ID: 1166407229

View in Genome Browser
Species Human (GRCh38)
Location 19:42529584-42529606
Sequence CCTGGGGACCCGCAGTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166407229_1166407239 12 Left 1166407229 19:42529584-42529606 CCTGTTCACTGCGGGTCCCCAGG No data
Right 1166407239 19:42529619-42529641 ATGCGGTGCAGGATGAGCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 126
1166407229_1166407240 13 Left 1166407229 19:42529584-42529606 CCTGTTCACTGCGGGTCCCCAGG No data
Right 1166407240 19:42529620-42529642 TGCGGTGCAGGATGAGCCCAGGG 0: 1
1: 0
2: 3
3: 8
4: 142
1166407229_1166407234 -5 Left 1166407229 19:42529584-42529606 CCTGTTCACTGCGGGTCCCCAGG No data
Right 1166407234 19:42529602-42529624 CCAGGCTGCCCAGCTCCATGCGG 0: 1
1: 1
2: 3
3: 36
4: 368
1166407229_1166407235 1 Left 1166407229 19:42529584-42529606 CCTGTTCACTGCGGGTCCCCAGG No data
Right 1166407235 19:42529608-42529630 TGCCCAGCTCCATGCGGTGCAGG 0: 1
1: 0
2: 4
3: 17
4: 162
1166407229_1166407241 18 Left 1166407229 19:42529584-42529606 CCTGTTCACTGCGGGTCCCCAGG No data
Right 1166407241 19:42529625-42529647 TGCAGGATGAGCCCAGGGAGAGG 0: 1
1: 2
2: 3
3: 61
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166407229 Original CRISPR CCTGGGGACCCGCAGTGAAC AGG (reversed) Intronic
No off target data available for this crispr