ID: 1166391338

View in Genome Browser
Species Human (GRCh38)
Location 19:42410490-42410512
Sequence CAGCTCGGCCAGGTTGTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166391327_1166391338 17 Left 1166391327 19:42410450-42410472 CCAGAGCGCGGAGCTGGGTGAGG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG 0: 1
1: 0
2: 0
3: 32
4: 190
1166391333_1166391338 -10 Left 1166391333 19:42410477-42410499 CCAGGTAGGCCTCCAGCTCGGCC 0: 1
1: 0
2: 3
3: 19
4: 193
Right 1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG 0: 1
1: 0
2: 0
3: 32
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166391338 Original CRISPR CAGCTCGGCCAGGTTGTGGC TGG Exonic
900102900 1:970412-970434 CAGCACAGCCAGGTGGGGGCCGG + Exonic
900177290 1:1296454-1296476 CAGCACGCCCAGGTTGATGCTGG + Exonic
900495094 1:2972590-2972612 CTGCTCGGCCGGGTGGGGGCTGG + Intergenic
901451552 1:9339367-9339389 CCGCCAGGCCAGGTTCTGGCAGG + Intronic
901863898 1:12091485-12091507 CTGCTCTGCCAGGGTGTGGCAGG - Intronic
904078716 1:27858655-27858677 CAGCTGTGCCAGGTTGGGCCTGG + Intergenic
905509931 1:38511232-38511254 CAGCCCAGCCAGGTAGAGGCTGG + Intergenic
906102664 1:43273102-43273124 CAGCCCGGCCAGGGTCAGGCCGG - Exonic
913410179 1:118542517-118542539 TAGCTCTGGCAGGTGGTGGCTGG - Intergenic
914877618 1:151524062-151524084 CAGGAGGGCCAGGTTGTAGCGGG + Intronic
915088443 1:153404888-153404910 CACCTCGCCCTGGTTGTCGCCGG - Intergenic
915595614 1:156894827-156894849 CAGCTCGGGCAGGATTGGGCCGG + Intronic
917473741 1:175350186-175350208 CAGCTCAGCCTGGATGTGGAAGG + Intronic
919944220 1:202308000-202308022 CAGCTTGGCAAGGAGGTGGCAGG - Intronic
920805509 1:209230486-209230508 CAGTTCTGCCAGGTTATGGCTGG + Intergenic
920922594 1:210310743-210310765 CACCTAGCCCAGGGTGTGGCAGG + Intergenic
1063558981 10:7108861-7108883 CAGCTGAGGCAGGTTGGGGCAGG + Intergenic
1064804654 10:19116891-19116913 CATGTTGGCCAGGTTGAGGCTGG - Intronic
1065236462 10:23657573-23657595 CACCTTGGCCAGGCAGTGGCCGG + Intergenic
1067162621 10:43840211-43840233 CAGCTCAATCAGGTTGGGGCTGG - Intergenic
1067281782 10:44878899-44878921 CAGCTCAGCCAGGCTGAGGCAGG - Intergenic
1067572550 10:47382058-47382080 GAGCTCAGGCAGGTAGTGGCAGG - Intronic
1068009800 10:51434003-51434025 CAGCTCAGCCAGGTAATGGCAGG - Intronic
1069899499 10:71699259-71699281 TAGCTCAGCCAGGAGGTGGCTGG + Intronic
1071226736 10:83539279-83539301 CACCTGGGCCAGGGTGTGCCAGG - Intergenic
1072209381 10:93232573-93232595 CAGCTCGGTCAGTTTGAGGCAGG + Intergenic
1077042222 11:529885-529907 CAGCTAGGCCAGTGTGTGGCAGG - Intergenic
1077329715 11:1978852-1978874 CAGGCTGGCCAGGTTGTGGGAGG + Intronic
