ID: 1166403092

View in Genome Browser
Species Human (GRCh38)
Location 19:42498519-42498541
Sequence GCTTATTCTGCAATTAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166403092_1166403094 13 Left 1166403092 19:42498519-42498541 CCTTCACTAATTGCAGAATAAGC No data
Right 1166403094 19:42498555-42498577 TTCAGAGAGTATCTTATCTGTGG No data
1166403092_1166403098 21 Left 1166403092 19:42498519-42498541 CCTTCACTAATTGCAGAATAAGC No data
Right 1166403098 19:42498563-42498585 GTATCTTATCTGTGGGGAGAGGG No data
1166403092_1166403099 26 Left 1166403092 19:42498519-42498541 CCTTCACTAATTGCAGAATAAGC No data
Right 1166403099 19:42498568-42498590 TTATCTGTGGGGAGAGGGAGAGG No data
1166403092_1166403096 15 Left 1166403092 19:42498519-42498541 CCTTCACTAATTGCAGAATAAGC No data
Right 1166403096 19:42498557-42498579 CAGAGAGTATCTTATCTGTGGGG No data
1166403092_1166403095 14 Left 1166403092 19:42498519-42498541 CCTTCACTAATTGCAGAATAAGC No data
Right 1166403095 19:42498556-42498578 TCAGAGAGTATCTTATCTGTGGG No data
1166403092_1166403097 20 Left 1166403092 19:42498519-42498541 CCTTCACTAATTGCAGAATAAGC No data
Right 1166403097 19:42498562-42498584 AGTATCTTATCTGTGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166403092 Original CRISPR GCTTATTCTGCAATTAGTGA AGG (reversed) Intergenic
No off target data available for this crispr