ID: 1166391000

View in Genome Browser
Species Human (GRCh38)
Location 19:42408900-42408922
Sequence CAGAGTGAGCAGTGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 1, 1: 0, 2: 7, 3: 91, 4: 723}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166390991_1166391000 15 Left 1166390991 19:42408862-42408884 CCTGGGTAGCGACAGTCAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG 0: 1
1: 0
2: 7
3: 91
4: 723
1166390995_1166391000 -8 Left 1166390995 19:42408885-42408907 CCAGTGTGGCTGGAGCAGAGTGA 0: 38
1: 109
2: 326
3: 700
4: 1386
Right 1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG 0: 1
1: 0
2: 7
3: 91
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166391000 Original CRISPR CAGAGTGAGCAGTGGGGAGA GGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900507727 1:3038113-3038135 CAGAATGAGCAGTGGTGACTTGG + Intergenic
900625204 1:3604810-3604832 CAGAGTGAGAATAGGGGAGGGGG + Intronic
900803970 1:4755415-4755437 CAGAGCCAGCAGGAGGGAGACGG - Intronic
900836075 1:5005158-5005180 GTGAGTGAGGAGTGGGAAGAAGG - Intergenic
901226857 1:7618251-7618273 CTGAGTGGTCAGTGGAGAGATGG + Intronic
901388394 1:8926240-8926262 CGGAGTGAGGTGTGGGAAGACGG - Intergenic
901645877 1:10716462-10716484 CATGGGGAGCAGTGGGCAGAGGG + Intronic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
901933449 1:12612194-12612216 CAGAGTGAGGATGGGAGAGATGG + Intronic
902729985 1:18362928-18362950 CAGAGGCAGAAGTGGGGAGGGGG - Intronic
903015630 1:20359924-20359946 CAGAGTTACCAGTGGGGCGAGGG - Intergenic
903259344 1:22122913-22122935 GAGAGTGGGCAGTGGAGAGTGGG - Intronic
903319245 1:22532207-22532229 CAGAGTGAACAGTGGTACGAGGG + Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903331435 1:22599073-22599095 TAGACTGGGGAGTGGGGAGATGG + Intronic
903677045 1:25071058-25071080 TAGAGTGAGGAATGGGGAGGGGG - Intergenic
903944121 1:26951176-26951198 CAGAGTGGGAGCTGGGGAGAGGG + Intronic
904067136 1:27762072-27762094 GTGGGTGAGGAGTGGGGAGAAGG - Intronic
904212980 1:28897918-28897940 CAGAGTGAGCCCAGGGGAGCAGG + Intronic
904642933 1:31944383-31944405 CAGAGTGATAACTGGGTAGAAGG + Intronic
904870517 1:33614977-33614999 TAGATTGGGCAGTGAGGAGAGGG - Intronic
904966476 1:34378263-34378285 CAGTGAGATCATTGGGGAGATGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905446516 1:38031271-38031293 TAGGGTGAGGAGTGGGGAGCAGG - Intergenic
905796368 1:40818733-40818755 CAGAGCGGGCAGGGCGGAGAGGG + Intronic
905934270 1:41811236-41811258 CAGAGTGGGCCTTGGGGAGTAGG - Intronic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
906284416 1:44577335-44577357 GAGAGGTGGCAGTGGGGAGAGGG - Intronic
906284427 1:44577371-44577393 GAGAGGTGGCAGTGGGGAGAAGG - Intronic
907304842 1:53507709-53507731 TGGAGTGGGCACTGGGGAGAGGG + Intronic
907329456 1:53661689-53661711 CACAGGGAGCCGTGGGGAGGAGG - Intronic
907330076 1:53664978-53665000 CAGAGTGAGCAATGGGGCGAGGG + Intronic
908693660 1:66811626-66811648 GAGAGTGAGGAGTGGGGAGGAGG + Intergenic
908804530 1:67916612-67916634 CAAGTAGAGCAGTGGGGAGAAGG - Intergenic
910489996 1:87757939-87757961 AAGGGTGAGCTGTCGGGAGAAGG + Intergenic
910541073 1:88357860-88357882 CAGAGTGGGGAGTAGGGAGGGGG + Intergenic
910996232 1:93107043-93107065 CATAGTCAGCTGTGAGGAGAAGG - Intronic
912927818 1:113929375-113929397 CAGAGTCTGCAGTGCGGAGGGGG + Intronic
913237953 1:116801057-116801079 CAGAGGGAGCAGAGGTGAAATGG + Intergenic
913445667 1:118948093-118948115 CTGAGTCACCACTGGGGAGATGG - Intronic
915030624 1:152877771-152877793 CAGAGTGGGGAGTAAGGAGAAGG - Intergenic
915081135 1:153353564-153353586 TAGAATGAGCACTGGGGAAATGG + Intergenic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915636542 1:157190833-157190855 TAGAGTCAGCAGTGGGAACAGGG + Intergenic
915748018 1:158180211-158180233 CAGTGTGAGAAGTGGCGAGTTGG + Intronic
915936338 1:160092249-160092271 CAGAGTGAGGAGGGTGGAGGGGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
918003995 1:180524820-180524842 CAGAGTGAGCAAGTGGGAGAGGG + Intergenic
918048834 1:180956940-180956962 AAGGCTGAGGAGTGGGGAGAGGG - Intergenic
918067181 1:181109265-181109287 CAGAGAGAGCTGTGGGGAGGGGG + Intergenic
918126469 1:181588421-181588443 GGGAGGGAGCGGTGGGGAGAAGG - Intronic
918217028 1:182400700-182400722 GTGAGAGAGCAGTGGGCAGAAGG - Intergenic
918406996 1:184221353-184221375 CCGAGTGAGCAATGAGGAAAAGG - Intergenic
919466556 1:197927207-197927229 GAGTGTGGGCAGTGGGGAGCTGG + Intronic
920205497 1:204288153-204288175 CACACTGAGGAGTAGGGAGAAGG + Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921279312 1:213549956-213549978 GAGAGAGGGCAGTGGGGAGAGGG + Intergenic
921626816 1:217386352-217386374 CAGAGTGGGAAATGGAGAGATGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922790746 1:228309569-228309591 CAGAGCGACCAGTGTGGAAAGGG - Intronic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923273715 1:232379274-232379296 GGGAATGAGCACTGGGGAGAGGG + Intergenic
923483283 1:234404750-234404772 GAGAGTTAGCTGTGGGGAGATGG - Intronic
923562698 1:235053544-235053566 CACAGGGAACAGTGGGGACATGG + Intergenic
923647427 1:235838177-235838199 GAGAGTGAGAAGTGGGAAGGAGG + Intronic
923679011 1:236104102-236104124 GAGAGGGAGCAGATGGGAGACGG - Intergenic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924352273 1:243127426-243127448 CAGAGTAGGGAGTTGGGAGAAGG + Intronic
924745914 1:246833606-246833628 CAGAGGGGGTAGTGGGGATATGG - Intergenic
1063161904 10:3424418-3424440 TAGAGTGAGCCTTGGGGAGAAGG + Intergenic
1063426117 10:5951406-5951428 CACTGTGAGCATTTGGGAGATGG - Intronic
1063939005 10:11108009-11108031 GGGAGTAAGGAGTGGGGAGAGGG - Intronic
1064018113 10:11788225-11788247 GAGGGTGAGCAATGGGGACACGG + Intergenic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1064523792 10:16231696-16231718 CTGAGGGAGCTGTAGGGAGAAGG - Intergenic
1064660187 10:17600093-17600115 CAGAGAGAGAAGTAGGTAGAAGG - Intronic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1065797615 10:29321776-29321798 CAGAGTGAGCAGGGGTGTGGGGG - Intergenic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1066440950 10:35437960-35437982 CAGAGTAGGCTGTGGGGTGAAGG - Intronic
1066522342 10:36236050-36236072 CAGAGTTAGCACTGGAGAAACGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067145747 10:43692546-43692568 GAGATGGGGCAGTGGGGAGAGGG - Intergenic
1067274050 10:44818982-44819004 CAGGGTGAGCAGGGGTCAGAAGG + Intergenic
1067440962 10:46309022-46309044 GAGAGTGAGGAGTGGGCAGATGG + Intronic
1067532663 10:47085752-47085774 CGGAGAGAGGAGTGGGGAGATGG + Intergenic
1067577089 10:47415729-47415751 GAGAATGAGGAGTGGGCAGATGG + Intergenic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1068118664 10:52762113-52762135 CAAAGTGAGTAGCGGGGAGCTGG - Intergenic
1069780122 10:70950160-70950182 GTGAGAAAGCAGTGGGGAGAGGG - Intergenic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1069948267 10:72002053-72002075 CAGAGCCAGAAGCGGGGAGAGGG - Intronic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1070399452 10:76040546-76040568 GAGTGTGAGCAGTGGGGAAGGGG - Intronic
1070450850 10:76555510-76555532 CAGAGTTGGCAATGGAGAGAGGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071339077 10:84626047-84626069 CAGATTGAGCTGCGGGGAGCAGG + Intergenic
1072292503 10:93977125-93977147 AAGAGTGAGCAGCCAGGAGAAGG - Intergenic
1072370547 10:94762490-94762512 CAGAGTGGGCACTGGGACGAAGG + Intronic
1072809980 10:98453966-98453988 CAGGGTGTTCTGTGGGGAGAGGG - Intergenic
1073085082 10:100883172-100883194 CTCACTGGGCAGTGGGGAGATGG + Intergenic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073444998 10:103575286-103575308 GAGAGACAGCAGCGGGGAGAAGG - Intronic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074116014 10:110458000-110458022 CTGGGTGTGGAGTGGGGAGAGGG + Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074678310 10:115878063-115878085 CTGAGAGGGCAGTGGGGAGAAGG - Intronic
1074735146 10:116423399-116423421 CAGAGTGAGCAGGGGGAAATCGG + Intergenic
1074895159 10:117770957-117770979 CAGAGGGAGCAGCTGGGAGGTGG + Intergenic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075631053 10:124000891-124000913 CAGAGAGAGCCCTGGGGAAATGG + Intergenic
1075875591 10:125803397-125803419 CACACTGAGCTGTGGGAAGACGG + Intronic
1076245098 10:128940991-128941013 CAGAGACAGAAATGGGGAGATGG - Intergenic
1076369353 10:129941633-129941655 CAGAGGTGGCAGTGAGGAGATGG + Intronic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1077078701 11:713044-713066 CAGAGTGAGGAGTGGAGGGTGGG + Intronic
1077130932 11:972190-972212 CAGCGTGGGCAGCCGGGAGATGG + Exonic
1077191213 11:1256577-1256599 CAGGATGGGCAGTGGGGAGCAGG - Intronic
1077241398 11:1512396-1512418 GAGAGTGGGCAGTGGGCAGCAGG - Intergenic
1077328450 11:1973619-1973641 CAGAGGGGGCTGTGGGGAGAGGG + Intronic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1077748051 11:4930536-4930558 CAGAATGAGGATTGGGTAGATGG - Intronic
1078120791 11:8506893-8506915 CAGAGTAAGCAGGGGAGAAAGGG - Intronic
1078737077 11:14030130-14030152 TAGAGTGAGCAGTGCTGAGCTGG + Intronic
1079096402 11:17513245-17513267 CAGAGCGAGCATTCAGGAGAGGG + Intronic
1079103894 11:17558448-17558470 CAACTTGAGCTGTGGGGAGAGGG - Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079304292 11:19308779-19308801 AAGAGTGAGGAGTGGGCAGAGGG - Intergenic
1079503885 11:21132761-21132783 CATGGTGAGCAGTGGGGTGGGGG + Intronic
1080392495 11:31861231-31861253 CAGAGTGAGGCCTAGGGAGAAGG + Intronic
1080429460 11:32185017-32185039 CAGAGTGGTCACTGGGAAGACGG - Intergenic
1080561493 11:33467414-33467436 GAGAGTGACCATTGGGCAGATGG + Intergenic
1080673748 11:34405571-34405593 GAGAGAGAGAAGTGTGGAGATGG - Intergenic
1080673811 11:34405850-34405872 GAGAGAGAGAAGTGGAGAGATGG - Intergenic
1080673824 11:34405914-34405936 GAGAGAGAGAAGTGTGGAGATGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1081781890 11:45718858-45718880 TAAAGTGAGGAGTGGGGAGCAGG - Intergenic
1081878323 11:46426311-46426333 CACAGTGAGGGCTGGGGAGATGG + Intronic
1081977089 11:47242559-47242581 GAGGGTGAGAAGTGGGGAGAAGG + Intronic
1082777624 11:57259656-57259678 CAAAGGGAGAAGTGGGAAGAGGG - Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083167562 11:60900506-60900528 CAGAGACAGCAGCGGGGTGAGGG + Intronic
1083331131 11:61898923-61898945 CAGAATGGGCTGTGGGGGGAGGG + Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084488504 11:69464735-69464757 AAGAGGGAGGACTGGGGAGAGGG + Intergenic
1085209534 11:74762874-74762896 CAGAGTGAGGAGTGTAGAGATGG + Intronic
1085475247 11:76784823-76784845 TGGAGTGAGCAGTGGGGAGGAGG - Intronic
1086367549 11:86123018-86123040 AAGAGAGATCAGTGGGGATAGGG - Intergenic
1086505709 11:87502090-87502112 CAGAGGGAGGAGTGGGGGAAGGG - Intergenic
1087747971 11:101971781-101971803 AAAAGTGAGCAGTGGGTACAGGG - Intronic
1089321603 11:117630227-117630249 TGGAGGGAGGAGTGGGGAGAGGG + Intronic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1090254289 11:125272556-125272578 CAGAGGGAGAAGGGGAGAGAGGG - Intronic
1090846781 11:130536230-130536252 CAGGGTGAGAAGGGGAGAGAGGG + Intergenic
1090963170 11:131574840-131574862 CAGAGGTAACAGTGGGGAGTGGG - Intronic
1090974599 11:131670853-131670875 CAGAGGGAGCAGAGGGGAAGGGG - Intronic
1091064580 11:132497238-132497260 CGGAGTGGGGAGTGGGGAGTGGG + Intronic
1091198128 11:133749122-133749144 CACTGTGTGCTGTGGGGAGAGGG + Intergenic
1202811428 11_KI270721v1_random:28798-28820 CAGAGGGGGCTGTGGGGAGAGGG + Intergenic
1091675881 12:2488944-2488966 CAGAGTGGGCAGTGCAGACAAGG + Intronic
1092237558 12:6819594-6819616 CCAAATGAGCAGTGGGGAGAGGG - Exonic
1092256406 12:6928520-6928542 CAGAGCCCGCAGTGGGGGGACGG - Intronic
1092663585 12:10767818-10767840 CAGAATGAGATGTGGGGCGATGG - Intergenic
1093215603 12:16358126-16358148 AAGAGATGGCAGTGGGGAGAGGG - Intronic
1094110382 12:26855642-26855664 GAGAGTAAGGATTGGGGAGAAGG - Intergenic
1095783916 12:46089721-46089743 CAGGGCTAGCAGTGGGGAAATGG - Intergenic
1095785319 12:46102634-46102656 CAGAGCTAACAGTGGGGAAATGG - Intergenic
1095974340 12:47929023-47929045 CAGCGTGGCCAGTAGGGAGAGGG + Intronic
1096041627 12:48521478-48521500 GAGAGGGAGACGTGGGGAGAGGG + Intronic
1096071043 12:48775712-48775734 CAGAGTGTGGAGTGAGGTGAAGG + Intronic
1096215586 12:49796093-49796115 CAGAGTTAGCTGTGGGTAGGTGG + Exonic
1096296712 12:50390247-50390269 CAGAGTGTGCATTGGGAAAAAGG - Intronic
1096499420 12:52055976-52055998 CAGAGTGTGGGGTGGGGAGGGGG - Intronic
1096991993 12:55812128-55812150 CAGAGTGAGCAATGGTAATAAGG - Intronic
1097021700 12:56025494-56025516 GAGAATGAGCTGTGGGGAGATGG - Intronic
1097618723 12:61914366-61914388 CAGTGGGAGCAGTGTGGTGAAGG - Intronic
1099789407 12:87312533-87312555 AAGAGTGAAGAGTGGGGAAATGG - Intergenic
1100032412 12:90209289-90209311 CCTAGTGAGCTGTGGGAAGAGGG + Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100390582 12:94143085-94143107 AAGGGGGAGCAGTGGGGAAATGG + Intergenic
1100734134 12:97508161-97508183 CAGAGTCAGCAATGGTAAGAAGG + Intergenic
1100752701 12:97716716-97716738 CAAAGGGAGCAGAGGAGAGAAGG - Intergenic
1100797865 12:98201488-98201510 TGGAGTGATCAATGGGGAGATGG - Intergenic
1101232446 12:102755268-102755290 CAGGGTGAGAAGTGGAGAGGTGG - Intergenic
