ID: 1166395690

View in Genome Browser
Species Human (GRCh38)
Location 19:42438906-42438928
Sequence CATGGACTCATGAGTATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12466
Summary {0: 1, 1: 0, 2: 2, 3: 140, 4: 12323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166395690_1166395694 27 Left 1166395690 19:42438906-42438928 CCATAAATACTCATGAGTCCATG 0: 1
1: 0
2: 2
3: 140
4: 12323
Right 1166395694 19:42438956-42438978 AAATAAATAAGGAAGAGGCTAGG 0: 1
1: 1
2: 10
3: 181
4: 1583
1166395690_1166395693 22 Left 1166395690 19:42438906-42438928 CCATAAATACTCATGAGTCCATG 0: 1
1: 0
2: 2
3: 140
4: 12323
Right 1166395693 19:42438951-42438973 CAAATAAATAAATAAGGAAGAGG 0: 1
1: 4
2: 40
3: 485
4: 3285
1166395690_1166395692 16 Left 1166395690 19:42438906-42438928 CCATAAATACTCATGAGTCCATG 0: 1
1: 0
2: 2
3: 140
4: 12323
Right 1166395692 19:42438945-42438967 ACTGAACAAATAAATAAATAAGG 0: 1
1: 3
2: 52
3: 759
4: 2267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166395690 Original CRISPR CATGGACTCATGAGTATTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr