ID: 1166407140

View in Genome Browser
Species Human (GRCh38)
Location 19:42529214-42529236
Sequence CCTTCCCCACAGGTGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166407131_1166407140 27 Left 1166407131 19:42529164-42529186 CCTGGGTGGTCTCTGTCCTCTGC 0: 2
1: 0
2: 4
3: 44
4: 846
Right 1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 238
1166407135_1166407140 -8 Left 1166407135 19:42529199-42529221 CCTGTGGTCACCGCACCTTCCCC 0: 1
1: 9
2: 7
3: 27
4: 193
Right 1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 238
1166407133_1166407140 11 Left 1166407133 19:42529180-42529202 CCTCTGCGAGGCTGATTGTCCTG No data
Right 1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166407140 Original CRISPR CCTTCCCCACAGGTGGTGCC AGG Intronic
900129380 1:1081023-1081045 CCTTCCCCACAGGAGGAGTCTGG + Intergenic
900420772 1:2555084-2555106 CCCACCCCACAGCTGGAGCCTGG - Intergenic
900438731 1:2643126-2643148 CCTTCCCCACTGGGGCGGCCTGG - Intronic
900496504 1:2978384-2978406 CCCTCCCCTCTGGTGGGGCCTGG - Intergenic
900514810 1:3076603-3076625 CCTCGCCCACAGGTAGTGCCAGG + Intronic
900605593 1:3522298-3522320 CCTTCTCCAGGGCTGGTGCCCGG - Intronic
901204923 1:7489150-7489172 CCTTTGCCACAGGTGGGCCCTGG + Intronic
902151986 1:14450718-14450740 CCTTCCCCACACTTGATGTCCGG - Intergenic
902409038 1:16202196-16202218 CCTGCCCCACAGGTGGTGTCAGG - Intronic
902483053 1:16722045-16722067 CCTCCCCCACAGCTGTTGCTGGG + Intergenic
903339233 1:22643774-22643796 CCTTCCTGAAATGTGGTGCCAGG + Intronic
904326291 1:29728807-29728829 CCCTCCCCACAGCTGGTGAAAGG + Intergenic
904409375 1:30315840-30315862 CCTTCCCTACAGGAGATTCCAGG + Intergenic
904413072 1:30336710-30336732 CCCTCCCCACTGCTGCTGCCGGG - Intergenic
906917053 1:50023451-50023473 CCTTCACCACAGGTGATCCCAGG + Intronic
907255628 1:53176575-53176597 CCTGCCCCAAAGGTGGTTGCAGG - Intergenic
908156490 1:61358792-61358814 CTATCTCCACAGGTGGTGGCTGG - Intronic
910515114 1:88052459-88052481 CCTTTCCCAGAGGAGTTGCCTGG - Intergenic
912386007 1:109271516-109271538 CCTTCTCCACAGGCTGGGCCAGG - Intronic
913304436 1:117411341-117411363 CCTTTCCAACAAGTGGTGCTGGG + Intronic
915489975 1:156245504-156245526 CCGTCCCCACTGGAGGGGCCTGG + Intronic
916713907 1:167434471-167434493 CCCTCCCCACAGGAGGGGCGGGG + Intronic
917538835 1:175894275-175894297 CCTTTCCCACAGGGGTGGCCAGG - Intergenic
918459040 1:184756594-184756616 CCTTCCACAAAAGTGGTCCCTGG - Intergenic
920314440 1:205067296-205067318 CATTCCCTATAAGTGGTGCCAGG - Intronic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
923034124 1:230272289-230272311 CCTTCCCCAGAGAAGGTGGCCGG + Intronic
923709839 1:236378426-236378448 CCTACCCCAGAGCTGGTTCCTGG + Intronic
923917852 1:238529527-238529549 CCTTGCACAGAGCTGGTGCCTGG - Intergenic