1101925633 12:108969274-108969296 GAGAGTGAGGAAGGGGGAGAAGG - Intronic
1102224470 12:111218051-111218073 CAGAGTTTGCAATGGGGACAGGG - Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102783294 12:115584079-115584101 CATCTTGAGCAGTGAGGAGATGG - Intergenic
1103142152 12:118557793-118557815 CAGAGGATGAAGTGGGGAGAGGG + Intergenic
1103929088 12:124439824-124439846 AAGAGAGAGAAGTGGGGAGAGGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104360283 12:128126540-128126562 ATGAGTGAGCCATGGGGAGACGG + Intergenic
1104917011 12:132270913-132270935 CAGAGAGAGCAAGGAGGAGATGG + Intronic
1106415781 13:29544768-29544790 CGGCGAGGGCAGTGGGGAGAGGG + Intronic
1107372261 13:39766090-39766112 CAGAGGCAGTACTGGGGAGAGGG - Intronic
1107743126 13:43475297-43475319 CAGCCTAAGCAGTGTGGAGATGG + Intronic
1107781854 13:43912182-43912204 CAGAATCAGCTGTGGGGATAGGG - Intergenic
1108211263 13:48142072-48142094 CAGAGTGAGCAATGTGGGGGTGG + Intergenic
1108607459 13:52053842-52053864 CAGCGCTAGCAGTGGGGAGATGG - Intronic
1108610121 13:52077125-52077147 CAGAGGGAACAGTGGGGTAAAGG + Intronic
1108640728 13:52380324-52380346 AAGAGTGGGCAGTGGGAGGACGG - Intronic
1108886599 13:55192859-55192881 TAAAGTGAGCAGAGTGGAGAGGG - Intergenic
1109415492 13:62034101-62034123 TAGAGTGAGCAGGCGGGAGCTGG + Intergenic
1110526097 13:76538369-76538391 GAAAGTGAGGAGTGTGGAGAAGG - Intergenic
1110700738 13:78544876-78544898 CAGAGTGAGAAATGGGGTGCAGG + Intergenic
1110767551 13:79298219-79298241 CAACGTGAACAGTGGAGAGAAGG - Intergenic
1110859034 13:80327624-80327646 CTGAGAGAGTAGTGAGGAGAAGG - Intergenic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1112564074 13:100537372-100537394 CAGAGTGAGGGCTGGGTAGAGGG + Intronic
1113147232 13:107220825-107220847 CAGAGAGAGGAGTGGGGTGGAGG + Intronic
1113173209 13:107530041-107530063 AAGAGTGAGCTGTGGAAAGAAGG - Intronic
1113641553 13:111961249-111961271 CAGAGAGACCAGTGGGGTGCAGG - Intergenic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114208294 14:20593959-20593981 CAGAGTCAGTAGTGGGGAGAGGG - Intronic
1114498556 14:23151404-23151426 CAGACAGAGTTGTGGGGAGAGGG + Intronic
1114532198 14:23403103-23403125 CCGAGGGAGGAGTGGAGAGAAGG + Intronic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1116940348 14:50784945-50784967 GAGAGTAGGCAGAGGGGAGAAGG + Intronic
1117279171 14:54220525-54220547 CAGAATGTGCCCTGGGGAGAGGG + Intergenic
1117575440 14:57092635-57092657 CAGTGTGATCACTGTGGAGATGG + Intergenic
1118137559 14:63045832-63045854 CAGAGAGAGCAGTGGCCAGTCGG + Intronic
1118768879 14:68928693-68928715 CTCAGTGAACAGTGGGGAGGAGG + Intronic
1119647140 14:76356034-76356056 CAGAGGGAGCCATGGGGAGCTGG + Intronic
1119698178 14:76730711-76730733 CAGAGTGACCAGTGGGGCAGGGG + Intergenic
1120388359 14:83874009-83874031 CAGAAGGAGCAGACGGGAGAAGG + Intergenic
1120954672 14:90071488-90071510 CACAGAGAGATGTGGGGAGATGG - Intronic
1121412825 14:93759783-93759805 GAGAGCAAGCAGTGGGGAGGGGG + Intronic
1122459526 14:101883761-101883783 AGGAGGGAGCTGTGGGGAGAGGG - Intronic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123028561 14:105439912-105439934 CAGAGGGGGCAGCGGGGGGAAGG + Intronic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124412752 15:29450487-29450509 CAAAGCAAGCAGTGGGGAAAGGG - Intronic
1125513136 15:40303420-40303442 AAGAATGAGCAATAGGGAGAAGG + Intronic
1125539642 15:40462559-40462581 CAAAGTGAGCAGGGAGGGGAGGG - Intronic
1125828189 15:42693268-42693290 AAGAGTGAGGATTGGGGAGGAGG - Exonic
1126066073 15:44827423-44827445 CAGAGTGAGCGGGTGGGTGAGGG - Intergenic
1126093762 15:45073141-45073163 CAGAGTGAGCGGGTGGGTGAGGG + Intronic
1126200744 15:45983152-45983174 CATACTGAGCAGTTGGAAGAAGG - Intergenic
1126422877 15:48493432-48493454 AAGAGAGATCAATGGGGAGAGGG + Intronic
1126906920 15:53377954-53377976 TAGGGTGGGCAGTGGGGAGGGGG - Intergenic
1127304059 15:57684663-57684685 CAGAGTGAGCAGGTAAGAGAGGG + Exonic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127638149 15:60890586-60890608 CAGAGAGAGCAGTGGTGATAAGG + Intronic
1127650745 15:61004205-61004227 AAAAGGGGGCAGTGGGGAGAGGG + Intronic
1128774602 15:70309956-70309978 CTCAGTGAGGACTGGGGAGAAGG - Intergenic
1129000019 15:72325026-72325048 GAGAGAGAGGAGAGGGGAGATGG - Intronic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129751459 15:78067717-78067739 CAGTGTGAGAAGTGGGGATTTGG - Intronic
1129903027 15:79166229-79166251 CAGAGTAGGTTGTGGGGAGAGGG + Intergenic
1130059130 15:80557175-80557197 CAGAGTGTGCAGGGAGGAGTGGG - Intronic
1130085785 15:80777827-80777849 CATGGTGAGGACTGGGGAGAGGG + Intergenic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1131108239 15:89749028-89749050 TAGAGGGTGCGGTGGGGAGAAGG - Exonic
1131231030 15:90659661-90659683 CAGAGTGACAGGTGGGGTGAGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132020785 15:98360271-98360293 CAGAGAGAGCTGTGTGGAGGGGG - Intergenic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1132685266 16:1159444-1159466 CAGGGTGGGCCGTGGGGAGGAGG + Intronic
1132956551 16:2597357-2597379 CAGAGGGAGCAGCGGGGATCGGG + Intronic
1133392813 16:5422969-5422991 GAGAGGGAGGAGTGGGGAGAGGG + Intergenic
1133392835 16:5423029-5423051 GGGAGGGAGGAGTGGGGAGAGGG + Intergenic
1133848566 16:9480123-9480145 GAGGGTGAGCACTGGGGTGATGG + Intergenic
1133889008 16:9860666-9860688 CAGAGTGACAAGCTGGGAGATGG + Intronic
1134763434 16:16734416-16734438 CGGAGTAAGCAATGGCGAGAGGG - Intergenic
1134766167 16:16759918-16759940 CAGACTGAGAAGTTTGGAGAGGG + Intergenic
1134982618 16:18624741-18624763 CGGAGTAAGCAATGGCGAGAGGG + Intergenic
1135010868 16:18877431-18877453 GGGAGGGAGGAGTGGGGAGAGGG + Intronic
1135317755 16:21465016-21465038 GGGAGGGAGGAGTGGGGAGAGGG + Intergenic
1135370650 16:21896815-21896837 GGGAGGGAGGAGTGGGGAGAGGG + Intergenic
1135441136 16:22473904-22473926 GGGAGGGAGGAGTGGGGAGAGGG - Intergenic
1135496733 16:22958412-22958434 CAGACAGAGGAGTGGGGAGGAGG - Intergenic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1136327968 16:29546466-29546488 GGGAGGGAGGAGTGGGGAGAGGG + Intergenic
1136542395 16:30935445-30935467 AAGAGTGAAGAGTGGAGAGAGGG + Intronic
1136589921 16:31212169-31212191 CCGAGTGATCAATGGGGAAAGGG + Intergenic
1137805182 16:51297867-51297889 CAGAATGAGGAGTGGGGTGGAGG + Intergenic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138268954 16:55680983-55681005 GGGAGGGAGCAATGGGGAGAGGG - Intronic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138455414 16:57117894-57117916 CAGAGTGAGGTGCGGGGAGGAGG - Intronic
1138768416 16:59632040-59632062 CAGAGGGAGAAGTGGGGAGAGGG + Intergenic