1077675354 11:4189892-4189914 CACCTAGGCCTGGTTGTGGAAGG - Intergenic
1077843733 11:6002376-6002398 CAGCTCTACCAGTTTGTGGCAGG - Exonic
1078718480 11:13861653-13861675 GAGCTGGCCCAGGTTGAGGCAGG + Intergenic
1079077270 11:17391790-17391812 CAGGTCAGCCAGGTGGTGTCTGG - Intergenic
1082804434 11:57438556-57438578 CAGCTTGGGCTGGTTGTGGCTGG + Intergenic
1083264970 11:61542396-61542418 CAGCTGGCCCAGGCTCTGGCTGG + Intronic
1086450037 11:86906466-86906488 TGGCTCGGCGAGGTTGTAGCTGG + Intronic
1088358854 11:108970381-108970403 TGGCTGGGTCAGGTTGTGGCGGG - Intergenic
1202812693 11_KI270721v1_random:34031-34053 CAGGCTGGCCAGGTTGTGGGAGG + Intergenic
1096245268 12:49981386-49981408 CAGCCAGGCCAGCGTGTGGCAGG + Intronic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1098039140 12:66336569-66336591 CAACTCAGCCTGGTTCTGGCAGG - Intronic
1098147855 12:67516076-67516098 CAGGTGGGCCTGGTTGTTGCAGG - Intergenic
1098302350 12:69067155-69067177 CAGCCCTGCCAGCATGTGGCTGG + Intergenic
1098768041 12:74514723-74514745 CAGCTCGGCCAGGAGCTGGCCGG + Intergenic
1101994099 12:109512241-109512263 CACCTCGCCCAGGTTATGGGGGG - Intronic
1103173791 12:118844353-118844375 CAGCTCTGTGAGGCTGTGGCTGG - Intergenic
1103913064 12:124362676-124362698 CAGCTGGGCCAGGTTCTGGGAGG - Intronic
1103913108 12:124362823-124362845 CAGCTGGGCCAGGTTCTGGGAGG - Intronic
1104945781 12:132414356-132414378 CAGCTGGGACAGGGTGTGGCGGG - Intergenic
1105669236 13:22593707-22593729 CAGCTCTGCAAGGTTGATGCAGG - Intergenic
1112726843 13:102313969-102313991 CAACTCTGCCAGGCTGAGGCCGG + Intronic
1113321131 13:109233412-109233434 CAGCTCCACCAGCTTCTGGCAGG - Intergenic
1114102274 14:19390419-19390441 CACCTCTGCAAGGGTGTGGCAGG + Intergenic
1118905946 14:70023220-70023242 CCGCTCCTCCAGGGTGTGGCTGG - Exonic
1120191908 14:81447242-81447264 CAGCTCTGCCAGCTTCTAGCTGG + Intergenic
1120817082 14:88872403-88872425 CAGCACAGCCAGGTTGTTGTAGG - Exonic
1121952760 14:98185908-98185930 CAGATCGGACAGGTAGTGGAAGG + Intergenic
1121974890 14:98393789-98393811 CAGCTTTGCCAGCCTGTGGCTGG - Intergenic
1122037958 14:98962075-98962097 CAGGTCTGCCAGGCTGGGGCTGG - Intergenic
1202837278 14_GL000009v2_random:87504-87526 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1202906665 14_GL000194v1_random:77634-77656 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1124204746 15:27707640-27707662 CAGCTCTGCCAGCTTATTGCTGG + Intergenic
1124629013 15:31326752-31326774 CTGCGCCGCCAGGATGTGGCTGG + Intergenic
1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG + Exonic
1132152487 15:99472709-99472731 CACCTGAGCCAGGTTGTGGAGGG - Intergenic
1132594578 16:742574-742596 AAGCTCGGCCAGGTATTGCCAGG - Intronic
1132809559 16:1790999-1791021 CAGCTCTGCCAGGCGGTTGCGGG + Exonic
1132892776 16:2212493-2212515 CAGCTCGCCAAGGTTCTGGGCGG - Exonic
1133774835 16:8888156-8888178 CAGAGCAGCCAGGCTGTGGCAGG + Intergenic
1138318461 16:56090533-56090555 CAGGTGGGACAGGTTGAGGCAGG - Intergenic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1139644369 16:68317404-68317426 CAGATGAGCCAGATTGTGGCTGG + Intronic
1139965500 16:70742776-70742798 CAGCCCGGCTGGGCTGTGGCGGG + Intronic
1141715466 16:85724438-85724460 CAGCTCGGCCATACTCTGGCTGG + Intronic
1141749445 16:85948381-85948403 CACCTGGGCCAGCTTCTGGCCGG - Intergenic
1141855240 16:86676803-86676825 CTCCTTGGCCAGGTTATGGCAGG - Intergenic
1142183112 16:88681290-88681312 CAGCCCGGCCAGCGTGTGGTAGG + Exonic
1143253921 17:5541946-5541968 CAGCTCGGTCAGGGTCTGGTTGG + Exonic
1143670508 17:8392940-8392962 GAGCTCTGCCAGGCTGCGGCGGG + Exonic
1143723058 17:8827172-8827194 CATCTCAGCCAGCTTGTGGATGG + Exonic
1147918124 17:43900612-43900634 CAGCCCGGCCAGGCTTTGGCTGG - Intronic
1148157990 17:45434216-45434238 CAGCACAGCCAGGCAGTGGCTGG + Intronic
1148674650 17:49438414-49438436 CAGCTCGGCCAGCTGCTGGAGGG + Intronic
1148836487 17:50468439-50468461 CAGCTCGGTCAGGTCGTCGAAGG + Exonic
1148957680 17:51367001-51367023 CATCTCACCCAGGTTGTGGCTGG - Intergenic
1150291210 17:63983443-63983465 CAGCTGGGGCAGGCTGTGGGTGG + Intergenic
1151384712 17:73748000-73748022 CAGCTCCCCCAGTTTCTGGCTGG + Intergenic
1152239282 17:79153111-79153133 CAGCTGGACCAGGGTGAGGCAGG - Intronic
1152597596 17:81245620-81245642 CAGCTCCGCCAGGCTGCGGGGGG - Exonic
1152869146 17:82742519-82742541 CAGCTCTTCCATGTTGTAGCAGG + Intronic
1153093164 18:1371511-1371533 CATCTTGGCCAGGATGTGGGAGG - Intergenic
1154078859 18:11234620-11234642 CAGTTCAGCCAGGTAGTGCCAGG + Intergenic
1155225555 18:23726310-23726332 CACCTGGGCCAGGCTCTGGCTGG - Intronic
1155264367 18:24076548-24076570 CTGCTTGGCCTGGCTGTGGCTGG + Intronic
1155618246 18:27746087-27746109 CAGCACGGCCAGGTAGAAGCAGG + Intergenic
1156456910 18:37299904-37299926 CAGCTTGGTCAGGTTGTCCCAGG + Intronic
1157125605 18:44952885-44952907 CCGCTCGCTCAGGATGTGGCTGG - Exonic
1157453422 18:47804868-47804890 CAGCATGGCCAGGGTGCGGCAGG - Intergenic
1158877242 18:61745100-61745122 CAGCTCTGCCACATTTTGGCTGG - Intergenic
1160716455 19:579024-579046 CAGCTGGGCGCGGTGGTGGCCGG - Intronic
1160864342 19:1250418-1250440 CGGCACGGCCAGGTCGTAGCGGG - Exonic
1161457170 19:4375228-4375250 CAGCTGGGCCAGGTGGGGGCTGG - Intronic
1162699409 19:12502424-12502446 TCGCTCTGCCAGGTGGTGGCTGG + Intronic
1163585230 19:18160369-18160391 CAGCTGGGGCAGTTTGAGGCAGG - Intronic
