ID: 1166406775

View in Genome Browser
Species Human (GRCh38)
Location 19:42527254-42527276
Sequence TGGCTACAGCTGGTACAAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 2, 1: 4, 2: 5, 3: 8, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166406775_1166406780 -10 Left 1166406775 19:42527254-42527276 CCCCTTTGTACCAGCTGTAGCCA 0: 2
1: 4
2: 5
3: 8
4: 114
Right 1166406780 19:42527267-42527289 GCTGTAGCCAAAAAGTTGCTGGG 0: 1
1: 2
2: 1
3: 7
4: 103
1166406775_1166406781 -9 Left 1166406775 19:42527254-42527276 CCCCTTTGTACCAGCTGTAGCCA 0: 2
1: 4
2: 5
3: 8
4: 114
Right 1166406781 19:42527268-42527290 CTGTAGCCAAAAAGTTGCTGGGG 0: 1
1: 2
2: 0
3: 16
4: 116
1166406775_1166406783 1 Left 1166406775 19:42527254-42527276 CCCCTTTGTACCAGCTGTAGCCA 0: 2
1: 4
2: 5
3: 8
4: 114
Right 1166406783 19:42527278-42527300 AAAGTTGCTGGGGCAGATTGTGG 0: 1
1: 2
2: 0
3: 31
4: 280
1166406775_1166406784 7 Left 1166406775 19:42527254-42527276 CCCCTTTGTACCAGCTGTAGCCA 0: 2
1: 4
2: 5
3: 8
4: 114
Right 1166406784 19:42527284-42527306 GCTGGGGCAGATTGTGGACAAGG 0: 1
1: 0
2: 2
3: 25
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166406775 Original CRISPR TGGCTACAGCTGGTACAAAG GGG (reversed) Exonic
902797441 1:18808672-18808694 TGCCCACAGCTGGTAGAAACAGG + Intergenic
907028996 1:51152359-51152381 TGGCTAAAGCTGGCCTAAAGAGG - Intergenic
907462690 1:54614666-54614688 TGGACACAGCTGGGACAGAGAGG + Intronic
907463286 1:54618713-54618735 TGGGTAAAGCTGGCACAAGGAGG - Intronic
907498627 1:54861976-54861998 TGGCTACAGTTGCTACTAATGGG - Intronic
911793450 1:102047322-102047344 TGGCCACAATTGGTGCAAAGAGG + Intergenic
914193436 1:145431009-145431031 TGGCTACAGCGGGTAGGGAGAGG + Intergenic
914474765 1:148013899-148013921 TGGCTACAGCGGGTAGGGAGAGG + Intergenic
915936350 1:160092327-160092349 CGACTACAGCTGGTACCAGGCGG - Exonic
917662456 1:177190597-177190619 TGCCTATAGCTGCTCCAAAGAGG - Intronic
919934261 1:202241333-202241355 TGGTTCTAGCTGGTAGAAAGTGG - Intronic
922724689 1:227917418-227917440 TGGCCACAGCTCCTACTAAGAGG - Intergenic
923107208 1:230863852-230863874 TGGATACAGCAGGCACAAGGTGG + Intronic
1064743745 10:18459200-18459222 TGGCTATAGCTGTGACAATGAGG - Intronic
1067910584 10:50342831-50342853 TGGATACACCTGGAACTAAGTGG + Intronic
1073757835 10:106599725-106599747 TGGCTTCACCTGGTTGAAAGTGG - Intronic
1074686806 10:115969475-115969497 TTGCTAAAGCTGGAACAAGGGGG - Intergenic
1076191443 10:128486194-128486216 TGGCACCAGCTGGGACAATGTGG - Intergenic
1078710934 11:13790266-13790288 TGGCAACAGCTGGAAGAGAGTGG - Intergenic
1079990413 11:27240614-27240636 TGGCTACTGCTGTCACAAAGGGG - Intergenic