1139680126 16:68554911-68554933 TAGAGTAGGCAGTGGGGAGAAGG + Intronic
1139889399 16:70238955-70238977 GGGAGGGAGGAGTGGGGAGAGGG + Intergenic
1140111982 16:72012360-72012382 CCAAGTGAGCAGTGGGGATTTGG + Intronic
1141157417 16:81606951-81606973 CAGTGTGAGGAGTGTGGAAAGGG + Intronic
1141254294 16:82386421-82386443 CAGAGCCACCAGTGGGGAGAGGG - Intergenic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141661682 16:85444927-85444949 CAACGTGGGCAGTGGGGAGGCGG - Intergenic
1141705504 16:85662321-85662343 GAGAGTGTGCAGAGGGGAGCAGG + Intronic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142197736 16:88746475-88746497 CAGACTGAACAGGGAGGAGAGGG - Intronic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142313090 16:89325436-89325458 GAGAGAGAGGAGAGGGGAGAGGG - Intronic
1142358821 16:89616680-89616702 CGGAGTGTGCTGAGGGGAGAAGG - Intronic
1142472192 17:170666-170688 CACAGGGAGCAATGGGGTGAGGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142615947 17:1135181-1135203 CAGAGTGAGCAGAGGGGGAGAGG + Intronic
1142718660 17:1762293-1762315 CAGAGGGAGCTGGGGGGACAAGG + Intronic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1143114927 17:4576925-4576947 CAGAGTGGGCAGTGGGGGTGGGG - Intergenic
1143476832 17:7207972-7207994 GAGAGAGAGCCGTGGGGAGGGGG - Intronic
1143574222 17:7780577-7780599 CAGAGGGATTTGTGGGGAGATGG + Intronic
1143682569 17:8488238-8488260 CCTAGTGTGCAGTGGGGATAGGG + Intronic
1144072670 17:11688742-11688764 CAGAGTGATCAATGGAGGGAGGG + Intronic
1144083337 17:11784418-11784440 CAGATCGATCAGTGGGGGGATGG - Exonic
1144128941 17:12227249-12227271 GAGTGGGAGAAGTGGGGAGATGG - Intergenic
1144746726 17:17620905-17620927 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1145769190 17:27480125-27480147 CAGGATGAGCAATGGGGTGAAGG - Intronic
1146548236 17:33757470-33757492 CAAAATGAACAGTGGGGAGCAGG - Intronic
1147036315 17:37684097-37684119 CACAGAGAGCACTGGGAAGATGG - Intergenic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147156368 17:38546370-38546392 TAAAGGGAGCCGTGGGGAGATGG + Intronic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1148020198 17:44548274-44548296 CAGAGTGAGAAGATGGGAGGGGG + Intergenic
1148214595 17:45827554-45827576 CAGAGAGGGGAGTGAGGAGAGGG - Intronic
1148466248 17:47866844-47866866 AGGAGAGGGCAGTGGGGAGATGG + Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148732664 17:49846992-49847014 AAGTGTGTGCAGTGAGGAGAGGG - Intronic
1148769723 17:50059950-50059972 CTGAGTCACCAGTGGGGAGAGGG + Intronic
1148984991 17:51613396-51613418 GAGAGGGAGAGGTGGGGAGAGGG - Intergenic
1149106613 17:52975063-52975085 TAGTGTGAGCAGTGGGGAAAAGG + Intergenic
1149636709 17:58176894-58176916 AAGCATGAGGAGTGGGGAGAGGG + Intergenic
1150201606 17:63362726-63362748 CAGAGTGGGCACTGGGAACAGGG + Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151138135 17:71967159-71967181 CAGAGGGAGCAGAGGAGAGTGGG + Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151384134 17:73744800-73744822 CCCAGGGAGCTGTGGGGAGATGG + Intergenic
1151441291 17:74130945-74130967 TGGGGTGGGCAGTGGGGAGATGG - Intergenic
1151458376 17:74240129-74240151 CCGAATAAGCAGTGGGGAGTTGG - Intronic
1151816578 17:76474222-76474244 GAGACTGAGCCCTGGGGAGATGG - Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152013733 17:77736036-77736058 AAGAGAGAGGAGTGGGGAGGTGG + Intergenic
1152940879 17:83172458-83172480 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940891 17:83172496-83172518 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940970 17:83172796-83172818 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940982 17:83172834-83172856 CTGGGTCAGCAGTGGGGTGAGGG + Intergenic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1152941026 17:83172984-83173006 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941044 17:83173060-83173082 CTGGGTGAGCAGTGGGGTGAAGG + Intergenic
1152941077 17:83173173-83173195 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941089 17:83173211-83173233 CTGGGTCAGCAGTGGGGTGAGGG + Intergenic
1152941131 17:83173363-83173385 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941143 17:83173401-83173423 CTGGGTCAGCAGTGGGGTGAGGG + Intergenic
1153255463 18:3165981-3166003 CACAGTGGGCAGTGGGTAGTAGG - Intronic
1153737108 18:8082529-8082551 CAGAGAGAGAAGGGGAGAGAGGG - Intronic
1153962587 18:10152247-10152269 CAGAGCCAGCAGTGGGCAGGTGG - Intergenic
1154157991 18:11959024-11959046 GAGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154202077 18:12307044-12307066 TGGAGAGAGCAGTGGGGAGGCGG + Intergenic
1155026585 18:21946115-21946137 GAGAGTGAGCAATGGTGAGGCGG + Intergenic
1155403518 18:25463452-25463474 CAAACTGAGCAGCCGGGAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156162247 18:34373695-34373717 CAGAGTGACAAATGGAGAGAGGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157546567 18:48550623-48550645 CAGACTGTGCTGTGGGAAGAGGG - Intronic
1157689475 18:49669223-49669245 CTGAATTAGCAGTGGTGAGAAGG + Intergenic
1158185415 18:54765821-54765843 CACAGTGAGCAATGGGGTGTGGG - Intronic
1158219956 18:55140304-55140326 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1158476461 18:57784250-57784272 CATAGAGAGCTGTGGAGAGAAGG + Intronic
1158605662 18:58893833-58893855 CAGAGAGAGCAGTGGTTACATGG + Intronic
1158951253 18:62497473-62497495 CAGAGTGAGAAGTGGAGATGGGG + Intergenic
1159861449 18:73654014-73654036 CAGAGTGAGAGCTGTGGAGAAGG + Intergenic
1160144510 18:76352502-76352524 CAGAGTGAGCTGGGGTGAGCTGG + Intergenic
1160308196 18:77760965-77760987 AAGAGAGAGCAGTGAGGAGGAGG + Intergenic
1160319276 18:77875142-77875164 CAGAGAGGGCTGTGGGGAGGTGG - Intergenic
1160399356 18:78598786-78598808 CAGAGAGAGCAGTTGGCTGATGG + Intergenic
1160894172 19:1395034-1395056 CACACTTAGCAGTGGGGAGCAGG - Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161496733 19:4590697-4590719 CAGAGTGAGGAATGGGAGGAAGG + Intergenic
1161618796 19:5287459-5287481 CAGAGTGGAGATTGGGGAGATGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161630806 19:5354508-5354530 CAGAGTGAGGAGTGGGAAAGAGG + Intergenic
1161636223 19:5390905-5390927 CAGAGTGAGTAATGGGGAGATGG - Intergenic
1161845640 19:6710584-6710606 GAGAGAGAGGAGTAGGGAGAGGG + Intronic
1161858289 19:6778407-6778429 CCCAGTGAATAGTGGGGAGAGGG + Intronic
1161895140 19:7074619-7074641 GAGAGTGGGGAGTGGGGAGGAGG + Intronic
1162735714 19:12745858-12745880 CAGAGTGAGAAGGGGTGGGAAGG - Intronic
1162791783 19:13066791-13066813 CAGGGTGAGGAATGGAGAGAAGG + Intronic
1162937575 19:13989044-13989066 GAGAGTGAGCAATGGGGGTAGGG + Intronic