1164116363 19:22223086-22223108 AAGCTCTCCCAGGCTGTGGCTGG + Intergenic
1164200057 19:23010554-23010576 GAGCTCTCCCAGGCTGTGGCTGG + Intergenic
1164838134 19:31371791-31371813 GAGTTGGGCCAGGTGGTGGCAGG + Intergenic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1166541267 19:43607656-43607678 CAGCTCCCCCAGGTTGTCGAAGG + Exonic
1167722818 19:51190564-51190586 CAGTGGGGCCAGGTTGAGGCGGG - Intergenic
1167756052 19:51414652-51414674 CACCTGGGCCGGGGTGTGGCAGG - Intronic
1168097669 19:54124730-54124752 CAGCTGGGCCAGATGGTGGGTGG - Intronic
1168157677 19:54485374-54485396 CAGCTTGTCCAGGTGGTGGACGG + Intergenic
1168290348 19:55354380-55354402 CTGCTCAGCCAGGTTATGGGAGG - Exonic
1202635365 1_KI270706v1_random:39847-39869 CACCTCTGCAAGGTTGTGCCAGG + Intergenic
926197531 2:10772842-10772864 CTGCTCGGCCAGGTGGGGCCAGG - Intronic
927689072 2:25194700-25194722 CAGCTCTGCCAGGTCATGCCTGG - Intergenic
928979008 2:37119061-37119083 CAGGACGGCCAGCTTGTGACAGG + Intronic
929799198 2:45085021-45085043 CAGCTGGGCCAGTATGTGGAAGG + Intergenic
929955044 2:46451456-46451478 CAGCTCTGCCATGTCCTGGCTGG - Intronic
931253143 2:60550857-60550879 CAGCCCGGCCAGGTACCGGCGGG - Intronic
933726670 2:85431018-85431040 CTCCTCGGCCAGGTTGGGGCAGG + Intronic
933911151 2:86942466-86942488 CCGCCCGGCCAGGTCGAGGCCGG - Intronic
933911202 2:86942640-86942662 CCGCCCGGCCAGGTCGAGGCCGG - Intronic
936047807 2:109200641-109200663 CAGCTTGGCCAGGTAGGGGTGGG - Intronic
937222962 2:120352690-120352712 CAGCACAGCCAGCTGGTGGCAGG + Intergenic
946702145 2:222424592-222424614 CAGCTCGGCCATGGTGTGCCCGG - Exonic
947282415 2:228470019-228470041 AAGCTGAGCCAGGCTGTGGCTGG + Intergenic
947824007 2:233092120-233092142 CAGCTCTGCGAGGTTGGCGCTGG + Intronic
948809905 2:240469148-240469170 CAGCTGGGCAAGGTGGTGCCTGG - Intergenic
949073558 2:242041010-242041032 CGCCTCGGCCGGGGTGTGGCCGG - Intergenic
1171008203 20:21489202-21489224 CAGCATGGCCAGGTTTTGGTGGG + Intergenic
1171255690 20:23687730-23687752 CAGCTCTGCCACGTAGTGTCTGG - Intronic
1171263026 20:23749650-23749672 CAGCTCTGCCACATTGTGTCTGG - Intronic
1171959598 20:31484405-31484427 GAGCACGGCCAGATTGTGGCAGG - Exonic
1173751666 20:45481373-45481395 CTGCTCAGCCTGGTGGTGGCTGG - Exonic
1175624520 20:60479208-60479230 CAACTCGGCCATGCTGGGGCAGG - Intergenic
1176168721 20:63687668-63687690 CAGCTCGTGCATGCTGTGGCCGG - Exonic
1176257200 20:64158681-64158703 CAGGTGGGGCAGGTGGTGGCAGG - Intronic
1176626013 21:9092433-9092455 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1178768672 21:35481419-35481441 CAGCTGAGTCAGGTAGTGGCTGG - Intronic
1178843710 21:36157237-36157259 CCGCTCGGCGAGGGCGTGGCCGG - Intronic