1081813934 11:45928324-45928346 GGGCTTCGGCTGGAACAAAGTGG + Exonic
1084273200 11:68039680-68039702 TGGCTAGAGCGGGGACCAAGGGG + Intronic
1085279880 11:75323140-75323162 TGGCTGCAGGTGGCACAAGGTGG - Intronic
1091942682 12:4502735-4502757 TGGATACAGCTGATGCACAGCGG - Intronic
1092154325 12:6272631-6272653 TGACTCCAGCTGGAACATAGGGG + Intergenic
1094099476 12:26745747-26745769 TGGCTCCACCTAATACAAAGAGG + Intronic
1094668172 12:32542647-32542669 TGGCTACAGCTCTTAGAAAAAGG + Intronic
1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG + Intergenic
1100141095 12:91619807-91619829 TGGCTACAGATTTCACAAAGAGG - Intergenic
1100325562 12:93536572-93536594 TGGCTGAAGCTGTCACAAAGTGG + Intergenic
1105558359 13:21466695-21466717 TAGCTACGGCTGGTGGAAAGAGG - Intergenic
1105909792 13:24852502-24852524 TGGCCATATATGGTACAAAGTGG - Intronic
1107458932 13:40581963-40581985 TGGCTACCTCTGGGACAAGGAGG + Intronic
1108640748 13:52380421-52380443 TGGCTTCAGTTGGGACAAGGAGG - Intronic
1110900045 13:80810775-80810797 TGGCTACCAGAGGTACAAAGAGG - Intergenic
1111819389 13:93194558-93194580 TGAATACAGCTGTTACAAATGGG - Intergenic
1112332700 13:98488919-98488941 TGGTTACAGCTGGTGAAATGTGG - Intronic
1112588099 13:100737593-100737615 TGTCTACAGAAGGAACAAAGTGG - Intergenic
1115080684 14:29446681-29446703 TGGCCATAGCGGGTACAAAGGGG - Intergenic
1115705286 14:35991808-35991830 TACATACAGCAGGTACAAAGTGG - Intergenic
1116625972 14:47263966-47263988 TGGCTAAACCTGTTACAAAATGG - Intronic
1119852046 14:77873152-77873174 TGGCAGCAGCAGGTAGAAAGCGG - Intronic
1121110698 14:91310935-91310957 TGGCTTCAGCTGATACAGGGTGG - Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127386681 15:58472910-58472932 TGACTACGGCTGTTACTAAGAGG + Intronic
1129769196 15:78192879-78192901 TGGGTTCAGCTGGGACAGAGAGG + Intronic
1130064714 15:80594169-80594191 TGGCTCCAGCTGGCAGAACGAGG - Exonic
1130632530 15:85583104-85583126 TGTCTACAGCTGGTAACAGGTGG - Intronic
1131538110 15:93254171-93254193 TGGCTACAGCTGGAACAGACCGG + Intergenic
1134346396 16:13395858-13395880 TCACTACAGCTGTTTCAAAGAGG + Intergenic
1138616134 16:58168871-58168893 ACACTACAGCTGGTAGAAAGGGG + Intronic
1139940967 16:70605055-70605077 TGGAAACAGCAGGTGCAAAGGGG + Intronic
1141520537 16:84575899-84575921 TGAGAACACCTGGTACAAAGCGG + Intronic
1141684446 16:85562303-85562325 GGGCTGCAGCTGGGACAAAAGGG - Intergenic
1142248736 16:88981425-88981447 TGGGGAAACCTGGTACAAAGTGG + Intergenic
1142627584 17:1202334-1202356 TGGCTGCATCTGTTATAAAGAGG - Intronic
1143125541 17:4639269-4639291 TGGCTGCAGCTGGCACAAAGTGG - Intronic
1143402930 17:6657543-6657565 TGGCTGCAGCTGGCACAAAGTGG + Intergenic
