ID: 1166403415

View in Genome Browser
Species Human (GRCh38)
Location 19:42501379-42501401
Sequence GGCTCAGCCTCCTGAATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166403415_1166403421 -2 Left 1166403415 19:42501379-42501401 CCACCTATTCAGGAGGCTGAGCC No data
Right 1166403421 19:42501400-42501422 CCTGGGAATCGCCTGAGTCTGGG No data
1166403415_1166403419 -3 Left 1166403415 19:42501379-42501401 CCACCTATTCAGGAGGCTGAGCC No data
Right 1166403419 19:42501399-42501421 GCCTGGGAATCGCCTGAGTCTGG No data
1166403415_1166403422 1 Left 1166403415 19:42501379-42501401 CCACCTATTCAGGAGGCTGAGCC No data
Right 1166403422 19:42501403-42501425 GGGAATCGCCTGAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166403415 Original CRISPR GGCTCAGCCTCCTGAATAGG TGG (reversed) Intergenic
No off target data available for this crispr