1179802176 21:43816294-43816316 CAGCTCAGCCAGGTGGTGAACGG + Intergenic
1180365343 22:11933380-11933402 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1180698955 22:17771426-17771448 CAGCTTGGCCAGGGTGGGGGTGG - Intronic
1180951857 22:19724031-19724053 CAGCGCCGTCAGGTTGTTGCCGG - Exonic
1181629590 22:24143597-24143619 CAGCTGGGCCTGGCTGTGCCTGG + Intronic
1182522196 22:30891005-30891027 CAGCTTGGCCAGAGTGTGGGTGG - Intronic
1183452849 22:37906221-37906243 CTGCTCGGGCAGGTTAGGGCAGG + Intronic
1183949664 22:41345822-41345844 CAGCTCTGCCAAGTCCTGGCAGG + Intronic
1184899336 22:47434581-47434603 CAGCGGGGCCAGGCTGTGCCGGG - Intergenic
1184961058 22:47928876-47928898 CAGCTCTGCCCGGTGATGGCAGG + Intergenic
1185005948 22:48277079-48277101 CAGCCCGGCCAGGCTGGAGCTGG - Intergenic
950262595 3:11553639-11553661 CAGCCCAGCCAGGCTGTGGATGG - Intronic
950422204 3:12905802-12905824 CAGCTTGGCCAGGGAGGGGCAGG + Intronic
954155339 3:48682111-48682133 CTGCTCGGCGAGGCTGTGGTGGG + Exonic
954659347 3:52218699-52218721 GAGCTGGGCCAGGGTGGGGCTGG - Intergenic
957217986 3:77346648-77346670 TAGCTCATCCAGGTTGTTGCAGG + Intronic
960611008 3:119554636-119554658 CACCTCTGCCATGGTGTGGCAGG + Intronic
960810283 3:121621659-121621681 GTGCTTGGCCAGTTTGTGGCGGG - Exonic
963010019 3:140760223-140760245 CAGCTCGGCAAGCATCTGGCTGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
966040212 3:175475633-175475655 CAGGTTGGCCAGTTTCTGGCAGG - Intronic
967649784 3:191972843-191972865 CAGCTCTGCAAGGCTGTGGCTGG + Intergenic
968295321 3:197571913-197571935 TAGCCAGGCAAGGTTGTGGCAGG + Intronic
969506873 4:7593631-7593653 CAGGTTGGCCAGGTTTCGGCTGG - Intronic
970613689 4:17747990-17748012 CAGCTCCTCCAGGCTGAGGCAGG + Intronic
980404999 4:132344640-132344662 CAGCTGGATCAGTTTGTGGCGGG - Intergenic
982074528 4:151725270-151725292 CAGCTCGGCTGGCTTCTGGCTGG - Intronic
1202762675 4_GL000008v2_random:125727-125749 CACCTCTGCAAGGTTGTGCCAGG + Intergenic
985536173 5:466867-466889 CAGCTTGGCCACGTTCAGGCTGG - Exonic
985696565 5:1344477-1344499 CAGCTCGGCCAGGCCCTGGCAGG + Intronic
991492452 5:67196226-67196248 CAGCTCCCCTAGGTTGAGGCAGG + Intronic
992609144 5:78492382-78492404 CAGCTCTGCCACCTTGTGTCAGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994814508 5:104568267-104568289 CAGCTGGGCATGGTGGTGGCAGG + Intergenic
999270412 5:150293602-150293624 CAGCTGTGCCCGGTGGTGGCGGG + Intergenic
1000119117 5:158179806-158179828 CCTCCCTGCCAGGTTGTGGCCGG + Intergenic
1002043364 5:176529621-176529643 CCGCTCGGCCAGGTTCAGGAGGG + Exonic
1005670848 6:28104895-28104917 CAGCTCAGCCAGGTGCGGGCGGG + Intergenic
1005784557 6:29229722-29229744 CAGCTGTGCCAGGCTCTGGCAGG - Intergenic
1008160280 6:48068407-48068429 GATCTTGGCCAGGCTGTGGCTGG + Exonic
1008209281 6:48701667-48701689 GATCTTGGCCAGGTTGTGGCTGG + Intergenic
1010378467 6:75202029-75202051 CAGCTCAGACAGGTTGAGCCTGG - Intronic
1016558941 6:145372707-145372729 CAGCTTGGCCATGTTGTGGGAGG - Intergenic
1021615566 7:22499894-22499916 CAGCCCAGCTGGGTTGTGGCCGG - Intronic
1024628423 7:51228157-51228179 CAGCGTGGCCACGTCGTGGCTGG - Intronic
1028376933 7:90154741-90154763 CAGCCCAGCTGGGTTGTGGCCGG + Intronic
1032919175 7:136526855-136526877 CATCTCTGCAAGGCTGTGGCTGG + Intergenic
1034429512 7:151034149-151034171 GCGCTTGTCCAGGTTGTGGCTGG - Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1035319525 7:158019824-158019846 CAGCTCGGCCTTGGTGTGGCTGG + Intronic
1035672762 8:1432859-1432881 CAGCTCGGCCAGTCTGTGTCAGG - Intergenic
1036968753 8:13330323-13330345 CACCTCTGCCAGGTTGTGCTGGG - Intronic
1044229534 8:89758101-89758123 CAGGTCGGCGAGTTTGTGGTAGG - Exonic
1044475433 8:92619547-92619569 CAGCTCCTCCAGGATGTTGCAGG - Intergenic
1049602813 8:143515764-143515786 CAGCTGGGCCAGGCAGGGGCTGG + Intronic
1049797061 8:144501671-144501693 CAGGTCAGCCAGGGTGTGGTGGG - Exonic
1050668160 9:7965264-7965286 CAGTTCTGCCAGGATCTGGCTGG + Intergenic
1050750596 9:8932607-8932629 CAGCTTTGCCAAGTTGTGGTGGG + Intronic
1052413127 9:28147623-28147645 CACCTCGCCCAGGTGCTGGCTGG - Intronic
1052830597 9:33212179-33212201 CAGTTAGGCCAGGTTGGGGAAGG + Intergenic
1053072708 9:35110642-35110664 CAGCTGTGCCAGGCTGTGGCTGG + Exonic
1053806507 9:41807441-41807463 CAGCTGGGCGTGGTGGTGGCGGG - Intergenic
1057076394 9:92140421-92140443 CAGCTCGGCCACCCTGAGGCTGG - Intergenic
1057851384 9:98569253-98569275 CACATGGGCCAGGTTGTGGCGGG + Intronic
1059576225 9:115491714-115491736 CAGCTCTTCCAGGTTTTGCCAGG + Intergenic
1060269188 9:122128909-122128931 CAGCTCTGCCACTTTCTGGCTGG + Intergenic
1060403847 9:123363135-123363157 GCGATCGGCCAGGTTGCGGCAGG - Exonic
1061135873 9:128733237-128733259 CATCTCGACCACATTGTGGCTGG - Intronic
1061674579 9:132208510-132208532 CAGCCTGGCCGGGTTCTGGCAGG + Intronic
1203749184 Un_GL000218v1:62854-62876 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1203543438 Un_KI270743v1:110608-110630 CACCTCTGCAAGGTTGTGCCAGG + Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1198272023 X:135064128-135064150 CAGCTAGACCAAGTGGTGGCTGG + Intergenic
1199608912 X:149597551-149597573 CAGCACTCCCAGGTCGTGGCTGG - Exonic
1199630207 X:149771806-149771828 CAGCACTCCCAGGTCGTGGCTGG + Intergenic
1201162543 Y:11177867-11177889 CACCTCTGCAAGGTTGTGCCAGG - Intergenic