ID: 1166406689

View in Genome Browser
Species Human (GRCh38)
Location 19:42526713-42526735
Sequence AGACCCTGACTGAGTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166406685_1166406689 -4 Left 1166406685 19:42526694-42526716 CCAGAAGGCCCTTCAGGCCAGAC No data
Right 1166406689 19:42526713-42526735 AGACCCTGACTGAGTCCTACTGG No data
1166406680_1166406689 23 Left 1166406680 19:42526667-42526689 CCAGGGCTGAGCTTGTCTGTGAG No data
Right 1166406689 19:42526713-42526735 AGACCCTGACTGAGTCCTACTGG No data
1166406679_1166406689 24 Left 1166406679 19:42526666-42526688 CCCAGGGCTGAGCTTGTCTGTGA No data
Right 1166406689 19:42526713-42526735 AGACCCTGACTGAGTCCTACTGG No data
1166406684_1166406689 -3 Left 1166406684 19:42526693-42526715 CCCAGAAGGCCCTTCAGGCCAGA No data
Right 1166406689 19:42526713-42526735 AGACCCTGACTGAGTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166406689 Original CRISPR AGACCCTGACTGAGTCCTAC TGG Intronic