1162959194 19:14116450-14116472 CAGAAAGAGCACTGGGGAGGAGG - Intronic
1163161031 19:15464259-15464281 CACAGGGGGCGGTGGGGAGAAGG - Exonic
1163218119 19:15895546-15895568 CAAACTGAGGAGGGGGGAGATGG + Exonic
1163797032 19:19343689-19343711 CAGAGGGTGCAGTGGGGACTAGG + Intronic
1163829156 19:19539654-19539676 GTGGGTGAGGAGTGGGGAGAAGG - Intronic
1164694667 19:30234344-30234366 TAGAGTCAGCAGTGGAGAGGTGG - Intronic
1165075026 19:33275842-33275864 CAGAAGCAGCAGTGGGGACAGGG - Intergenic
1165149914 19:33754102-33754124 CACAGAGGGTAGTGGGGAGATGG - Intronic
1165384790 19:35503969-35503991 CAGAGTGAGGAGGGAGCAGAGGG - Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1166007316 19:39916481-39916503 CAGAGTGAGCCCGAGGGAGAGGG - Intronic
1166045760 19:40229829-40229851 CAAAGAGTGCAGTGTGGAGAGGG - Intergenic
1166063394 19:40341788-40341810 CAAAAAGGGCAGTGGGGAGAGGG + Intronic
1166072956 19:40397434-40397456 CAGAGTGGGCAGTGAGGGCAAGG + Exonic
1166123777 19:40701504-40701526 GAGAGTGTGAAGTGGGGTGATGG - Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1167106311 19:47431854-47431876 AAGAGACAGCTGTGGGGAGAGGG - Intronic
1167112012 19:47468174-47468196 CAGACTGGGCAAGGGGGAGAGGG - Intronic
1167284742 19:48592692-48592714 CAGAGGGACAAGTGGGGTGAGGG - Intronic
1167698185 19:51026985-51027007 CAGAGAGAGAAGAGTGGAGATGG - Intronic
1167702058 19:51054639-51054661 CTGAGTGAGCAAGGAGGAGAGGG - Intergenic
1167767506 19:51493440-51493462 TATAGTCAGCAGAGGGGAGAGGG - Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1168145555 19:54418644-54418666 GACAGTGAGCAGGGAGGAGAGGG + Intronic
1168330217 19:55563802-55563824 CAGAGGGAGCAGTGAGGGGGAGG - Intergenic
1168683636 19:58334916-58334938 CAGAGTGAGCAATGTGGTCATGG - Exonic
925157525 2:1658832-1658854 CAGAGGGAGCCGCGGGGAGATGG - Intronic
925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG + Intronic
927599725 2:24430397-24430419 GAGAGAGAGGAGAGGGGAGAAGG - Intergenic
927873716 2:26640485-26640507 CAGAGGGAGGAGCTGGGAGAAGG + Intronic
929610973 2:43270386-43270408 CAGAGTGTGCCCTGGGGAAAGGG - Intronic
929759968 2:44798567-44798589 CAGAGTGATCCCTGAGGAGATGG - Intergenic
929874362 2:45784281-45784303 CAGAGGGAGCAGTGTTGACAAGG + Intronic
930025297 2:47025808-47025830 AGGAGTGAGGAGTGGGGACAGGG - Intronic
930031494 2:47060833-47060855 CTGAGTGAGAAGTGGGGAAGAGG - Exonic
930422659 2:51174089-51174111 CAGAGTTTGAGGTGGGGAGAAGG - Intergenic
931251368 2:60533517-60533539 CTGAGTGGGCAGTGGAGAAAGGG - Intronic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
932016588 2:68034314-68034336 CAGAGGTGGGAGTGGGGAGAGGG + Intergenic
932307287 2:70713096-70713118 CAGACTGAGCAGTGAACAGAAGG - Exonic
932400999 2:71481270-71481292 CAGGGAGGGCTGTGGGGAGAAGG - Intronic
932434130 2:71693242-71693264 AAGACGGAGCAGTGGGGAGATGG + Intergenic
932437893 2:71713637-71713659 TAGAGTAAGCAGAGAGGAGAAGG + Intergenic
932476722 2:72011139-72011161 CAGAGACAGCGGTGGGGAGATGG + Intergenic
933466316 2:82657291-82657313 CAGAGCTAGCAGTGGGGAAATGG + Intergenic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
933835215 2:86240449-86240471 CCGAGTGAGGAGTGAGGTGAGGG + Intronic
934960131 2:98665727-98665749 CAGAGTGATGAATGGGGAGGGGG + Intronic
936600334 2:113889525-113889547 CAGGGTGAGCAGTCGGGGAACGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937307477 2:120881368-120881390 CAGGGAGGACAGTGGGGAGAGGG + Intronic
937534197 2:122866102-122866124 GAAAGGGAGCAGTGGGGAGGAGG - Intergenic
938062289 2:128263038-128263060 CAAGGGGAGCAGTGGGGAGCAGG + Intronic
938139249 2:128782931-128782953 CCTGGTGAGCAGTGTGGAGAGGG - Intergenic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
938944127 2:136195582-136195604 CAAAGTGAGCTGGGGGAAGATGG - Intergenic
939086715 2:137728261-137728283 CAGAGAGAGTAGTGGGTGGAGGG - Intergenic
939287999 2:140157309-140157331 CAGAGAGAGCTGTGGGGAAAAGG - Intergenic
942537943 2:176985196-176985218 AATAGTGAGTGGTGGGGAGAGGG - Intergenic
942541604 2:177020936-177020958 CAGTGTGAGCATGGGGGTGAGGG - Intergenic
943857519 2:192816404-192816426 CATGGTGGGCAGTAGGGAGAGGG + Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944553903 2:200869364-200869386 CAGAGCTAGCAGTGGGGAAATGG - Intergenic
944855765 2:203765301-203765323 CAGAGTGAGGAGCCTGGAGATGG - Intergenic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
945180385 2:207085487-207085509 CTGAGTGACCAGTGGCTAGAGGG - Intronic
945502065 2:210588677-210588699 CTGAGAGAGGAGTGAGGAGAAGG - Intronic
945916435 2:215709342-215709364 CAGAGTAAGCAGTAGAGAGAAGG - Intergenic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946053156 2:216880603-216880625 CAGAGTGGGCTTTGGGAAGAAGG + Intergenic
946187808 2:217991074-217991096 CAGAGTCAGCCCTGGGTAGAAGG + Intronic
946341400 2:219071581-219071603 CAGAGTTAGAATTGGGGAGTAGG - Intergenic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946615294 2:221502434-221502456 CAGAAACAGCAGTGGGGAGAAGG + Intronic
946998741 2:225427980-225428002 CAGAGAGAGAAGTAGAGAGAGGG - Intronic
947106056 2:226668894-226668916 CAGAGATAGCAGTGTGCAGAAGG + Intergenic
947515566 2:230801055-230801077 AAGAGAGAGCACTGGGGAGCTGG + Intronic
947522822 2:230861735-230861757 CAGGAGGAGCAGTGGGCAGAAGG + Intergenic
947935777 2:234002211-234002233 CAGAGCGAGGAGTGGGCAGAGGG + Intronic
948251905 2:236536157-236536179 GAGAGAGTGAAGTGGGGAGAAGG + Intergenic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
948786170 2:240354104-240354126 CAGGGTGTGCAGTGGGGCCAGGG - Intergenic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
948909620 2:240996520-240996542 GAAGGTCAGCAGTGGGGAGAAGG + Intergenic
948939182 2:241187697-241187719 GAGAGGGAGAAGTGGGGGGAGGG + Intergenic
948983676 2:241507897-241507919 CGGAGCGGGCAGTGGGGTGAGGG - Intronic
1168787821 20:555224-555246 AAGAGTGAGAATGGGGGAGAAGG + Intergenic
1169102479 20:2963181-2963203 CAGAGTGAGAAGTATGGAGAAGG - Intronic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1169555162 20:6741538-6741560 AAGAGAGAGGACTGGGGAGAAGG + Intergenic
1169590633 20:7137515-7137537 CAAAGTGAACAGTGGCGAAAGGG + Intergenic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1171011237 20:21510474-21510496 AGGAGTGGGGAGTGGGGAGAAGG + Intergenic
1171066208 20:22017972-22017994 CAGAGGGAGGAGAGGGGATATGG + Intergenic
1171173515 20:23035159-23035181 CAGAGTCGGCAGCGGGGAGGGGG + Intergenic
1171461572 20:25300935-25300957 CAGTGTGAGGACTGTGGAGAAGG - Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1172718698 20:36983115-36983137 AAGAGAGAGCAGAGGAGAGAAGG - Intergenic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1173553672 20:43950483-43950505 CAGAGCAAGCAGTGGGGAGGGGG - Intronic