924144600 1:241060973-241060995 CCTGCCCCTCAGGCTGTGCCAGG + Intronic
924246821 1:242093399-242093421 TCATCCCCACAGCTGTTGCCAGG + Intronic
1064312059 10:14220458-14220480 CATGCCCCAAAGGGGGTGCCAGG + Intronic
1065890657 10:30118535-30118557 CCTTCCCCACAGTAGAAGCCAGG + Intergenic
1066435487 10:35393504-35393526 CCTTGCTCACAGGTTGTTCCTGG + Intronic
1067083784 10:43227727-43227749 CCCACCCCAGAGGTGTTGCCTGG - Intronic
1069241331 10:66143736-66143758 CCTTAACCGCAGGTGGTCCCAGG + Intronic
1070396079 10:76012109-76012131 CCTTGCCCAAAGCTGGTTCCTGG + Intronic
1070721611 10:78760949-78760971 CCTGGCTCCCAGGTGGTGCCTGG + Intergenic
1070961895 10:80505282-80505304 CCTTCCCGACAGTAGGAGCCAGG - Intronic
1071108569 10:82127653-82127675 CCTTCTTCCCAGTTGGTGCCAGG + Intronic
1072278165 10:93842720-93842742 ACTTGCCCCCAGGAGGTGCCTGG - Intergenic
1073459372 10:103657817-103657839 CCTTCCCCACAGATGTTCCAGGG + Intronic
1075467488 10:122662445-122662467 GCTGCTTCACAGGTGGTGCCAGG - Intergenic
1075713167 10:124541599-124541621 CTGTCCCCACGGGTGGTCCCAGG - Intronic
1075973272 10:126673037-126673059 CCTTGACCACAGCTGGTGGCTGG + Intergenic
1077364071 11:2154521-2154543 CCTTCCCCACAGCTGGGCCTAGG + Intronic
1078809378 11:14743170-14743192 CCCTTCCCCCAGGTGGTCCCAGG + Intronic
1079083460 11:17429459-17429481 CCTCCCCCACAGGCGGTGACTGG + Intronic
1081772465 11:45658578-45658600 CTTTCCCCTCAGGTCGGGCCTGG - Intronic
1083855184 11:65389764-65389786 CCTGCCCCCCAGGTCGTGCTGGG + Intronic
1085205644 11:74730684-74730706 CCTCCGGCACAGGTGCTGCCTGG + Intronic
1088897360 11:114088704-114088726 CCTTCCCCACCAGTACTGCCTGG - Intronic
1091805836 12:3355233-3355255 CCTTCCCCATCCCTGGTGCCAGG + Intergenic
1091875579 12:3930629-3930651 CCTTTCCCCCAGGAGGAGCCTGG - Intergenic
1092102861 12:5900691-5900713 CCTTCCCCATGGGTGGGGCCGGG + Intronic
1092524971 12:9304250-9304272 CTCTACCCACAGGTGGTGACAGG - Intergenic
1092542297 12:9427568-9427590 CTCTACCCACAGGTGGTGACAGG + Intergenic
1094494575 12:30981354-30981376 CCTTCACCACTGATGGCGCCGGG + Intronic
1094510717 12:31094865-31094887 CTTTACCCACAGGTGGTGACAGG - Intronic
1095784123 12:46091354-46091376 CCTATGCCACATGTGGTGCCAGG - Intergenic
1095925083 12:47570304-47570326 CCTTTTCCACAGGGAGTGCCTGG - Intergenic
1095953307 12:47793358-47793380 CCTTCACCACAGGTGAGACCGGG - Exonic
1096214873 12:49793257-49793279 CCGTCCCCGCAGCAGGTGCCAGG - Intronic
1096517342 12:52164259-52164281 CCTTCCCCACAAGAGAGGCCAGG - Intergenic
1097048312 12:56204624-56204646 CCTTACCCTCAGATGGAGCCAGG - Exonic
1100448646 12:94684395-94684417 CTTTCTCCACAGGTGGCCCCTGG - Intergenic
1101673477 12:106897587-106897609 CCTTTCCCAGAGGTGGAGCCTGG + Intergenic
