ID: 1166396659

View in Genome Browser
Species Human (GRCh38)
Location 19:42446177-42446199
Sequence ACCCACTGCTCACTTTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166396659_1166396672 25 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396672 19:42446225-42446247 GGAAACGGCCGAGGGAAGATGGG No data
1166396659_1166396666 10 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396666 19:42446210-42446232 AGGTGACCCTACGTGGGAAACGG No data
1166396659_1166396671 24 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396671 19:42446224-42446246 GGGAAACGGCCGAGGGAAGATGG No data
1166396659_1166396670 17 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396670 19:42446217-42446239 CCTACGTGGGAAACGGCCGAGGG No data
1166396659_1166396664 3 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396664 19:42446203-42446225 GGGCTTCAGGTGACCCTACGTGG No data
1166396659_1166396665 4 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396665 19:42446204-42446226 GGCTTCAGGTGACCCTACGTGGG No data
1166396659_1166396663 -10 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396663 19:42446190-42446212 AGCAGTGGGTGTGGGGCTTCAGG No data
1166396659_1166396673 26 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396673 19:42446226-42446248 GAAACGGCCGAGGGAAGATGGGG No data
1166396659_1166396674 30 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396674 19:42446230-42446252 CGGCCGAGGGAAGATGGGGTAGG No data
1166396659_1166396668 16 Left 1166396659 19:42446177-42446199 CCGTGGGAAAGTGAGCAGTGGGT No data
Right 1166396668 19:42446216-42446238 CCCTACGTGGGAAACGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166396659 Original CRISPR ACCCACTGCTCACTTTCCCA CGG (reversed) Intergenic
No off target data available for this crispr