1173784392 20:45782198-45782220 CAGCTTGAGCAGTTGGGTGATGG - Intronic
1173838737 20:46142453-46142475 CAGAGTGAGCAAGGGAGAGAGGG - Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174896904 20:54459048-54459070 CAGAATGAGGAGGGGGGAAAAGG + Intergenic
1174910339 20:54601152-54601174 CAGAGTGAGCACTGGGGCTGAGG + Intronic
1175010112 20:55726308-55726330 GAGGGTGAGCAATGGGGAGGTGG + Intergenic
1175225118 20:57440114-57440136 CAGAGTGAGCAGTGGAGTTGGGG - Intergenic
1175879674 20:62250011-62250033 CAGAGTGAGCCTTGGGGGCAGGG - Intronic
1176242371 20:64081043-64081065 CAGAGTGAGTTGTGGGGAGCAGG + Intronic
1177115066 21:17075313-17075335 TGGAGTGGGCAGGGGGGAGAGGG + Intergenic
1177126349 21:17198035-17198057 AAGAGGGAACAGTGGGCAGATGG - Intergenic
1177387417 21:20425931-20425953 CAGAGTGAGGAGCCTGGAGACGG - Intergenic
1177498624 21:21920853-21920875 CAGAGTGTGCAGAGAAGAGAGGG + Intergenic
1177868964 21:26547204-26547226 GAGAGACAGGAGTGGGGAGAAGG - Intronic
1178028467 21:28495832-28495854 CTGAGGAAGCAGTGGGGAGGCGG - Intergenic
1178517901 21:33264265-33264287 CCAGGTGAGCAGTGGAGAGAAGG + Exonic
1179047623 21:37860619-37860641 CAGTGTGAGTGATGGGGAGAAGG - Intronic
1180078096 21:45473291-45473313 CAGAGGGAGCGGTGGGTAGGTGG + Intronic
1180158723 21:45989757-45989779 AAAAGGGAGCCGTGGGGAGAAGG + Exonic
1180635968 22:17263258-17263280 CAGACAGAGCAGTGGGGAGGTGG + Intergenic
1180963873 22:19775788-19775810 CAGGGGGAGGAGTGCGGAGAGGG - Intronic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181696296 22:24594485-24594507 CAGAGATGGCAGTGGGGAGAGGG + Intronic
1182001746 22:26925631-26925653 CAGAGTGAGCAATAGGGAAAGGG - Intergenic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1183072902 22:35408655-35408677 CAGGGTGAGTAGGGTGGAGAAGG + Intronic
1183392995 22:37556441-37556463 GGGAGTGGGCAGTGGGTAGATGG + Intergenic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183472899 22:38019025-38019047 AAGAGTGAGCCGTGGAGGGAGGG + Intronic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1184490939 22:44808517-44808539 CAGAGTGTGCAGTGGGGGAGGGG + Intronic
1184760760 22:46542774-46542796 CAGAGTGCACAGCGTGGAGATGG + Intergenic
1184795311 22:46728753-46728775 CAGAGTCAGCAGCTGGGAGCTGG + Intronic
1184946363 22:47807139-47807161 CAGAGGCAGCAGTGGGGACACGG - Intergenic
949533470 3:4978746-4978768 GAGGGTGAGCAGTGGGGGCAGGG + Intergenic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950412441 3:12847912-12847934 CAGAGCCAGCAGTGGGGACAGGG - Intronic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
952286276 3:31972504-31972526 CGGAGTGAGCACTGCAGAGACGG + Intronic
952570170 3:34706049-34706071 CATATTTAGGAGTGGGGAGAAGG + Intergenic
952906750 3:38144132-38144154 CAGGGAGAGAATTGGGGAGAGGG + Intergenic
953087033 3:39679472-39679494 CAGAGGGTGCGGTGGGGAGGAGG - Intergenic
953355572 3:42253684-42253706 CAGAGGGAACAGTGGTGCGAAGG + Intergenic
954331840 3:49895365-49895387 CAGGGAGTGCTGTGGGGAGAGGG + Exonic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954792870 3:53145863-53145885 CAGAGTGAGCAGGGCCCAGATGG - Intergenic
954805572 3:53218092-53218114 GAGAGTGAGCTGTGGGGGGCTGG - Intergenic
954952672 3:54489074-54489096 TGGAGGGAGCAGTGGGGAGGTGG + Intronic
955506831 3:59640791-59640813 CAAAGTGACCAGTGCTGAGATGG + Intergenic
956003155 3:64750545-64750567 CAGAGTCAGCAGTATTGAGATGG + Intergenic
956602818 3:71041016-71041038 CGGAGTGAGCACTTGGCAGAAGG + Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957893647 3:86390767-86390789 CAGAGCTAGCAGTGGGGAAGTGG - Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
961010456 3:123432344-123432366 CAAAGAGAGAAGTGGGGAGGAGG + Intronic
961352141 3:126310920-126310942 GAGAGAGAGCAGGGTGGAGATGG - Intergenic
961490851 3:127255933-127255955 AAGAGTTAGTGGTGGGGAGAGGG - Intergenic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203510 3:133417585-133417607 AGGAGTGAGTAGAGGGGAGATGG - Intronic
962261776 3:133914962-133914984 CAGACTGGGGAGTAGGGAGACGG + Intergenic
963085662 3:141434002-141434024 GAGAGTGAGCAGAGGGGAACTGG - Intronic
963090395 3:141478309-141478331 CAAATTTAGCAGTGGGGAGGAGG - Intergenic
963613718 3:147507504-147507526 AAGAGTGAGAATTGGGGGGAGGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
967267364 3:187702315-187702337 AAGAGTGAGGGCTGGGGAGAAGG + Exonic
967319716 3:188183663-188183685 CACAGTGAGCACTGGGTAAATGG - Intronic
968487637 4:871579-871601 CAGGCTGAGCTGTGGGGAGCAGG + Intronic
968647801 4:1749003-1749025 GAGGGAGAGCAGTGGGGAGGGGG - Intergenic
969057894 4:4413574-4413596 CAGAGGGAGCAGCGGGCAGTGGG + Intronic
969711383 4:8846282-8846304 CAGCCTGTGCAGTGTGGAGAGGG - Intronic
969715335 4:8865637-8865659 TAGAGGGCCCAGTGGGGAGAGGG + Intronic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
972915242 4:43868977-43868999 AACAGTGAGCAATGTGGAGAAGG + Intergenic
975281650 4:72568996-72569018 CAGAGTGTGCAGGAGCGAGAAGG + Intergenic
975609095 4:76186263-76186285 CAGAGGCAGCGGTGGGGCGAAGG + Intronic
977257793 4:94758833-94758855 CAGAGCAGGCGGTGGGGAGAGGG - Intronic
978023190 4:103839214-103839236 AGGAGTGGGGAGTGGGGAGAGGG + Intergenic
979249671 4:118553099-118553121 CAGAGTAGGGAGTTGGGAGAAGG - Intergenic
980777448 4:137454758-137454780 CAGAGCTAGCAGTGAGGAAATGG + Intergenic
981738273 4:147975370-147975392 TAGACAGAGCAGTAGGGAGAAGG + Intronic
982066282 4:151657471-151657493 CAGAGTGAGGAGTGGGGGTGGGG + Intronic
982660508 4:158201147-158201169 AAGAGTGAGGATTGGGAAGAAGG - Intergenic
983583298 4:169330217-169330239 AAGTGGGAGCAGTGGGGTGAAGG - Intergenic
985041162 4:185893246-185893268 CAGAGTGATGTGTGGTGAGAGGG + Intronic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
987061357 5:14246928-14246950 CTCAGTGAGCAGGGTGGAGAGGG - Intronic
987259688 5:16190556-16190578 AAGAGGTGGCAGTGGGGAGAAGG + Intergenic
988450836 5:31341568-31341590 CAGAGGGAACACTGGGGAGTGGG - Intergenic
988493161 5:31722245-31722267 CAGAGTGTGCGGTGTGGTGAGGG - Intronic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
989397833 5:40977536-40977558 CAGAGAGGGCTGTGTGGAGATGG + Intronic
989566584 5:42907180-42907202 GAGAGAGAGAAGTGGGTAGAGGG - Intergenic
989576221 5:42991114-42991136 CTGATTGAACAGTGAGGAGAGGG + Intergenic
990796289 5:59544688-59544710 CACAGTGAGTAGTGGGGAGAAGG + Intronic
990890479 5:60643911-60643933 TAGCCTGAGCAGTGGTGAGAGGG - Intronic
991168756 5:63595052-63595074 CAGAGGGTGTTGTGGGGAGAAGG + Intergenic
991481923 5:67090291-67090313 GAGGGGGAGAAGTGGGGAGAGGG - Intronic