1101913643 12:108879731-108879753 CTTTCCCCTCAGGGGCTGCCAGG + Intronic
1102158878 12:110752560-110752582 CCTTCCCCAGAGGTAGCACCAGG + Intergenic
1102162437 12:110780653-110780675 CCATCCACACAGGAGGTGCAAGG - Intergenic
1104986669 12:132601296-132601318 CCTTCCCCACAGGTAGCTCCCGG - Intergenic
1106077099 13:26469882-26469904 CCTTGCTCACATTTGGTGCCTGG + Intergenic
1107173799 13:37376952-37376974 CCTTCCCCACTTGTGCTTCCTGG + Intergenic
1107557286 13:41527996-41528018 CCTTCCTCAAATGTGGTGCTGGG - Intergenic
1108350268 13:49585357-49585379 CCTTCCCCGCAGGCCGGGCCGGG - Intronic
1115758746 14:36556744-36556766 CCTTCCACAAAGGCGATGCCTGG + Intergenic
1121561100 14:94876177-94876199 ACTTCCCCACTGGTGTTCCCTGG + Intergenic
1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG + Intergenic
1122430411 14:101636555-101636577 CCCTCCCCACAAGGGGTGCCCGG - Intergenic
1122999956 14:105288034-105288056 CCTCCAACAAAGGTGGTGCCGGG + Intronic
1123027485 14:105433634-105433656 CTTTCCACACAGGTACTGCCAGG - Intronic
1123156334 14:106230267-106230289 ACTTCCTCAAAGGTGTTGCCAGG - Intergenic
1123482968 15:20652302-20652324 AGATCCCCACAGGTGGTGTCAGG + Intergenic
1125537878 15:40453032-40453054 CATTCCCCACAGCAGGAGCCCGG - Intronic
1127312810 15:57767560-57767582 CCTTCCCCACTGGAGTTGACAGG - Intronic
1127754438 15:62077329-62077351 CCTTCCCTAAAGGTGCTGCTAGG - Intergenic
1128240869 15:66100183-66100205 CCCAGCCCACAGGAGGTGCCCGG - Intronic
1128368763 15:67023999-67024021 CCGCCCCCACAGGAGGAGCCAGG - Intergenic
1128979570 15:72176339-72176361 CCTTCCCCACAGCTGGGGTGGGG + Intronic
1129204143 15:74025409-74025431 CTTTCCCCACAGATGGTTCTTGG + Intronic
1130353534 15:83110750-83110772 TCATCCCCACAGGAGGAGCCTGG + Intronic
1131156824 15:90080681-90080703 CCTCCCCGACAGGTGGTCCTGGG - Exonic
1132495753 16:262542-262564 GCTTTCCCACAGGTGGGTCCGGG + Exonic
1132543365 16:521705-521727 GCTTCTCCACAGGTGCGGCCTGG + Exonic
1136546502 16:30957904-30957926 CTTTCGCCACAGGCGCTGCCGGG - Exonic
1138511330 16:57510148-57510170 GCTATCTCACAGGTGGTGCCAGG + Intergenic
1139632211 16:68237555-68237577 CTTTCCCTACAGGTGGAGGCGGG + Intronic
1139950625 16:70666655-70666677 AAATCCTCACAGGTGGTGCCTGG - Intronic
1141218178 16:82044436-82044458 CCTCACCCACAGATGGGGCCTGG + Intronic
1141894375 16:86949292-86949314 CCTACCCCACAGGATGAGCCGGG + Intergenic
1142473385 17:175883-175905 CCTTCCCAGGAGGTGGTGACGGG - Intronic
1144748867 17:17634442-17634464 CCCTCCCTACAGTTGCTGCCTGG - Intergenic
1146263352 17:31435793-31435815 CCTGGCCCACAGTTGGTGCCTGG - Intronic
1147690811 17:42313235-42313257 CCTCACACACAGGTGGGGCCTGG - Intergenic
1148690421 17:49523966-49523988 CCCTCCCCCCACCTGGTGCCTGG + Intergenic
1148747448 17:49926643-49926665 CTTTTCCAATAGGTGGTGCCTGG - Intergenic
