180043883 21:45293970-45293992 GATCTGGGGGGCTACAGTCAGGG + Intergenic
1184807775 22:46806860-46806882 GACCTGAGTAGCTACAATTATGG + Intronic
951803677 3:26623676-26623698 GAGCTGGGTAGGGACAGAGAAGG + Intronic
951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG + Intronic
953431232 3:42842197-42842219 GAACTGGGCAGAGAAAGTCATGG + Intronic
954289718 3:49643200-49643222 GGCCTGGGTAGTGAGTGTCATGG + Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
966657410 3:182374953-182374975 GACTTGGGTAGGGAAAGTAAGGG - Intergenic
968446297 4:654018-654040 GACCTGGGTCGGGCCAGGCAGGG - Intronic
973635571 4:52859165-52859187 AACCTGGGTTGTGGCAGTCAAGG - Intergenic
984623507 4:181979530-181979552 GACCTGGGTAGCTGGAATCAAGG - Intergenic
987415132 5:17654548-17654570 GACCTGGGTCACTCCAGTCATGG + Intergenic
990766309 5:59187447-59187469 AACCTGGGGAGGGACACTCAGGG + Intronic
995297211 5:110536238-110536260 GAACTGGGTGGTGGCAGTCAAGG - Intronic
998145451 5:139725183-139725205 GACCTGGGAGGCGCCTGTCAGGG + Intergenic
998394292 5:141808528-141808550 GACCTTGGGAGAGACATTCAAGG + Intergenic
999057678 5:148597458-148597480 GACTTTGGTAGCTACATTCAAGG - Intronic
1001123368 5:168997742-168997764 GACCTAGGTAGCAACTGGCACGG + Intronic
1002198144 5:177512258-177512280 AACCTGGGTGGCCACAGGCAGGG + Intronic
1005288020 6:24349858-24349880 GACCTGGGTGTAGAGAGTCAGGG + Intronic
1006878414 6:37318194-37318216 GACCTGGATAGTGACAGTGGAGG + Intronic
1006980757 6:38146009-38146031 GTCTTTGGTAGCAACAGTCAGGG + Intronic
1007954487 6:45903989-45904011 GCCCTGGTTTGCCACAGTCAGGG + Intronic
1009405972 6:63313290-63313312 GGCCTTGGTAAGGACAGTCACGG + Intronic
1023876454 7:44288905-44288927 GCCCTGGGTGGCTGCAGTCAGGG - Intronic
1032357626 7:131225200-131225222 GAGCTGGGAAGCCACAGTCATGG + Intronic
1039114959 8:34082742-34082764 CACCTGGGTATAGAAAGTCAAGG + Intergenic
1041840829 8:62268769-62268791 AACCTGGGTATAGACATTCATGG - Intronic
1048034702 8:130666393-130666415 GACCTTGGCAGGGACTGTCAGGG - Intergenic
1048927533 8:139284214-139284236 GAGCTGGGTGGAGACAGTGAGGG - Intergenic
1049432800 8:142573147-142573169 GGCCTGGGGAGCGGCAGTGAGGG - Intergenic
1051167816 9:14284053-14284075 GAGCTGGGAAGGGGCAGTCATGG + Intronic
1054946626 9:70803207-70803229 GACCTGGGGACTGACTGTCAAGG - Intronic
1055236352 9:74127981-74128003 GAACTGGGTAGTAGCAGTCAAGG - Intergenic
1056502206 9:87221159-87221181 GACCTGGGTAGAGACCCTCCTGG - Intergenic
1061405338 9:130390606-130390628 GACCTGTGTAGGGTCAGTGAGGG + Intronic
1186110087 X:6246421-6246443 GAACTGGGCAGTGACAGGCAAGG + Intergenic
1192539867 X:71958602-71958624 GAATTGGGTAGCGACATTCCTGG + Intergenic
1193142532 X:78042956-78042978 GAGCTGGGTTGAGAAAGTCAGGG - Intronic
1197195673 X:123698503-123698525 GACCAGGGTGGCGAAAGTCATGG - Intronic