1144911286 17:18683925-18683947 TGGCTACAGTTGGTCCTAGGAGG + Intergenic
1150550709 17:66207247-66207269 TGGGTAGATCAGGTACAAAGAGG + Intergenic
1157213818 18:45765323-45765345 TGGCGACAGCTGGGTCAAAAAGG - Intergenic
1158958214 18:62562725-62562747 TGCTTACAGCTGGGACAGAGAGG - Intronic
1159166233 18:64704592-64704614 TTGCCACAGCTGGGAGAAAGGGG - Intergenic
1163272341 19:16261853-16261875 TGGGTGCAGCTGGGAGAAAGTGG - Intergenic
1163311065 19:16514839-16514861 TGGCAAAAGCTGGTACAGGGTGG + Intronic
1166255468 19:41601322-41601344 TGGCTACAACTGGTACAAAGGGG + Intronic
1166266363 19:41687075-41687097 TGGCTACAACTGGTACAAAGGGG - Exonic
1166281579 19:41797713-41797735 TGGCTACAGCTGGTACAAAGGGG + Exonic
1166406775 19:42527254-42527276 TGGCTACAGCTGGTACAAAGGGG - Exonic
1166411825 19:42560647-42560669 TGGCTATAACTGGTACAAAGGGG - Intronic
1166415720 19:42593754-42593776 TGGCTACAACTGGTACAAAGGGG - Exonic
1166420383 19:42631951-42631973 TGGCCACAACTGGTACAAAGGGG - Intronic
1166423397 19:42655265-42655287 TGGCTACAACTGGTACAAAGGGG + Intronic
1166491968 19:43268003-43268025 TGGCTACTTCTGGTACAAAGGGG - Exonic
1166788728 19:45385152-45385174 AGGCTACAGCTGCCAGAAAGGGG - Intronic
1167620502 19:50557433-50557455 AGGCTGCAGCTGGCCCAAAGTGG - Intronic
927574496 2:24190134-24190156 TGGCTGTAGTTGGGACAAAGGGG - Intronic
928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG + Intergenic
929825037 2:45303432-45303454 GGGATACAGCTGTGACAAAGTGG - Intergenic
931564326 2:63598870-63598892 TGTCTACAGCTTGTCAAAAGAGG + Intronic
940203346 2:151175547-151175569 TGGCTGCAGCTGGTCCCAAAAGG + Intergenic
942431577 2:175917078-175917100 TGGCTTCAGATGATACCAAGTGG + Intergenic
1172603063 20:36196812-36196834 TGGCTACTTCTGGGGCAAAGTGG - Intronic
1174481420 20:50833894-50833916 TGGCCAGAGCTGGAACAGAGGGG + Intronic
1175997950 20:62819758-62819780 TGGCTACAGCAGGCAGACAGTGG + Intronic
1180121140 21:45748978-45749000 TTGCTTCAGCTTTTACAAAGAGG + Intronic
1182648439 22:31829596-31829618 TGCCTGCAGATGGTGCAAAGAGG - Intronic
1183079879 22:35449555-35449577 AGGCCACAGCTGGGACAAAGAGG - Intergenic
949840045 3:8310665-8310687 TGGCTACTGCTGGTATAGACAGG + Intergenic
952101632 3:30019840-30019862 TGGGTCCAGCTGATTCAAAGTGG - Intergenic
962986258 3:140538722-140538744 TGTCTACAGCTGGAAGAAAGAGG + Intronic
963514391 3:146290480-146290502 AGTCTACCACTGGTACAAAGAGG - Intergenic
963784423 3:149519272-149519294 TTGCTACAGTTGGTATAAAAAGG - Exonic
969468497 4:7371869-7371891 TGGCCACAGCTGAGATAAAGAGG + Intronic
970969561 4:21965832-21965854 TGGCTGCAGCTGGAACTAACTGG - Intergenic
972211843 4:36848129-36848151 AGGCTACTGCTGGTACATGGAGG - Intergenic