1148761091 17:50001014-50001036 CCTCTCTCACAGGTGCTGCCTGG - Intergenic
1148859958 17:50599640-50599662 CCATCGCCACAGGGGGTCCCTGG + Exonic
1150985421 17:70191317-70191339 CCTTCCCTTCACGTAGTGCCAGG - Intergenic
1151192297 17:72407412-72407434 TCTTTGCCACAGGTGTTGCCAGG + Intergenic
1151260598 17:72912943-72912965 CTTTCCCCAGATGTGGTGTCAGG + Intronic
1151332088 17:73415982-73416004 TCTTCCCCTCAGGTACTGCCTGG - Exonic
1151450306 17:74194702-74194724 CCCTCAGCACAGGTGGGGCCTGG - Intergenic
1151908638 17:77066536-77066558 TCTTCCCCACAGGGGCTACCTGG - Intergenic
1152258487 17:79254034-79254056 CCTTCTCCCCAGCTGGTGGCAGG + Intronic
1152284172 17:79402926-79402948 CCTGACCCACAGGACGTGCCCGG + Intronic
1152840577 17:82565082-82565104 ACTTCCCAACAAGTGGTACCAGG + Intronic
1152926311 17:83089313-83089335 TCTCCCACACAGGTGGTGACGGG - Intronic
1153062948 18:1012967-1012989 CCTCCCACACAGGTTCTGCCTGG + Intergenic
1153555597 18:6310098-6310120 ACTTCTCCACATGTGGTCCCTGG - Intronic
1155174459 18:23290333-23290355 CCTTCCCCGCAGCTGGTTCTGGG - Intronic
1157275020 18:46304232-46304254 CCCTCCCCACAGCTGGAGCAAGG - Intergenic
1158189337 18:54808265-54808287 CAGTCCCCACAGGTTGGGCCAGG + Intronic
1161061980 19:2219833-2219855 CCCTCCCCACAGCTGGACCCCGG + Intronic
1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG + Intronic
1166266726 19:41688940-41688962 CCTTCCCCATGGGTGGTGCCAGG + Intronic
1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG + Intronic
1166499968 19:43333082-43333104 CCTTCCCCATGGGTGATGCCAGG + Intergenic
1166772223 19:45290783-45290805 CAGTCCTCACAGGTGGTGGCAGG - Intronic
1166961135 19:46496350-46496372 TCTTGCTCACAGGTGGTGCCTGG - Exonic
1167156808 19:47743583-47743605 CCTTGCCCACACGGGCTGCCAGG + Intergenic
1168173644 19:54607750-54607772 CCTGCCCCACAGGTAGGCCCTGG + Intronic
1168669387 19:58229324-58229346 CCCTCCCGACAGAGGGTGCCTGG + Intronic
925977651 2:9152239-9152261 CCTTCCTCACAGGCGTGGCCTGG + Intergenic
929888526 2:45899827-45899849 CTTTCTCCCCAGGTGGTGTCAGG - Intronic
932801742 2:74747527-74747549 CCTTACCCACAGGGGCTGACAGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937963699 2:127484512-127484534 ACTTCCCCATAGGTGGAGCAGGG - Intronic
943606525 2:189983559-189983581 CCTTCCCCACATCTGTTCCCAGG + Intronic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
945251593 2:207769584-207769606 CCTCCCGCCCAGGTGCTGCCAGG - Intergenic
945415392 2:209564630-209564652 CCTTCCCCATAGATGGTGCTGGG + Intronic
947720825 2:232368303-232368325 CATGCCCCAAAGGTGGAGCCAGG + Intergenic
948915037 2:241030178-241030200 GCTTCCCCTCAGAGGGTGCCTGG + Intronic
948953764 2:241272243-241272265 CCTTCCCCCCAGGTGGCGGCGGG - Intronic
1169854029 20:10084146-10084168 CCTTCCCCAGCAGTGGTGTCTGG - Intergenic