991992390 5:72353071-72353093 GAGAGTGAAAAGTGAGGAGAAGG - Intronic
992295287 5:75321470-75321492 CAGAGCTAGCAGTGGGAAAATGG + Intergenic
992473292 5:77077860-77077882 CAGAATGAGGAGTGGCGAGCCGG - Exonic
992871124 5:81006693-81006715 CAGACGGAGAAGTGGGGAAAGGG - Intronic
994578609 5:101611426-101611448 GAGAGTGAGCAAGGCGGAGAAGG + Intergenic
995385544 5:111584865-111584887 CAGAGAGAGCTGTGTGGAAAGGG + Intergenic
995749561 5:115440054-115440076 CAGAGGGAGAAGGGTGGAGAAGG - Intergenic
995805865 5:116051707-116051729 CGCAGTGAGCAGTGGGGAGGAGG - Intronic
997015413 5:129928187-129928209 CAGGGTGGGGGGTGGGGAGAGGG - Intronic
997234803 5:132266579-132266601 CAGAGTGAGCCCAGGGCAGAGGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
999282281 5:150373756-150373778 CAGACTGGGCTGTGGGGAGGGGG - Intronic
999408091 5:151324952-151324974 CAGAGAGAGGAGTCGGGAGGTGG - Intronic
999902187 5:156096361-156096383 CAGAGCTAGCAGTGGGGAAATGG + Intronic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001548813 5:172587319-172587341 GAAAGTCAGAAGTGGGGAGAAGG + Intergenic
1001910372 5:175512409-175512431 CAGACTGAGGAGTGCGGGGAGGG + Intronic
1002110622 5:176908165-176908187 GAGAGAGAGAAGGGGGGAGAGGG + Intronic
1002321207 5:178377144-178377166 CTGAGTCAGCAGTGGGCAGCGGG + Intronic
1002586598 5:180252669-180252691 CACACTGAGGACTGGGGAGACGG + Intronic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003507460 6:6751559-6751581 GTGAGTGTGCAGTGGGGAGCAGG + Intergenic
1004069713 6:12287568-12287590 CAGAGGGAGAAATGGAGAGATGG + Intergenic
1004460273 6:15828730-15828752 AGTGGTGAGCAGTGGGGAGAGGG - Intergenic
1004581484 6:16958432-16958454 TTGAGTGAGCAGTGGCAAGACGG + Intergenic
1005131549 6:22514185-22514207 CAGAATGTGCAGTTGGAAGAAGG + Intergenic
1005675933 6:28154859-28154881 CACAGTGTACAGTGGGGAGGTGG - Exonic
1006234241 6:32614602-32614624 CATATGGAGCTGTGGGGAGAGGG - Intergenic
1006442180 6:34059597-34059619 AAGAGGGAGCTGTGGGCAGAAGG - Intronic
1006456454 6:34134703-34134725 GAGAAAGAGCAGTGGAGAGATGG - Intronic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1007071667 6:39042633-39042655 TAGTGTCAGAAGTGGGGAGAAGG - Intergenic
1007075031 6:39060856-39060878 GAGTGTGTGCATTGGGGAGAAGG + Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007377888 6:41468925-41468947 CAGAGTGAGGAGTGGTCAGTAGG - Intergenic
1007420161 6:41714469-41714491 AAGAGGGAGCAGGGGCGAGAAGG + Intronic
1007535108 6:42580187-42580209 CAGAGAGAGCAGTGTAGACAAGG - Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1007809904 6:44478338-44478360 CAGAGGGTGCAGTGGGGGGTTGG + Intergenic
1008499511 6:52166947-52166969 GAGAGGAAGCAGTGGGGAAAGGG - Intergenic
1009469657 6:64016918-64016940 CAGAGTGAGTGGTGGAGACAGGG - Intronic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1010116446 6:72317090-72317112 CATGGGGAGCAGTGGGGAGGAGG - Intronic
1010160811 6:72852605-72852627 CAGAGAGGGCAGTGGAGAGAAGG + Intronic
1010517599 6:76791698-76791720 GAGAGACAGCAGTGGGGAGGAGG + Intergenic
1010631372 6:78202440-78202462 CAGAGCTAGCAGTGGGGAAATGG + Intergenic
1011759733 6:90549273-90549295 GAGAGTGAGGAGTGGCGAGGAGG + Intronic
1012416243 6:99017113-99017135 AAAAGTGTGCAGTGGAGAGAAGG - Intergenic
1012920975 6:105220911-105220933 CAGAGTGTGCAGTGGGGAAAGGG - Intergenic
1013432765 6:110069788-110069810 CAGAGTGAGCCAAGAGGAGAGGG - Intergenic
1014034574 6:116750682-116750704 CAGAGAGAGTGGTGGAGAGAGGG + Intergenic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016463999 6:144308106-144308128 GAGAGTGAGCGGTGGAGGGAGGG - Intronic
1016875926 6:148864565-148864587 CAGAGTGAGCAATACAGAGACGG - Intronic
1016933372 6:149430123-149430145 CACAGAGAGCAGTGGGTACATGG + Intergenic
1017521772 6:155208966-155208988 CGGGGTGGGCAGCGGGGAGAGGG - Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017536398 6:155351331-155351353 AAGAGAGGGAAGTGGGGAGATGG + Intergenic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018926010 6:168207548-168207570 CAGAGAGGGCAGTGTGGAGATGG + Intergenic
1019291766 7:254042-254064 CAGCGTTGGCAGTGGGGTGAGGG + Intronic
1019491247 7:1314597-1314619 CAGGGAGAGCAGTGGGGAAGAGG - Intergenic
1019555139 7:1625551-1625573 GGGAGAGAGCAGTGGGGAGCTGG - Intergenic
1020340174 7:7101519-7101541 CAGAGGGAGCAGGAGGGAGTAGG - Intergenic
1021226941 7:18038993-18039015 GAGAGTGAGCTGTGATGAGAGGG + Intergenic
1021489672 7:21205432-21205454 CAGATTGAGCAGAGGCCAGAGGG + Intergenic
1021570730 7:22062431-22062453 CAGAGGGAGCTGTGTGGAAAAGG + Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1021954192 7:25807326-25807348 GGGAGGGAGGAGTGGGGAGAGGG + Intergenic
1022126902 7:27366894-27366916 CAGAGTACGAAGTGGTGAGATGG + Intergenic
1022251199 7:28610224-28610246 CTGGGTGAACAGTGGGGAGCTGG + Intronic
1022280413 7:28903057-28903079 CACACTGAGCAGTGGGAACAGGG - Intergenic
1022514321 7:30965734-30965756 CAGACTGTGCAGTAGGCAGAAGG + Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023618759 7:42048429-42048451 CCGAGTGAGGAGCGGGGAGGAGG + Intronic
1023873453 7:44274832-44274854 GTGAGTGAGGATTGGGGAGATGG - Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023885369 7:44350071-44350093 CATTGTGAGGGGTGGGGAGAAGG - Intergenic
1024323883 7:48093775-48093797 CAGGGGGAGCAGCGGGGACAGGG - Intronic
1024392514 7:48831710-48831732 CATGGTGGCCAGTGGGGAGATGG - Intergenic
1026050453 7:66942168-66942190 CAAAGTGAGTCCTGGGGAGATGG - Intronic
1026244000 7:68602167-68602189 CAGATTCAGAAGTGGGGAGCAGG - Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1027647646 7:80823920-80823942 CAGAGAGAGAAATGGGGAGTAGG + Intronic
1028593996 7:92528555-92528577 CAGGATGCGCAGCGGGGAGAGGG - Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029363577 7:100103364-100103386 CTGAGTGATCAGTGGAGGGAAGG - Intronic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1029654012 7:101912577-101912599 CAGAGGGGCCGGTGGGGAGAGGG - Intronic
1029699771 7:102238710-102238732 CAGAGTGAAAAGTGGGGTGGGGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1031389857 7:121200951-121200973 AAGAGAGAGCAGTGAAGAGAAGG + Intronic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032425579 7:131819929-131819951 CAGAGAGGGCGGTGAGGAGAGGG - Intergenic
1032991878 7:137403012-137403034 CAGAGTGTGCAGGGTGGCGAAGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1033796710 7:144853906-144853928 CAGAGTGAGTAGTGTGTGGAAGG - Intergenic
1034031449 7:147770378-147770400 AAGAGGGAGGAGTGGGGAAATGG + Intronic
1034269645 7:149797366-149797388 CAGAGGGTGGAGTGGGGGGACGG + Intergenic
1034437038 7:151067573-151067595 CAGAGTGAGCACTTGAGAAATGG - Intronic
1034838998 7:154378297-154378319 CAGAGGGAGAAGTGAGGAAATGG + Intronic
1034899164 7:154896839-154896861 CAGAGTGAGAAGGAGCGAGAGGG + Intergenic
1035362488 7:158322635-158322657 CCCAGTGGGCAGTGGGGACAAGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036023702 8:4878956-4878978 CACAGTGAGAAGCAGGGAGAGGG + Intronic
1036403723 8:8434311-8434333 CAGAGGGTGCAGAGGAGAGAAGG + Intergenic
1036746416 8:11413125-11413147 GAGAGAGAGAAATGGGGAGAAGG - Intronic
1036971977 8:13365628-13365650 CTGAGCGAGCCGTGGTGAGACGG + Intronic
1037116424 8:15235090-15235112 CGGTGTGATCAGTGGAGAGAGGG - Intronic
1037703800 8:21298155-21298177 CAGAGAGGGCTGTGGGGAGCGGG + Intergenic
1038261227 8:25997145-25997167 CAGAGTGGGCGGTAGGGAGTGGG - Intronic
1038369452 8:26973331-26973353 CCGAGTTTGCAGTGGGGAAAAGG - Intergenic
1038559522 8:28559852-28559874 CAGAGTGAGTATTGGGAAGTGGG - Intronic
1039719890 8:40151884-40151906 CAGAGTGAGCAGGGCAGAGTGGG - Intergenic
1039842910 8:41306666-41306688 CAAAGAGAAAAGTGGGGAGAGGG - Intronic
1039920521 8:41891040-41891062 CAGAGAGAGCAATGGGGTGGGGG + Intronic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1041340982 8:56845107-56845129 GGGAGTGAGCAGATGGGAGAGGG + Intergenic
1041346804 8:56907445-56907467 CAGAGTTGGCAGGAGGGAGAGGG - Intergenic
1041624534 8:60010468-60010490 CAGAGTGCACAGTGTGGGGATGG + Intergenic
1042216844 8:66436430-66436452 CAGAGTGAATAAGGGGGAGATGG + Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042642713 8:70953774-70953796 CAAAGTGATCAGTGGGGACCAGG - Intergenic
1043595149 8:81877025-81877047 CAAAGTATGCAGTGAGGAGATGG - Intergenic
1044923411 8:97188839-97188861 CAGAGGGCACAGTGGGTAGAGGG - Intergenic
1045151006 8:99408044-99408066 CAGAGAGAGCACTGGGAAGAGGG + Intronic
1045180403 8:99775390-99775412 GACAGTGAGCTGTGGGGAAAGGG + Intronic
1045193853 8:99910004-99910026 CAAAGTGATCAGTGAGGGGAGGG - Intergenic
1045238513 8:100377397-100377419 CAGAGGGAGTAGTAGAGAGAAGG + Intronic
1045479326 8:102579755-102579777 GAGAGTGAGGAGTGGGGTGAGGG - Intergenic
1045737946 8:105318556-105318578 GAGAGCGAGCAGCGAGGAGAGGG - Intronic
1046551936 8:115729033-115729055 GAGAGAGAGAAATGGGGAGAGGG + Intronic
1046728789 8:117703283-117703305 CAGGGTGTGGTGTGGGGAGAGGG - Intergenic
1048162297 8:132032470-132032492 AAGAGAGGGGAGTGGGGAGACGG - Intronic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049258374 8:141625753-141625775 CAGAGTGAGGAGCTTGGAGAGGG + Intergenic
1049575532 8:143388131-143388153 CCCAGTGAGCAGTTGGGGGAGGG + Intergenic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1049791531 8:144474729-144474751 CACAGGGAACAGTGGGGAGGAGG - Exonic
1049824812 8:144661864-144661886 CAAGGTGAATAGTGGGGAGAGGG - Intergenic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1050182901 9:2939344-2939366 AAAGGTGGGCAGTGGGGAGATGG + Intergenic
1050317999 9:4423035-4423057 CAGAAGCAGCAGTGGGGACATGG + Intergenic
1051335738 9:16064388-16064410 CAGATAGAGGTGTGGGGAGAGGG + Intergenic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1053036172 9:34828149-34828171 CAGAGGGACAAGTGGGGAGCTGG - Intergenic
1053350411 9:37410321-37410343 CAGAGTGAGGGAGGGGGAGAAGG + Intergenic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055224342 9:73975700-73975722 GAGAGTGAGGGGTGGTGAGAGGG + Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1055494252 9:76838791-76838813 GGGAGTGAGCAGTGGTGGGAAGG + Intronic
1056042011 9:82677959-82677981 CACAGCCAGCAATGGGGAGAGGG - Intergenic
1056228178 9:84517295-84517317 CAGAGTGAGTAGTAGCGACAGGG + Intergenic
1056268669 9:84925118-84925140 CAGAGAGGGCAGTGGGGTGGGGG - Intronic
1056695663 9:88848694-88848716 GAGAGTGAGTAATGGGGAGTAGG - Intergenic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1057321046 9:94013099-94013121 AAGAGTGAGCAAGAGGGAGAAGG - Intergenic
1057952992 9:99384975-99384997 CAGAAAGACCACTGGGGAGATGG + Intergenic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059303929 9:113339395-113339417 CAGAGGGAGATTTGGGGAGACGG - Intronic
1059725259 9:117002446-117002468 CAGAGTAAGCAATGGAAAGAGGG + Intronic
1059727391 9:117022817-117022839 CAGAGTGGGCAGTGGGCAGTGGG + Intronic
1060551979 9:124489981-124490003 GAGAGGGAGGAGTGGGGAGTGGG - Intronic
1060876083 9:127084516-127084538 CACAAAGAGCAGTGGGAAGAGGG - Intronic
1061250198 9:129421950-129421972 CAGGGAGAGCAGTGGGGACAAGG - Intergenic
1061375376 9:130220870-130220892 CAGAGTGGACTGTGGGGAGGAGG + Intronic
1061951772 9:133940211-133940233 CAGAGTGGGCACTGGGGTGTGGG + Intronic
1062063836 9:134515258-134515280 GTGAGTGGGCGGTGGGGAGATGG - Intergenic
1062070811 9:134554086-134554108 CGGAGTGAGCAGGGGGGTGTGGG + Intergenic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062707553 9:137953794-137953816 CAGAGGGTGTTGTGGGGAGAGGG + Intronic
1185487054 X:490069-490091 CTAAGTGAGCCCTGGGGAGAAGG + Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185922983 X:4114571-4114593 AGGAGTGAGCAGTGAGGAGAAGG - Intergenic
1185933933 X:4234374-4234396 CAGAGTGATGAGTGATGAGAAGG - Intergenic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186786290 X:12959155-12959177 CAGGGGCAGCAGTGAGGAGAAGG - Intergenic
1187081290 X:15991063-15991085 AAGAGTGAGATGTGGGGACAGGG - Intergenic
1187516882 X:19979925-19979947 GAGAGAGAATAGTGGGGAGAGGG + Intergenic
1187989702 X:24856207-24856229 CAGAGTTAGGAGTGGGAAGGAGG - Intronic
1188793378 X:34433127-34433149 AAGGGTGAGCACTGGGGAAAGGG + Intergenic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189758372 X:44295572-44295594 CAGAGTGGGCAGTTGAGAAAGGG + Intronic
1190480563 X:50872666-50872688 GAGAGAGAGCAGTGGGGAGGAGG - Intergenic
1191006231 X:55714153-55714175 AAGGGGGAGAAGTGGGGAGATGG - Intergenic
1191907267 X:66107161-66107183 CAGAGTAAACAGTGTAGAGAAGG - Intergenic
1192256829 X:69468544-69468566 GAGTGTGAGCAGTGGGGCGAGGG + Intergenic
1192743440 X:73915298-73915320 CAGGATGGGAAGTGGGGAGAGGG + Intergenic
1194235873 X:91382516-91382538 GAGAGTGGGGAGTGGGGAGGTGG - Intergenic
1194535622 X:95103204-95103226 CAGGGTGAGCAATGGGGGCATGG + Intergenic
1195255053 X:103082121-103082143 CAGAGAGAGGAGTGGGGCGAGGG + Intronic
1195645461 X:107226345-107226367 CAGTGAGAGCTTTGGGGAGAGGG - Intronic
1195678273 X:107524012-107524034 CAGACTGTGGCGTGGGGAGAAGG - Intronic
1198682683 X:139199689-139199711 GAGGGTGAGCTGTGGGGCGAAGG - Intronic
1200046483 X:153405555-153405577 CAGAGTGAAGGGTGGGGAAAGGG - Intergenic
1200312291 X:155089858-155089880 TAGACTGAACAGTGGGCAGAGGG + Intronic
1201461734 Y:14233013-14233035 GAGAGGGAGGAGGGGGGAGAAGG - Intergenic