974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG + Intergenic
974969575 4:68807485-68807507 TAGCCACAGCTGAGACAAAGGGG - Intergenic
976698808 4:87947010-87947032 TGGCTAGAGCTGGTATAATGAGG + Intergenic
986411489 5:7485133-7485155 TGTGTACAGCAGGTATAAAGAGG - Intronic
988183517 5:27829928-27829950 TGGCTACACTTGATTCAAAGTGG + Intergenic
988372679 5:30391944-30391966 TGGCTTCAGATGCTAGAAAGAGG - Intergenic
989460758 5:41696190-41696212 TGGCTGCAGCTGATAAAAAATGG + Intergenic
990544663 5:56810877-56810899 TGGCCAAAGCTGCTATAAAGAGG - Intergenic
992076332 5:73195991-73196013 TGGCTGTAGCCGGTACAAGGTGG - Intergenic
995059386 5:107796987-107797009 TGGCTATATCTGGTATAAAGTGG + Intergenic
1001695890 5:173669500-173669522 TGGCCTCAGCTGGCACATAGTGG + Intergenic
1004285848 6:14319981-14320003 TGGTTCCAGCTGGTTCACAGTGG - Intergenic
1011612712 6:89168909-89168931 TGGCTCCGGCTGGTGCAAAATGG + Intergenic
1015606144 6:134956262-134956284 TCCCTACAGCAGGAACAAAGTGG + Intergenic
1018344903 6:162890627-162890649 TGGCAGGAGGTGGTACAAAGAGG - Intronic
1019797739 7:3064262-3064284 TGGTTACAGCTGGTGCAAGTGGG - Intergenic
1021022447 7:15620149-15620171 TGACTACAACTGGTAAAATGGGG - Intronic
1021306329 7:19036817-19036839 TTTCTACTGCAGGTACAAAGAGG - Intronic
1021313418 7:19118050-19118072 TGGCAACAGCTTCTACACAGTGG + Intergenic
1026377889 7:69770499-69770521 TGGCTCCAGCTGGAGCCAAGAGG - Intronic
1032172312 7:129595209-129595231 TGGCCAAAGCTGGAACAATGTGG - Intergenic
1032255852 7:130296581-130296603 TGGCTACAGCAATCACAAAGAGG - Intronic
1033654549 7:143363627-143363649 TGGTTACAGCAGGTAAGAAGTGG + Intergenic
1035785385 8:2255735-2255757 TGGCTCCAGCAGGCACAATGTGG - Intergenic
1035807423 8:2465981-2466003 TGGCTCCAGCAGGCACAATGTGG + Intergenic
1036541371 8:9715450-9715472 AGGCTACAGGTGGTACCAGGTGG - Intronic
1043264908 8:78253685-78253707 TGGCAACAGCTAGTGCTAAGAGG + Intergenic
1046245821 8:111561175-111561197 TGTCTACTGCTGTTACTAAGTGG + Intergenic
1049207775 8:141371404-141371426 TGGCCACAGCTGGCACAAGGTGG + Intergenic
1050379247 9:5009346-5009368 TGGCTACATCTGATACAGAATGG + Intronic
1052577588 9:30309701-30309723 TGGCTACAGCCTGAACATAGTGG - Intergenic
1053476647 9:38386772-38386794 TGGCAGCTGCTGGCACAAAGGGG - Intergenic
1056724856 9:89106007-89106029 TGGCTGCACCTGGCACATAGTGG - Intronic
1058153501 9:101486837-101486859 TGGCCACAGCTGGCACAAGCAGG - Intronic
1190583045 X:51907190-51907212 TGTCTCAAGCTGGTACAAACTGG - Intergenic
1196456209 X:115893216-115893238 GGGCTAGAGCTGGCCCAAAGTGG - Intergenic
1198772216 X:140142866-140142888 TGGCTACAGAAGGTACAATAAGG + Intergenic