1172775627 20:37405037-37405059 CCTTCCCCACTGGCAGGGCCTGG - Exonic
1172907893 20:38382857-38382879 CCTTCTCTTGAGGTGGTGCCTGG + Intergenic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1179581669 21:42348166-42348188 CCTTCTCCAGAGGACGTGCCTGG + Intronic
1179879274 21:44286720-44286742 GCTTCCCCAAAGGTGGGTCCTGG + Exonic
1180083274 21:45496488-45496510 CCCTCCCCACAGGGAATGCCCGG + Exonic
1180245573 21:46545381-46545403 CCTTCCACACAGGCGCTGCTGGG + Intronic
1182070364 22:27459221-27459243 CCTTCCCCACCAGTGCTTCCTGG + Intergenic
1182361886 22:29751531-29751553 CCTCCCCCACAGGTTGTCCTGGG - Intronic
1182532020 22:30968359-30968381 TCTTCGCCACACGTGATGCCAGG + Intergenic
1183599206 22:38830321-38830343 CCTGGCCCACAGTGGGTGCCGGG + Intronic
1183942848 22:41305865-41305887 CCAGCCCCAGAGGCGGTGCCAGG + Intronic
1184271479 22:43386999-43387021 CCTGCCTCCCAGGTGGTGGCAGG - Intergenic
1184442006 22:44522815-44522837 CCTTCCCCCCATGGGGAGCCTGG + Intergenic
1184722341 22:46322304-46322326 TCTTCTCCACAGGTGCTTCCAGG - Intronic
1184727432 22:46355113-46355135 GCTGCCCCACAGGTGGTTGCAGG + Intronic
1184766757 22:46576448-46576470 CCTGCCCCGCAGGTAGTGCCTGG + Intronic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
1185367988 22:50445734-50445756 CCCACCCCACAGGTGGTGTTGGG - Exonic
1185380396 22:50505143-50505165 CCTTGCCCACAGGTGGACCCAGG - Exonic
952517707 3:34122470-34122492 CCTTCACCAAAGATGGTACCTGG - Intergenic
954007226 3:47601498-47601520 CCTTCCCCACAGCAGCTTCCTGG + Intronic
954134213 3:48574711-48574733 TCATCCCCACAGGGGGAGCCGGG - Exonic
954409264 3:50363234-50363256 CCATGCCCACTGCTGGTGCCAGG - Intronic
954750659 3:52811640-52811662 CCTGCCCCGCAGGTGCTGGCAGG + Intergenic
956665750 3:71640637-71640659 CCTTCTCCACAGAAGGTTCCAGG - Intergenic
957862438 3:85972440-85972462 CCTCCCCCAGGGGTGGTCCCAGG - Intronic
958719159 3:97822792-97822814 CCTCCCACACAAGTGGTGCTGGG - Intronic
959345612 3:105191198-105191220 CTTTCCCCCCCAGTGGTGCCTGG - Intergenic
961443233 3:126965253-126965275 CCTTTACCACAGGGGGTGGCCGG - Intergenic
961563606 3:127747819-127747841 CCTTCCACACCTGTGGTCCCTGG + Intronic
961802594 3:129463912-129463934 TCTTCCCCACACATGCTGCCTGG - Intronic
964438242 3:156675511-156675533 CCTTCCCCTCAGCAGGCGCCTGG - Intronic
966226702 3:177605541-177605563 CATTCCTCATAGATGGTGCCTGG - Intergenic
968545466 4:1195541-1195563 GCCTACCCACATGTGGTGCCCGG - Intronic
968662191 4:1803277-1803299 CGACCCCCACAGGAGGTGCCCGG + Intronic
968689831 4:1984732-1984754 CCTTGCCCACGGGCGCTGCCAGG - Intronic
969091694 4:4698742-4698764 CCCTCCACACAGGTGGAGCTGGG + Intergenic
969288386 4:6222382-6222404 CCTTCAGCACAGGCGGCGCCGGG - Intergenic
974204439 4:58682236-58682258 CATTGGTCACAGGTGGTGCCAGG - Intergenic
978468015 4:109030158-109030180 CCCTCCAGAGAGGTGGTGCCTGG + Intronic
978515083 4:109560574-109560596 CGGTCCCGACAGGTGGTGGCCGG + Intronic
978539474 4:109801602-109801624 CCTTACACACAGGAGGAGCCTGG + Intronic
978599369 4:110411758-110411780 CCTTCCTCACAGCTTGTCCCAGG - Intronic
982221111 4:153125997-153126019 CCTTCCCCACACCTGCTGCCTGG - Intergenic
982668306 4:158292265-158292287 CCTCCCCAACAGGTGGTCCTGGG + Intergenic
983863711 4:172738221-172738243 TTTTCCTCACAGGTGGTGCCTGG + Intronic
984764438 4:183388913-183388935 CCTTCCTCTCAGGGAGTGCCTGG + Intergenic
985589558 5:757498-757520 CCATGCCCCAAGGTGGTGCCAGG - Intronic
985923177 5:2995488-2995510 ACATCCCCACAGCTGGTCCCGGG + Intergenic
985973878 5:3399581-3399603 CCTTCCCCCAAGGTTGTCCCAGG - Intergenic
988110470 5:26813024-26813046 CATTTCCCACTGGTGGTGTCAGG + Intergenic
999132599 5:149295886-149295908 CCTTCACCACAGGTTGTGCCTGG - Intronic
1000273078 5:159705314-159705336 CCTCCCCCAGAGGTGGTGGGTGG + Intergenic
1002044839 5:176536173-176536195 GCTTCCCAACGTGTGGTGCCTGG + Intronic
1004461629 6:15842073-15842095 CCCTCCCCAGAGGTGGAGCGAGG + Intergenic
1006474785 6:34246858-34246880 CCTCCCCGACAGGTGGTACATGG - Exonic
1007626711 6:43250754-43250776 CCTTCCTCACCTGTGTTGCCAGG + Intronic
1009371340 6:62906606-62906628 TGTTCCCCAAAGGTGGTCCCTGG - Intergenic
1011887592 6:92116509-92116531 CATTCCCCACAGTTGCAGCCAGG + Intergenic
1013010960 6:106119549-106119571 CCTTCCCCGCAGGTTGTCCTTGG + Intergenic
1013630664 6:111983078-111983100 CCTCCCTCACAGGTGGAGCCTGG + Intergenic
1014898098 6:126928609-126928631 GCCTACCCACTGGTGGTGCCTGG + Intergenic
1018027875 6:159819785-159819807 CCTTCCAGTCAGGAGGTGCCCGG + Intronic
1018043752 6:159948055-159948077 CTTTCATCCCAGGTGGTGCCTGG + Intergenic
1018069815 6:160154378-160154400 GCTTTCCCACAGGTGATGACAGG + Intronic
1018802712 6:167236171-167236193 CCCACCCCACAGAGGGTGCCGGG - Intergenic
1018803715 6:167242492-167242514 CCTACCCCACAGATGGCTCCTGG - Intergenic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1020430651 7:8113391-8113413 CTGTCCCCACAGCAGGTGCCTGG - Exonic
1020468048 7:8503386-8503408 CCTTCCTCACCGGTGATGCATGG + Intronic
1020641428 7:10758895-10758917 CCTTCTCCAAAGGTGGTTACTGG - Intergenic
1022341511 7:29472887-29472909 TCTGCCACACATGTGGTGCCAGG + Intronic
1023259181 7:38341359-38341381 CCTTCCAGAAGGGTGGTGCCTGG + Intergenic
1024249627 7:47496338-47496360 CCTTCCACACATGTGGCCCCAGG - Intronic
1025794823 7:64729687-64729709 CCTTCCCCAGAGTTCTTGCCAGG + Intergenic
1027348640 7:77288042-77288064 CTTTCCTCACTAGTGGTGCCTGG - Intronic
1032117668 7:129130299-129130321 CCTTCCCCAGAGGCTGTGGCTGG + Intergenic
1033422641 7:141217271-141217293 CTTTCAGCACAGGTGGGGCCTGG + Intronic
1034935035 7:155193472-155193494 CCTTCCCCTCCGCTAGTGCCGGG - Intergenic
1035582772 8:750229-750251 CAGTGCCCACGGGTGGTGCCAGG - Intergenic
1035912176 8:3579638-3579660 CCTTCACCACACCTGGTTCCAGG + Intronic
1039581710 8:38672118-38672140 TCTTCCCCCCAGCTGGAGCCAGG + Intergenic
1041588648 8:59550270-59550292 CCCTCCCCAGAGGTGGGGCTGGG - Intergenic
1041938212 8:63358008-63358030 CCTTTCCCAAAGGTGATTCCTGG + Intergenic
1042737729 8:72007597-72007619 CCTGAACCACAGGTTGTGCCTGG - Intronic
1044319976 8:90791312-90791334 CCTTCCCCAAAGGCGGGGGCAGG - Intronic
1045459189 8:102412094-102412116 CCTCCCCCACGGGCCGTGCCGGG - Intronic
1046012218 8:108563007-108563029 CCTTCCCCACAGTTAGTACAGGG - Intergenic
1049172541 8:141170704-141170726 CCTGCCCCCCAGGTGGCTCCTGG - Intronic
1049439584 8:142602983-142603005 CTTTACCCAGAGGTGGTGGCCGG + Intergenic
1049676220 8:143890465-143890487 CCCTTCCCACAGGAGGTTCCAGG - Intergenic
1050854515 9:10335344-10335366 CCTTTCCAACAAATGGTGCCTGG + Intronic
1053285631 9:36848046-36848068 CCTTCCCTACTGGAGGTGACAGG + Intronic
1053293450 9:36897177-36897199 CCTTACCCACAGCTGCTGCCTGG - Intronic
1056938697 9:90937206-90937228 CCTTCCCCACTGGTGACTCCAGG - Intergenic
1056967476 9:91177381-91177403 CCTTCCCTACAGGCTGTTCCAGG + Intergenic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1057694281 9:97312276-97312298 CCTTCCTCAGAGGAGTTGCCAGG - Intronic
1060721645 9:125983549-125983571 GCTTCCCCAAAGGAGGTTCCTGG - Intergenic
1060823500 9:126674452-126674474 GCTGCCCCACAGGTGGCCCCAGG - Intronic
1060976554 9:127768335-127768357 CCTTCCCCAGCCCTGGTGCCAGG - Intronic
1061669741 9:132182178-132182200 CCTTCCCCAGAGCTGGTGCGTGG - Intronic
1061788117 9:133042981-133043003 TCTGGCCCACAGGAGGTGCCTGG + Intronic
1061803829 9:133127408-133127430 CCTGCCCAACAGGAGGTGACAGG - Intronic
1062345540 9:136112832-136112854 TGTGCCCCACAGGGGGTGCCAGG - Intergenic
1187871988 X:23772156-23772178 CCTTCCCCTCGAGTGGTGACAGG + Intergenic
1189260378 X:39674472-39674494 TCTGCCCCACAGCTCGTGCCAGG - Intergenic
1191855416 X:65621340-65621362 CCTTTCCAACATATGGTGCCAGG - Intronic
1192496976 X:71622699-71622721 CCTTGACCACAGGTGGGGCCCGG - Intergenic
1196921415 X:120589603-120589625 CCTTCCCCATAGGTAATGACTGG - Intergenic
1197709067 X:129653500-129653522 CCTTCCCCTTGTGTGGTGCCAGG + Intronic
1197993369 X:132343338-132343360 CATTCCCCACAGTTGGTGGTGGG + Intergenic
1198146633 X:133864010-133864032 CCCTTCCCACAGATGGTGTCTGG + Intronic
1198567143 X:137916364-137916386 CCTACCCAGCAGGTGGTGGCAGG + Intergenic
1198932799 X:141879093-141879115 CCTTCCCGAGAGGCTGTGCCTGG - Intronic
1198936460 X:141905605-141905627 CCTTCCCCTCAGGAGGTCTCTGG - Exonic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic