ID: 1166407984

View in Genome Browser
Species Human (GRCh38)
Location 19:42536322-42536344
Sequence AATCTGAACTATAGAACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1901
Summary {0: 1, 1: 42, 2: 276, 3: 578, 4: 1004}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166407984_1166407985 11 Left 1166407984 19:42536322-42536344 CCATTTGTTCTATAGTTCAGATT 0: 1
1: 42
2: 276
3: 578
4: 1004
Right 1166407985 19:42536356-42536378 TTCTTTGTTGATTTTCTGTCTGG 0: 322
1: 596
2: 602
3: 679
4: 1807
1166407984_1166407986 12 Left 1166407984 19:42536322-42536344 CCATTTGTTCTATAGTTCAGATT 0: 1
1: 42
2: 276
3: 578
4: 1004
Right 1166407986 19:42536357-42536379 TCTTTGTTGATTTTCTGTCTGGG 0: 42
1: 143
2: 156
3: 203
4: 732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166407984 Original CRISPR AATCTGAACTATAGAACAAA TGG (reversed) Intronic
901189385 1:7397996-7398018 AAACTAAACTCTAGATCAAATGG - Intronic
902120012 1:14156350-14156372 AACCTCCACTATAGACCAAATGG - Intergenic
905707395 1:40071398-40071420 AATCTGAGCTAAAGAACAGCTGG - Intronic
906020579 1:42625865-42625887 AATCTGCATTATAGACCAAATGG - Intronic
906892779 1:49736471-49736493 AACCTGCCCTATATAACAAATGG + Intronic
906902887 1:49855379-49855401 TATCTGCACGATAGACCAAATGG + Intronic
906928543 1:50145472-50145494 ACTGGAAACTATAGAACAAAGGG - Intronic
907139268 1:52170967-52170989 AATCTGCACTATAGAACACATGG - Intronic
907493167 1:54823086-54823108 AATCTACACTATAGACCAAATGG - Intronic
907605156 1:55808857-55808879 AATCTGCATTATAGACCAAATGG + Intergenic
907695997 1:56729639-56729661 AAACTGCACCATAGACCAAATGG + Intronic
907887171 1:58603765-58603787 AAACTGTACTCTAGAATAAATGG - Intergenic
908070860 1:60458246-60458268 AAACTGCACTTTAGACCAAAGGG + Intergenic
908093370 1:60710106-60710128 AATCTGTGCTATAGACCCAATGG + Intergenic
908538204 1:65098196-65098218 AAACTGGACTTTAGACCAAATGG - Intergenic
908712793 1:67036194-67036216 AATCTGCACTGTAGACCAAATGG - Intronic
908800286 1:67872848-67872870 AATCTGAAGGAGAGAAAAAAAGG + Intergenic
908809996 1:67971407-67971429 AATTTGCACTATAGACCAAATGG - Intergenic
908908267 1:69041256-69041278 AATCTGTAGTGTAGACCAAATGG + Intergenic
909277512 1:73707221-73707243 AATCTGCAATATAGACCAAATGG - Intergenic
909385062 1:75045368-75045390 AATCTGCCCTGTAGACCAAATGG + Intergenic
909420991 1:75465014-75465036 CATCTGCACTATAGACCAAATGG + Intronic
909521216 1:76570084-76570106 ACTCTGAACTATGGAAATAATGG + Intronic
909720623 1:78765241-78765263 CATGTGTACTATAGAACAAATGG - Intergenic
909823406 1:80095123-80095145 AATCTGCTCTATACATCAAATGG - Intergenic
909861742 1:80614734-80614756 AAACTGGACTTTAGACCAAATGG - Intergenic
910102277 1:83591126-83591148 ACTCTGCACTGTAGACCAAATGG - Intergenic
910214418 1:84828841-84828863 AATCTGAACAATGGAATCAATGG - Intronic
910351336 1:86301707-86301729 AATCTGCACTAGAGACCAAATGG - Intergenic
910413134 1:86967270-86967292 AATAAGAAATATAGTACAAATGG - Intronic
910470139 1:87544035-87544057 TGTCTGAACTATAGATCAAATGG - Intergenic
910547622 1:88435982-88436004 AATCTGTACTATAGAGCAAATGG + Intergenic
910620796 1:89251683-89251705 AATCTGCACTATAGACCAAATGG + Intergenic
910716147 1:90233189-90233211 AATCTGCGCTATAGAACAAACGG - Intergenic
910819162 1:91327607-91327629 AATCTGCACTATAGACCAAATGG + Intronic
911241118 1:95468092-95468114 AATCTACACTGTAGAGCAAATGG - Intergenic
911279996 1:95912459-95912481 AAACTGCAGTATAGACCAAATGG - Intergenic
911283732 1:95963270-95963292 AATCTGATATATAGACCAAACGG - Intergenic
911292087 1:96069441-96069463 AAACTGGACTTTAGACCAAATGG - Intergenic
911343594 1:96670358-96670380 AATCTGCGCTGTAGACCAAATGG - Intergenic
911496763 1:98640746-98640768 AATCTGCACTATAGACCAAATGG + Intergenic
911666031 1:100553460-100553482 AATCTGCTCTATAGACCAAATGG - Intergenic
911908791 1:103604563-103604585 GATCTGCACTTTAGACCAAACGG + Intergenic
911911108 1:103636905-103636927 GATCTGCACTTTAGACCAAACGG + Intergenic
911914126 1:103674898-103674920 GATCTGCACTTTAGACCAAACGG - Intronic
911918523 1:103731047-103731069 GATCTGCACTTTAGACCAAACGG + Intronic
911949998 1:104161154-104161176 AATCTACACTATAGACCAAATGG + Intergenic
912047031 1:105471650-105471672 AAACAAAACTATAGGACAAAAGG - Intergenic
912104999 1:106262145-106262167 AAACTGGACTCTAGAACTAATGG - Intergenic
912127567 1:106558217-106558239 AATCTGCACTATAAACCAAATGG + Intergenic
912130476 1:106593998-106594020 AAACTGAACTTTAGAGCAAATGG - Intergenic
912136456 1:106665227-106665249 AATCTGCACTGTGGACCAAATGG + Intergenic
912193277 1:107366468-107366490 AAAATTAACTTTAGAACAAAAGG + Intronic
912267973 1:108178328-108178350 AAACTATACTCTAGAACAAATGG + Intronic
912493545 1:110076522-110076544 AATCTGCACTCTGGAACCAATGG - Intergenic
912601386 1:110937206-110937228 AATCTGCACTATTGACCAAATGG + Intergenic
912614888 1:111089017-111089039 AATCTGCACTATAGAATAAATGG - Intergenic
912633001 1:111264584-111264606 AATCTGTCCTATGGACCAAATGG - Intergenic
912898987 1:113627438-113627460 AATCTGCACTATAGACTACATGG - Intronic
913036674 1:114972908-114972930 AATCTGCACTATAGACCAAATGG - Intronic
913146745 1:115999309-115999331 AATCTTCACTATAGACCAAATGG - Intronic
913374019 1:118131444-118131466 AATAAGAACTACAGAGCAAAAGG - Intronic
915178455 1:154037198-154037220 ACTCTGCACTATAGACCAAATGG - Intronic
915236007 1:154483098-154483120 ATTCTGAATTATAGAATAAAAGG - Exonic
915800875 1:158791908-158791930 AAACTGTGCTGTAGAACAAATGG - Intergenic
915852757 1:159344000-159344022 AATCTAGACTATAGAACTATAGG - Intergenic
915928066 1:160039510-160039532 AATCTGAAACAGAGAACAGAAGG - Exonic
916360800 1:163965686-163965708 AATCTGCACTATAGAATAAATGG + Intergenic
916369204 1:164071019-164071041 AATCTGCACTATACATCAAATGG - Intergenic
916567342 1:165992606-165992628 AATTTGAACTCCAAAACAAATGG + Intergenic
916903017 1:169250988-169251010 AAAGTGCACTCTAGAACAAATGG - Intronic
917051001 1:170922972-170922994 AAACTGCACTTTAGATCAAATGG + Intergenic
917061446 1:171045806-171045828 AATCTGCACTATACATGAAATGG - Intronic
917221198 1:172730539-172730561 AAACTGAACTCTAGACCAAATGG + Intergenic
917226125 1:172785344-172785366 AATCTACACTATAGATCAAATGG - Intergenic
917246024 1:173001899-173001921 AATCTGCACTATAGAACAAATGG - Intergenic
917306584 1:173631463-173631485 AATCTACACTACAGACCAAATGG + Intronic
917438859 1:175048246-175048268 AATCGGCACTATAGACCAAATGG - Intergenic
917566641 1:176219041-176219063 AATCTGAAACCTACAACAAAAGG - Intergenic
917583565 1:176401403-176401425 AATCTGCACTATAGACTAAAAGG - Intergenic
917841157 1:178979630-178979652 AATCTGCACTATAGACCAAGTGG + Intergenic
918018433 1:180660860-180660882 AATCTGCACTACAGACCAAATGG - Intronic
918415830 1:184307243-184307265 AATCTGTACTATAGACCAAATGG - Intergenic
918701001 1:187607785-187607807 AATCTGTACTGTAGACCAACTGG + Intergenic
918755347 1:188334283-188334305 AATCTGCACTATAGATCAAATGG - Intergenic
919012970 1:191988819-191988841 AATCTGCACTATAGACCAAAGGG + Intergenic
919068073 1:192718171-192718193 AATTTGCACTACAGACCAAATGG + Intergenic
919243711 1:194949590-194949612 AAACTGAACTGTAGACCAAATGG + Intergenic
919308999 1:195881884-195881906 AATCTGCATTATAGACCAAATGG - Intergenic
919370633 1:196721569-196721591 AAATTGGACTGTAGAACAAATGG - Intronic
919407810 1:197206749-197206771 AAACTATACTTTAGAACAAATGG - Intergenic
919595359 1:199554906-199554928 AATCTGTACTATAGAACAAATGG + Intergenic
921042973 1:211451749-211451771 AATCTACACTGTAGACCAAATGG + Intergenic
921117702 1:212109746-212109768 ATTCTTAACTATAGAAGGAAGGG + Intergenic
921176329 1:212598111-212598133 CATCCGCACTATAGAACAATGGG + Intronic
921237559 1:213149659-213149681 AATCTACACTACAGACCAAATGG - Intronic
921272920 1:213488951-213488973 AATCTGAAGTAAAGAGCAGATGG + Intergenic
921295842 1:213702429-213702451 AATCTGCACTATAGACCAAAAGG - Intergenic
921399576 1:214706685-214706707 AATCTGCACTATAAAAGAAATGG - Intergenic
921467900 1:215512489-215512511 AATCTGTACTATAGACCAAATGG + Intergenic
921746534 1:218746760-218746782 AATCTGCACTATAGACCAAATGG + Intergenic
921823456 1:219643808-219643830 AATCTGCACTATAGATCAAATGG + Intergenic
922044562 1:221931560-221931582 AATCTGTACTATAGACCAAATGG + Intergenic
922319516 1:224473773-224473795 AATCTGCACTATAGACCAAATGG + Intronic
922388284 1:225111130-225111152 AATCTGCACAATAGACCAAATGG - Intronic
923834766 1:237598288-237598310 AAACTGCACTCTAGACCAAAGGG + Intronic
923960305 1:239074425-239074447 AATCTGCACTACTGAACAAATGG + Intergenic
924068441 1:240251583-240251605 AAACTGAACTTTAGACCAAATGG - Intronic
924077560 1:240356633-240356655 AATCTGATCTTTAGAAGAGATGG - Intronic
924079560 1:240380113-240380135 AAACTGGACTCTAGACCAAATGG + Intronic
924490536 1:244532870-244532892 AATCTCCACTACAGACCAAATGG - Intronic
924618135 1:245632532-245632554 AATCCGCACTACAGACCAAATGG - Intronic
924768475 1:247056155-247056177 ACTCTGCACTGTAGACCAAATGG + Intronic
924792620 1:247266798-247266820 AATCTACAATATAGACCAAATGG - Intergenic
924838798 1:247685854-247685876 AAACTGCACTCTAGACCAAATGG - Intergenic
1063403136 10:5767286-5767308 AAGATGATCTGTAGAACAAAGGG - Intronic
1064446833 10:15402015-15402037 AATCTGCACTGTAGAACAAATGG + Intergenic
1064491726 10:15865018-15865040 AATCTTGACTAGAGAAAAAAGGG + Intergenic
1064521345 10:16205719-16205741 CTTCTGTACTACAGAACAAATGG - Intergenic
1064875144 10:19985391-19985413 AATCTCTACTATAGAAAAAGTGG - Intronic
1065158061 10:22891220-22891242 AAACTGAACTCTAGAACAAATGG - Intergenic
1065426673 10:25612801-25612823 AATGTACACTATAGACCAAATGG - Intergenic
1065431255 10:25659342-25659364 AATCTGCACTATAAACAAAACGG - Intergenic
1066142667 10:32523175-32523197 AATCTGTACTACAGAACAAATGG - Intronic
1066148755 10:32592040-32592062 AATCTGAACTATAGAGGAAGTGG - Intronic
1066476493 10:35752124-35752146 AATCTGCACTGTAGACCAAATGG + Intergenic
1066620984 10:37349473-37349495 GATCTGTACCAAAGAACAAACGG - Intronic
1067335346 10:45358201-45358223 AATCTGAACTATAGACCAAATGG + Intergenic
1067368087 10:45654979-45655001 AAACTGCACTCTAGAACAAATGG + Intronic
1067707253 10:48617330-48617352 AAACTGCACTTTAGAACAAATGG + Intronic
1067798939 10:49343516-49343538 AATTTGCACTATAGACCAAATGG + Intergenic
1067840467 10:49672753-49672775 AAACTGCACTTTAGACCAAACGG + Intergenic
1067974165 10:51005499-51005521 AATTGGAACAATAGGACAAAAGG + Intronic
1068193334 10:53683073-53683095 AATCTGAACTAAACATGAAAAGG - Intergenic
1068217534 10:54002322-54002344 AATCTCCACTGTAGAACAAATGG + Intronic
1068296902 10:55082053-55082075 AATCTGCGCTATAGACCAAATGG + Intronic
1068451235 10:57192007-57192029 AATCTGCTGTATAGACCAAACGG - Intergenic
1068593833 10:58880289-58880311 AAACTGCACTATAGATCAAATGG - Intergenic
1068781589 10:60924623-60924645 AGTCTGCACTATAGACCAAATGG + Intronic
1068844084 10:61651424-61651446 AATCTGCACTATAGACCGAGTGG - Intergenic
1069050824 10:63791264-63791286 CATCTGCACTATAGACCAAATGG + Intergenic
1069053291 10:63816856-63816878 AATCTGCACTGTGGAACAAATGG - Intergenic
1069193221 10:65516575-65516597 AATATGCACTATAGACCAAAAGG - Intergenic
1069335540 10:67345346-67345368 AATCTGCACTATGAACCAAATGG - Intronic
1069343860 10:67444026-67444048 AATCTGTGCTATAGAACAAATGG + Intronic
1069392091 10:67947101-67947123 AATCTGCACTACAGACCAAATGG + Intronic
1069395305 10:67981512-67981534 AATCTGCACTATAGACCAAATGG + Intronic
1069804446 10:71110072-71110094 AAACTGCATTATAGACCAAATGG - Intergenic
1070059008 10:72964246-72964268 AACCTGCACTACAAAACAAATGG - Intergenic
1070445026 10:76490299-76490321 ACACTGGACTATAGACCAAATGG - Intronic
1070851676 10:79568443-79568465 AATCTGTGCTCCAGAACAAATGG - Intergenic
1070896698 10:79989111-79989133 AATCTGAACTACAGACCAAATGG + Intergenic
1071018522 10:81025697-81025719 AATCTGCATTATAGACCAAATGG - Intergenic
1071050854 10:81447535-81447557 ACTCTGCACTATAGGCCAAATGG - Intergenic
1071062887 10:81594359-81594381 AAACTATACCATAGAACAAATGG + Intergenic
1071226386 10:83534126-83534148 AATGTGAAGTATATAATAAAAGG + Intergenic
1071354598 10:84781613-84781635 AAACTGGACTACAGACCAAATGG - Intergenic
1071539303 10:86466058-86466080 AAACTGAACTAAAGCAAAAATGG + Intronic
1071799204 10:89040181-89040203 AATCAGCACTATATAACAAATGG - Intergenic
1071869477 10:89778148-89778170 AATCTGTACTACAGACCACAAGG - Intergenic
1071879627 10:89882135-89882157 ATTATGTACTATAGACCAAATGG - Intergenic
1071896475 10:90073063-90073085 AATCTGTGCTATAGACCAAATGG - Intergenic
1072059095 10:91791292-91791314 AATGTGCACTATAGACCAAATGG + Intergenic
1072083839 10:92058799-92058821 AATCTACACTATTGAACAAAGGG + Intronic
1072115234 10:92364439-92364461 AATCTGCACTGTAGATCAAATGG - Intergenic
1072224398 10:93355034-93355056 AATTTTAACTATAGGAAAAAAGG - Intronic
1072378613 10:94842005-94842027 CATCTGCACTATAGACCAAATGG - Intronic
1072390472 10:94980347-94980369 CATCTGCACTATAGATCAAATGG - Intronic
1072392570 10:95002421-95002443 AATCTGCACTATAAAACAAATGG + Intergenic
1072398976 10:95077730-95077752 AATCTGCACTACACATCAAATGG - Intergenic
1072843330 10:98799414-98799436 CATCTGCGCTATAGAACAAATGG + Intronic
1072863028 10:99026600-99026622 AATCTGCACTACAGATCAAATGG + Intronic
1072877987 10:99193917-99193939 AATCTGCACTAGAGACCCAATGG + Intronic
1073661846 10:105484493-105484515 AATCTGCATTATAGAACACTAGG + Intergenic
1073713682 10:106076206-106076228 AAACTGAACAAAAGAAAAAAAGG - Intergenic
1073898310 10:108188584-108188606 AATCTTCTCTATAGACCAAATGG - Intergenic
1073905145 10:108270732-108270754 AAACTGCACTGTAGACCAAATGG - Intergenic
1074114983 10:110449627-110449649 AATCTGCACTATAGACCAAATGG + Intergenic
1074408758 10:113204739-113204761 AATCTGCACTATAGAACAAATGG + Intergenic
1074637835 10:115341521-115341543 AATCTGCACTATAGACCAAATGG - Intronic
1074804339 10:117032675-117032697 AATCTGCACTGTAGACCCAATGG + Intronic
1075195222 10:120351129-120351151 AATCTGCACTATAGACCAAATGG + Intergenic
1075496623 10:122925826-122925848 AATCTGCACTATAGACCAAATGG + Intergenic
1075830275 10:125404304-125404326 AACCTGTGCTATAGACCAAATGG - Intergenic
1075860991 10:125676128-125676150 AAACTGAACTTTAGGCCAAATGG - Intronic
1076085948 10:127632115-127632137 AAACTGCACTTTAGACCAAATGG - Intergenic
1076094891 10:127723922-127723944 AATCTGCACTATAGACCAAATGG + Intergenic
1076376917 10:129995458-129995480 AATCTACACTACAGACCAAATGG + Intergenic
1076925844 10:133486142-133486164 AAATTGCACCATAGAACAAATGG - Intergenic
1077596808 11:3539321-3539343 AAGCTGCACTTTAGACCAAATGG + Intergenic
1077830076 11:5857760-5857782 AATCTGAACAAAAGAAGAAGTGG - Intronic
1077912259 11:6582630-6582652 AATCTGCACTATAGAGTAAATGG + Intronic
1078244256 11:9559281-9559303 AATCTGCACTATGGATCAAATGG - Intergenic
1078993029 11:16669018-16669040 AATCTGCACTATAGAGCAAATGG + Intronic
1079041021 11:17059601-17059623 AATCTGCACTATACACCTAATGG + Intergenic
1079068872 11:17325198-17325220 AATCTACACTATAGATCAAATGG - Intronic
1079102614 11:17551308-17551330 AATCAGGACTATATAACAACAGG - Intronic
1079272012 11:18996966-18996988 TATCTGCACTATAGACAAAATGG - Intergenic
1079415761 11:20234827-20234849 AATCTGTACTACAGACCAAATGG - Intergenic
1079529781 11:21437125-21437147 AAACTTCACTATAGATCAAAAGG - Intronic
1079687187 11:23373996-23374018 AATCTGCACTATAGACCAAATGG + Intergenic
1080213422 11:29814277-29814299 AATATGCACTATAGACCAAATGG - Intergenic
1080486281 11:32710699-32710721 AAACTGTACCCTAGAACAAATGG - Intronic
1081049432 11:38318929-38318951 AATCTGCAATATAGACCAAAAGG + Intergenic
1081091934 11:38881363-38881385 CAGTTGAACTATTGAACAAATGG - Intergenic
1081123658 11:39296474-39296496 AATCTGTGCTATAGACCAAATGG + Intergenic
1081212280 11:40351413-40351435 AATCTGCACTATAGACCTAAAGG - Intronic
1082195259 11:49297248-49297270 AATCTGCACTATAGGCCAAATGG - Intergenic
1082225382 11:49700179-49700201 AATAGGCACTATAGACCAAATGG - Intergenic
1082244771 11:49909288-49909310 AATCTGCAATAAAGACCAAATGG - Intergenic
1082721441 11:56682102-56682124 AATCTGCACTATACGCCAAATGG + Intergenic
1084252725 11:67913294-67913316 AAGCTGCACTTTAGACCAAATGG + Intergenic
1084763507 11:71291150-71291172 AATCTACAGTATAGACCAAATGG - Intergenic
1084820138 11:71682736-71682758 AAGCTGCACTTTAGACCAAATGG - Intergenic
1085007857 11:73111183-73111205 AATCTGTACTATAGACCGAATGG - Intronic
1085147631 11:74216121-74216143 AATCTGCACTATATATCAAATGG + Intronic
1085178809 11:74514702-74514724 AACCTGCACTATAGACCAAATGG + Intronic
1085223720 11:74898884-74898906 AATCTGCATCATAGAAAAAATGG + Intronic
1085814721 11:79725620-79725642 AATCTGCACTATAGACTAAATGG + Intergenic
1086033401 11:82387192-82387214 AATCTGCATCATAGAACAAATGG + Intergenic
1086069020 11:82778893-82778915 AATCTGCACTATATACCAAATGG + Intergenic
1086123354 11:83324708-83324730 AAACTGCACTTTAGACCAAATGG - Intergenic
1086249108 11:84793414-84793436 AACCTGCACTTTAGGACAAATGG - Intronic
1086261153 11:84942736-84942758 AATCTGCACCATAGACCAAATGG - Intronic
1086524361 11:87707909-87707931 AATCTGCACTATAAACTAAATGG - Intergenic
1086541715 11:87920650-87920672 AAACTGTACTTTAGACCAAATGG - Intergenic
1086547971 11:88020578-88020600 AATCTGCACTACAGAACAGATGG + Intergenic
1086569879 11:88269835-88269857 AACCTACACTATAGAACAAATGG + Intergenic
1086574340 11:88321484-88321506 GAGCTGAACAATAGAACACATGG - Intronic
1086623710 11:88919526-88919548 AATAGGCACTATAGATCAAATGG + Intronic
1086660670 11:89412295-89412317 AATCTGCACTATAGACCAAATGG + Intronic
1086864420 11:91962264-91962286 AAACTATACTGTAGAACAAATGG + Intergenic
1087054044 11:93915635-93915657 AATCTCCACTATAAACCAAAGGG - Intergenic
1087201596 11:95350003-95350025 AATCTGCACTATAGACCAAATGG + Intergenic
1087299609 11:96416784-96416806 AATCTGCAGTATAGACCGAATGG + Intronic
1087353497 11:97063193-97063215 AAACTGGACTTTAGACCAAATGG + Intergenic
1087370947 11:97282827-97282849 AATCTGCACTATAGAATCAATGG + Intergenic
1087380231 11:97396450-97396472 AATCTGCACTATACATCAAATGG - Intergenic
1087460716 11:98442973-98442995 AATCTGCACTATAGATCAAATGG - Intergenic
1087492136 11:98841928-98841950 AACCTACACTATAGACCAAATGG - Intergenic
1087503520 11:98991189-98991211 AAACTGCACTACAGACCAAATGG - Intergenic
1087532624 11:99403868-99403890 AATCTTGACTATAGACAAAATGG - Intronic
1087681422 11:101222321-101222343 AAACTGCACCATAGACCAAATGG - Intergenic
1087720631 11:101661352-101661374 AATCTGCCTTATAGAACAAATGG - Intronic
1087950566 11:104215863-104215885 AATCTGGAGTATAGACCAAATGG - Intergenic
1087970842 11:104481110-104481132 AGTCTGCACTGTAGAACAAATGG + Intergenic
1088240331 11:107767610-107767632 ACTGTGTACTTTAGAACAAATGG + Intergenic
1088364642 11:109027339-109027361 AATCTGCACTGTAGACAAAATGG - Intergenic
1088406200 11:109481666-109481688 AATCTGCACTAAAGGCCAAATGG + Intergenic
1088520931 11:110699416-110699438 AAACTGAACTGTAGACCAAATGG - Intronic
1088552670 11:111029363-111029385 AAACTGCACTCTAGAACAAATGG + Intergenic
1088901457 11:114120817-114120839 AATGGGAACTGTAGAAGAAAGGG + Intronic
1089578598 11:119466049-119466071 AATCTGCACTATATGCCAAATGG - Intergenic
1090017010 11:123095062-123095084 AATCTGAATGATTGAATAAATGG + Intronic
1090209116 11:124904850-124904872 AATCTGTGCTATAGACCAAATGG - Intergenic
1090448143 11:126781970-126781992 AATCTTAACTTTGTAACAAAAGG - Intronic
1090688448 11:129151350-129151372 AAACTAAACCCTAGAACAAATGG + Intronic
1091052140 11:132382198-132382220 AATATGCACTACAGACCAAATGG + Intergenic
1092060267 12:5545098-5545120 AATCTGTACCCTAAAACAAATGG + Intronic
1092326483 12:7536296-7536318 AATCTGCACTATAGACCAAATGG - Intergenic
1092422974 12:8348095-8348117 AAGCTGCACTTTAGACCAAATGG + Intergenic
1092497919 12:9015636-9015658 AATCTGTCCTATAGACCAAGTGG + Intergenic
1092573583 12:9753318-9753340 AAACAGAACTATGGAAAAAAAGG - Exonic
1092646672 12:10581831-10581853 AAACTGTACTCTAGATCAAATGG + Intergenic
1093023871 12:14228728-14228750 AAACTGCACCATAGACCAAATGG - Intergenic
1093259264 12:16914992-16915014 TATCTGCACTATAGACCAAATGG - Intergenic
1093263530 12:16971091-16971113 AAACTGCAATATAGACCAAATGG - Intergenic
1093404121 12:18784086-18784108 CATCTGCACTATAGACCAAGTGG + Intergenic
1093419747 12:18961700-18961722 AATCTGTACTATAGACCAAATGG - Intergenic
1093538453 12:20251004-20251026 AATCTGCACTGTAGACCAAATGG + Intergenic
1093581406 12:20787633-20787655 AATCTGCACTATAGAATAAATGG - Intergenic
1093593571 12:20936298-20936320 AGTCTGCACTATAGATCAAATGG - Intergenic
1093601936 12:21037670-21037692 AACCTGAGCTATGGAACAAGTGG - Intronic
1093606387 12:21095243-21095265 AAACTGCACTCTAGACCAAATGG - Intronic
1093607885 12:21116012-21116034 TCTCTGTACTATAGACCAAATGG - Intronic
1093888429 12:24490164-24490186 AAGCTGAGTTATAGAACAAATGG - Intergenic
1093903042 12:24658220-24658242 AATCTGCACTATAGACCAAATGG - Intergenic
1094258840 12:28467586-28467608 AATCTATACTATAAAGCAAATGG + Intronic
1094420054 12:30261357-30261379 AATCTGCACTATAGAACAAATGG + Intergenic
1094440773 12:30473730-30473752 AATCTGCTCTATAGACCAAATGG + Intergenic
1094726330 12:33120859-33120881 ATTCTGCACTATAGACCAAGTGG - Intergenic
1094741879 12:33298964-33298986 AATCTGTACTACAGAACAATTGG + Intergenic
1094787119 12:33861038-33861060 AATCTGCACTGTAGACCAAATGG - Intergenic
1095133962 12:38575274-38575296 AATCTGCACTATAGACCAAATGG + Intergenic
1095163587 12:38944746-38944768 AATCTGCACTGTAGACCAAATGG + Intergenic
1095227854 12:39698472-39698494 CATCTGTACTATAGATCAAATGG + Intronic
1095240002 12:39846873-39846895 AATGTTAACTATATAATAAATGG + Intronic
1095613915 12:44165851-44165873 AAACTGCACTTTAGACCAAATGG + Intronic
1095760121 12:45822946-45822968 AATCTGCACTATAGACCAAATGG + Intronic
1095786418 12:46113710-46113732 AAACTGCACTCTAGAACAAATGG + Intergenic
1095807746 12:46339165-46339187 AATCTGAACTATACACCAAATGG - Intergenic
1095911701 12:47433173-47433195 AATCCAAACTTTAGATCAAATGG + Intergenic
1097146720 12:56945759-56945781 AATCTGCACTGTAGACCAAATGG - Intergenic
1097413596 12:59285280-59285302 CATCTGAATTATAGAAACAAAGG - Intergenic
1097425801 12:59442951-59442973 AATTCACACTATAGAACAAATGG - Intergenic
1097466499 12:59931641-59931663 AAACTGCACTATAGACCAAATGG + Intergenic
1097521522 12:60676571-60676593 AAACTGAACAATAGATCAAATGG - Intergenic
1097595486 12:61623612-61623634 AAACTGGACTTTAGAGCAAATGG + Intergenic
1097600297 12:61683559-61683581 AATCTGCACTCTAGAATAAATGG + Intergenic
1097770205 12:63574936-63574958 AATCTGCACTATAGATCAAAAGG + Intronic
1097791512 12:63820665-63820687 AATCTGCATTATAAAACAAACGG + Intergenic
1097834788 12:64262186-64262208 TATGTGAAATATAAAACAAATGG + Intergenic
1097898239 12:64847893-64847915 AATCTGTACTATAGAACAAATGG - Intronic
1098142612 12:67466189-67466211 AATGTGCACTACAGACCAAATGG - Intergenic
1098155664 12:67595495-67595517 AATCTGCACTATAAATGAAAAGG + Intergenic
1098207595 12:68129363-68129385 AACCTGCACTATAGACCAAATGG - Intergenic
1098226369 12:68329321-68329343 AATTTGGTCTAGAGAACAAAGGG - Intronic
1098319480 12:69226960-69226982 AATCTGCACTAGAGACCAAATGG + Intergenic
1098396218 12:70019930-70019952 AATCTGCACGGTAGACCAAATGG + Intergenic
1098396431 12:70023116-70023138 AATCTGCACTATAGACTAAATGG + Intergenic
1098502049 12:71204344-71204366 AAACTTCACTCTAGAACAAATGG + Intronic
1098582677 12:72119550-72119572 AATCGGCACTATAAAACAAACGG - Intronic
1098671573 12:73236116-73236138 AAACTGCACTGTAGACCAAATGG + Intergenic
1098702753 12:73649535-73649557 AATCTGCACTACAGAACAAATGG + Intergenic
1098786241 12:74759883-74759905 AAACTACACTCTAGAACAAATGG - Intergenic
1098903618 12:76138894-76138916 AAACTGAACTATAAAATAAATGG + Intergenic
1098939750 12:76520268-76520290 ACTCTGCACTAGAGAAGAAATGG - Intronic
1099100694 12:78436789-78436811 AATCTGCACTACAGACCAAATGG - Intergenic
1099290919 12:80775512-80775534 AAACTAAACTTTAGACCAAATGG - Intergenic
1099390873 12:82077749-82077771 AAACTGAACTTTAGACCAAATGG - Intergenic
1099416525 12:82394203-82394225 AATCTGCACTATGGACCAAATGG - Intronic
1099465303 12:82978702-82978724 AATTGGCACTATAGAGCAAATGG - Intronic
1099519247 12:83640061-83640083 AAACTGTACTTTAGACCAAATGG - Intergenic
1099523559 12:83693045-83693067 AATCTGCACCATAGGTCAAATGG + Intergenic
1099757716 12:86876037-86876059 AATCTGCACTATTGGCCAAATGG - Intergenic
1099808497 12:87549964-87549986 AATCTGCACTATAGGCCAAATGG + Intergenic
1100360520 12:93874933-93874955 AATCTGCACTGTAGATCAAATGG - Intronic
1100905165 12:99289396-99289418 AATCTATACTATAGAACAAATGG + Intronic
1100914661 12:99406148-99406170 AATCTGTACTATAGGTCAAATGG + Intronic
1100946655 12:99791403-99791425 AATCTGCACTTTAGAAAAAATGG + Intronic
1100995951 12:100301629-100301651 AATCTGCACCATAGATTAAATGG - Intronic
1101025878 12:100606002-100606024 AATCTTCACTATAGAACAAATGG - Intronic
1101222365 12:102654892-102654914 AATCTAAAACATAGACCAAAAGG + Intergenic
1101562536 12:105871657-105871679 AATCTGTACTATAGACCAAATGG + Intergenic
1101607847 12:106262065-106262087 AATCTGCACTATACACCAAATGG + Intronic
1103233050 12:119348390-119348412 ATCCTGAACCATAGAACACAAGG - Intronic
1103816991 12:123666275-123666297 AATTTGCACTATAGACCAAATGG - Intergenic
1103893706 12:124259194-124259216 AAGATGAACTCTAGCACAAATGG + Intronic
1104102886 12:125631502-125631524 AATCTGCACTATAGACCAAATGG - Intronic
1104615974 12:130268934-130268956 AATCTACACTATAGAACAATTGG - Intergenic
1105558690 13:21470226-21470248 AATCTGCATTATAGCACAAGTGG - Intergenic
1105611785 13:21975122-21975144 AATCTAAACTTTAGAACATGTGG + Intergenic
1106060187 13:26283174-26283196 AAACTATACCATAGAACAAATGG + Intronic
1106061155 13:26293839-26293861 AATATATATTATAGAACAAATGG - Intronic
1106572918 13:30944957-30944979 AAACTACACTCTAGAACAAATGG - Intronic
1106723384 13:32458766-32458788 AAACTGCACTTTAGACCAAATGG + Intronic
1106843831 13:33715753-33715775 AATCTGCACTCTAGAACAAATGG + Intergenic
1107083642 13:36402498-36402520 AATCTGCACTATAAACCAATTGG - Intergenic
1107085468 13:36423157-36423179 AATCTGCACTACAGACCAAATGG + Intergenic
1107091341 13:36484274-36484296 AGACTGCACTATAGACCAAATGG - Intergenic
1107158852 13:37201688-37201710 AATCCTATCTATAGAACAATGGG + Intergenic
1107178367 13:37426305-37426327 AATCTACACTATTGACCAAATGG + Intergenic
1107228440 13:38079268-38079290 AATCTGCACCGTAGACCAAATGG + Intergenic
1107265743 13:38551814-38551836 AATCTGCACTATAGACCAAATGG - Intergenic
1107287479 13:38811807-38811829 AATCTGCACTACAGAACAAATGG - Intronic
1107361417 13:39621591-39621613 AAGCTGTACCCTAGAACAAACGG + Intergenic
1107551882 13:41484307-41484329 AATCTGCACTATACAAGAAATGG - Intergenic
1107750721 13:43563013-43563035 AATCTGCACTATAGACTAAATGG + Intronic
1107807659 13:44169663-44169685 AATCTGCACTATAGACCAAATGG - Intergenic
1107998062 13:45880497-45880519 AAACTGGACTCTAGACCAAATGG + Intergenic
1108099556 13:46939594-46939616 ACTCTGAACTAAAGACCAAATGG + Intergenic
1108219553 13:48219081-48219103 AATCAGAACTATCGATAAAATGG - Intergenic
1108255680 13:48608473-48608495 AATCTGCAGTACAGACCAAATGG - Intergenic
1108339640 13:49485693-49485715 CATCTGAACTCTAAAACCAAGGG + Exonic
1108632422 13:52299622-52299644 AAACTGCACCATAGACCAAATGG - Intergenic
1108635253 13:52327581-52327603 AAACTGTGCTTTAGAACAAATGG + Intergenic
1108652556 13:52495648-52495670 AAACTGTGCTTTAGAACAAATGG - Intergenic
1108654281 13:52512972-52512994 AAACTGCACCATAGACCAAATGG + Intergenic
1108858680 13:54827163-54827185 AATCCGCACTATAGATCAAATGG + Intergenic
1108863575 13:54894096-54894118 AATATGAACTATGGAATCAAAGG - Intergenic
1108956041 13:56158453-56158475 AAACTGCACTTTAGAACAAATGG + Intergenic
1108961917 13:56244619-56244641 AATTTGCACTATAGAATAAATGG - Intergenic
1108973537 13:56406156-56406178 AGTTTGCACTATAGACCAAATGG + Intergenic
1109134431 13:58628583-58628605 AATCTGTATTATAGACCAAATGG + Intergenic
1109218834 13:59620131-59620153 AAACTGCACCATAGAACAAATGG + Intergenic
1109336383 13:61000274-61000296 AATCTGCACTACAGACCAAATGG - Intergenic
1109433039 13:62261037-62261059 AAACTGCACTATAGACAAAATGG + Intergenic
1109483891 13:62993941-62993963 AAACTACACTATAGAACAAATGG - Intergenic
1109522255 13:63529438-63529460 AATCTGCAGTATAGACCAAATGG - Intergenic
1109650411 13:65316638-65316660 AAACTGAACTGTAGACCAAATGG + Intergenic
1109686048 13:65820919-65820941 AATCTGCACTAAATACCAAATGG + Intergenic
1109747927 13:66650661-66650683 AATGTACACTATAGACCAAAAGG + Intronic
1109990923 13:70056465-70056487 AATCTGCATTATAGACCAAATGG + Intronic
1110135398 13:72061854-72061876 AATCTGCACTATAGATCAAACGG + Intergenic
1110159445 13:72358293-72358315 ATTCTGAACAATAGAAAAAGAGG - Intergenic
1110377600 13:74811553-74811575 AATCTGCACTATAGACCAAATGG + Intergenic
1110415616 13:75248491-75248513 AATGTGAACTATTGAGAAAAGGG + Intergenic
1110501523 13:76233696-76233718 TATCTGCACTATAGACCAAATGG + Intergenic
1110806659 13:79762436-79762458 AATCTATACAATAGACCAAATGG - Intergenic
1110879090 13:80548296-80548318 ATGCTGAACTACAGAACAAAGGG - Intergenic
1110888004 13:80662769-80662791 AAACTGCACTCTAGAACAAATGG - Intergenic
1110901658 13:80832473-80832495 AATCTGCACTATTGACCAAATGG + Intergenic
1110917239 13:81036724-81036746 AACCTGCACTATAGGCCAAATGG + Intergenic
1111130676 13:83971154-83971176 AATCTACACTGTAGACCAAATGG + Intergenic
1111152580 13:84275790-84275812 AAACTACACTATAGACCAAATGG - Intergenic
1111290648 13:86165662-86165684 CATTTGAACTATATAAGAAAAGG + Intergenic
1111356092 13:87104456-87104478 AATGTGTGCTATAGACCAAATGG - Intergenic
1111568317 13:90046387-90046409 AATCTGCATTCTGGAACAAATGG - Intergenic
1112137649 13:96600146-96600168 AAACTGGAATCTAGAACAAATGG - Intronic
1112403921 13:99101050-99101072 AATATCAACTAGAGTACAAAAGG + Intergenic
1112618560 13:101031463-101031485 AATCTTCACTATAGGCCAAATGG - Intergenic
1112749013 13:102562145-102562167 AAACTGTACTTTAGACCAAATGG - Intergenic
1112944366 13:104908777-104908799 AACCTGCACTAAAGAACAAATGG - Intergenic
1113208388 13:107944140-107944162 AAACTGGACTCTAGACCAAATGG + Intergenic
1113212252 13:107997339-107997361 AATCTGTACTATAGACCAAATGG - Intergenic
1113243944 13:108373732-108373754 AATCTGCAGTATAGAACAAATGG - Intergenic
1113570543 13:111352688-111352710 AAACTGCACTCTAGACCAAATGG + Intergenic
1114155737 14:20100878-20100900 ATTCTGAACTGTAGAAAAACAGG - Intergenic
1114698416 14:24649835-24649857 AAATTGCACTCTAGAACAAATGG + Intergenic
1114761365 14:25319367-25319389 AATCTGTACTATAGACCAAATGG - Intergenic
1114820511 14:26012687-26012709 AATCTTCACTATAGACCAAATGG + Intergenic
1114984900 14:28214543-28214565 AATCTGCACTGTACAACAAATGG - Intergenic
1115134160 14:30089279-30089301 AATCTGCACCATAGACCAAATGG + Intronic
1115288888 14:31748313-31748335 AAACTGTACTATAGACCAAATGG - Intronic
1115381284 14:32742882-32742904 AGCCTGCACTATAGACCAAATGG - Intronic
1115476986 14:33824860-33824882 AATCTGCAGTATAGACCAAATGG + Intergenic
1115661410 14:35498345-35498367 AATCTGCACTATAAACCAAATGG + Intergenic
1115695647 14:35895822-35895844 AAACTGGACTTTAGACCAAATGG - Intronic
1115833305 14:37366662-37366684 AATCTGAACTACAGACTAAATGG - Intronic
1115918607 14:38345718-38345740 AATCTGCACTATAAACCAAATGG + Intergenic
1115948968 14:38697862-38697884 AATCTGCACTATAGAACAAATGG + Intergenic
1116021362 14:39465972-39465994 CATCTGCACCACAGAACAAATGG - Intergenic
1116085614 14:40233920-40233942 AATCTGCACTATGTAACAAATGG - Intergenic
1116154956 14:41191861-41191883 ACTCTGCACTATAGGCCAAATGG + Intergenic
1116355076 14:43917768-43917790 AATCTACACTATAGAATAAATGG + Intergenic
1116393437 14:44420353-44420375 AATCTGCACTATAGACCAAATGG + Intergenic
1116450353 14:45057954-45057976 AAATTGAACTTTAGACCAAATGG - Intronic
1116481458 14:45395978-45396000 AATCTGTGTTATAGACCAAATGG + Intergenic
1116725447 14:48556768-48556790 AAGCTGAATCAGAGAACAAAGGG + Intergenic
1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG + Intergenic
1117110598 14:52449576-52449598 AATCTGCACTACAGACAAAATGG + Intronic
1117159057 14:52970438-52970460 AATCTGCACTATAGACCAAATGG - Intergenic
1117161123 14:52991083-52991105 AATTTGCATTATAGACCAAATGG - Intergenic
1117240936 14:53831824-53831846 AAACTGTACCCTAGAACAAATGG + Intergenic
1117264337 14:54071105-54071127 AATCTGTACTATAAATCAAATGG - Intergenic
1117289398 14:54317911-54317933 AATGTGAACTATAGGAAAGAAGG - Intergenic
1117321909 14:54632559-54632581 AAAGTGAAGTGTAGAACAAATGG - Intronic
1117634515 14:57727896-57727918 AATCTTCACTGTGGAACAAATGG - Intronic
1117933961 14:60880480-60880502 AATGTGAACTATTGAATGAAAGG + Intronic
1118033950 14:61846162-61846184 AATCTGCACTATAGACCAAATGG - Intergenic
1118099140 14:62575740-62575762 AATCTGCACTATAGACTAAATGG + Intergenic
1118263894 14:64275109-64275131 AATCTGCACTAAAGACCAAATGG - Intronic
1118543786 14:66861473-66861495 AATCAGCACTATAGAACAAATGG + Intronic
1119015043 14:71042184-71042206 AGTCTGCACTACAGAACAAATGG - Intronic
1120262807 14:82208833-82208855 AATCTGCACTATATAAGAAATGG - Intergenic
1120276036 14:82373764-82373786 TTTCTGCACTATAGAATAAATGG + Intergenic
1120340445 14:83214303-83214325 AATCTGCACTATGGATCAAATGG - Intergenic
1120431066 14:84416574-84416596 AAACTGTACTGTAGACCAAATGG - Intergenic
1120439421 14:84517531-84517553 AATCAGTACTGTAGACCAAATGG - Intergenic
1120572310 14:86135723-86135745 AGTCTGCACTATAGACCAAATGG + Intergenic
1120579883 14:86233156-86233178 AATCTGCACTGCAGAATAAATGG + Intergenic
1120697703 14:87662596-87662618 ATTCTGCACTACAGACCAAATGG + Intergenic
1120770811 14:88378077-88378099 AATCTGTGCTATAGACCAAATGG - Intergenic
1120794143 14:88613425-88613447 ACTATAAATTATAGAACAAATGG + Exonic
1120809057 14:88783788-88783810 AATGTGCACTATAGACCAAATGG + Intronic
1121130645 14:91443192-91443214 AATCTGCACTGTAGAACAAATGG + Intergenic
1121153231 14:91657157-91657179 AATCTGCACTGTAGACCAAATGG + Intronic
1121373893 14:93387752-93387774 AATCTGCACTATAGAACAAATGG - Intronic
1123111781 14:105873722-105873744 AATCTGCACTATCGACCAAATGG - Intergenic
1123463007 15:20491770-20491792 AATCTGCACTGTAGACCAAATGG - Intergenic
1123502720 15:20904672-20904694 AATCTGCACTATAAACCAAATGG + Intergenic
1123559968 15:21478339-21478361 AATCTGCACTATAAACCAAATGG + Intergenic
1123596208 15:21915638-21915660 AATCTGCACTATAAACCAAATGG + Intergenic
1123655052 15:22508644-22508666 AATCTGCACTGTAGACCAAATGG + Intergenic
1123720086 15:23052649-23052671 AATCTGCGCTAGAGACCAAATGG - Intergenic
1124081124 15:26498419-26498441 AATCTGCACCATAGAACAAATGG - Intergenic
1124131644 15:26993714-26993736 AATCTGCACTATAGAACAAATGG - Intronic
1124273845 15:28309172-28309194 AATCTGCACTGTAGACCAAATGG - Intronic
1124308962 15:28603845-28603867 AATCTGCACTGTAGACCAAATGG + Intergenic
1124379931 15:29156673-29156695 ACTCTGAAGTTCAGAACAAAAGG + Intronic
1124843890 15:33271734-33271756 AATCTGCACTATAGACTAAATGG - Intergenic
1125433747 15:39624819-39624841 AATCTGAACTCTAGTCAAAAAGG + Intronic
1125494923 15:40183812-40183834 TAGCTGAACTAAAGAGCAAAGGG + Exonic
1125565432 15:40674488-40674510 AATGTGCACTATAGAAAAAATGG - Intergenic
1125821078 15:42631954-42631976 AATCTGCACTGTAAACCAAATGG - Intronic
1126015867 15:44349617-44349639 CATCTACACTATAGACCAAATGG + Intronic
1126052900 15:44703299-44703321 AATCTGCACTATAGATCAAATGG - Intronic
1126258792 15:46661431-46661453 AAACTGCACTATAGAATATATGG + Intergenic
1126440866 15:48686826-48686848 AATCTGAACTATAGACCAAATGG + Intergenic
1126480459 15:49113231-49113253 AAAGTGCACTATAGACCAAATGG + Intronic
1126488757 15:49213004-49213026 AATCTGCACTATAGAACAAATGG - Intronic
1126534266 15:49743247-49743269 AATCTGCACTATGGAACAAACGG + Intergenic
1126549545 15:49911663-49911685 AAACTGGACTTTAGATCAAATGG + Intronic
1126640449 15:50819681-50819703 AATCTGAAAGATAAAATAAAAGG - Intergenic
1126708759 15:51432615-51432637 GATCTGCCCTATAGAACAAATGG + Intergenic
1126709170 15:51438247-51438269 AATCTGCACTATAGAACAAATGG - Intergenic
1126745353 15:51820415-51820437 AATCTGCTCTATAGGCCAAATGG + Intergenic
1127019040 15:54724828-54724850 AATCTGTACTATAGAACAAATGG - Intergenic
1127020464 15:54741333-54741355 AAACTGAACTCTAGACCAAAGGG + Intergenic
1127033811 15:54892727-54892749 AATCTACACTATAGACCAAATGG - Intergenic
1127132917 15:55886325-55886347 AATCTGCACTACAGACCAAATGG + Intronic
1127140689 15:55973111-55973133 AATCTGCACTGTAAACCAAATGG + Intronic
1127177772 15:56379558-56379580 AATCTGCACTGCAGAACAAGTGG - Intronic
1127196698 15:56593873-56593895 AACCTGCACTTTAGACCAAATGG + Intergenic
1127406582 15:58655007-58655029 AATCTGCAGTATAGAACAAATGG - Intronic
1127970599 15:63957012-63957034 AATATGCATTATAGACCAAATGG - Intronic
1128014790 15:64334049-64334071 AAACTGCACTTGAGAACAAATGG + Intronic
1128337635 15:66797570-66797592 TATCTGCACAATAGGACAAAGGG - Intergenic
1128364766 15:66991072-66991094 GATCTGGACTATGGACCAAATGG + Intergenic
1128401638 15:67288257-67288279 GATCTGCACTACAGATCAAATGG - Intronic
1129224038 15:74155698-74155720 AACCTGACCTATCTAACAAAGGG - Intergenic
1129501434 15:76041806-76041828 AATCTGTACTATAGACCACATGG + Intronic
1129963238 15:79709255-79709277 AAATTGAACTTTAGACCAAATGG - Intergenic
1130400143 15:83544465-83544487 ATTCTGCACTATAGACCAAATGG - Intronic
1130962154 15:88667753-88667775 AATCTGCACTACAGACCAAATGG + Intergenic
1131319537 15:91373701-91373723 AATCTGCACCATAGACCAAATGG - Intergenic
1131323250 15:91417787-91417809 AATCTACGCTATAGATCAAATGG - Intergenic
1131680462 15:94716429-94716451 AATTTGGACTATATAAGAAATGG + Intergenic
1131945193 15:97612296-97612318 AATCTGCACTATAGACCAAATGG + Intergenic
1132126750 15:99233997-99234019 AATATGAGATATAGATCAAAGGG - Intronic
1202968314 15_KI270727v1_random:205501-205523 AATCTGCACTATAAACCAAATGG + Intergenic
1133375276 16:5281439-5281461 AAGCTGCACTTTAGACCAAATGG - Intergenic
1133833621 16:9347452-9347474 AATCTGCACTGTAGACCAACTGG - Intergenic
1133947179 16:10358420-10358442 AATGTGTACAATAGAAAAAAAGG + Intronic
1135832326 16:25786759-25786781 GATCTGAACTATTAAAGAAAGGG - Intronic
1135879721 16:26242252-26242274 AATCAGAACTATAGACCAAGTGG + Intergenic
1135902091 16:26470271-26470293 AAGCTGCACTGTAGCACAAATGG + Intergenic
1136281653 16:29216371-29216393 AAACTGAGCTATAGATCCAATGG + Intergenic
1136387244 16:29936518-29936540 AATATGAATAACAGAACAAAGGG + Intergenic
1137020603 16:35422270-35422292 AATCTGATTTCTAGTACAAAAGG + Intergenic
1137027381 16:35491023-35491045 AATCTGATTTCTAGTACAAAAGG + Intergenic
1137308110 16:47225237-47225259 AGTCTGAAGGATAGAAAAAAAGG + Intronic
1137337865 16:47569032-47569054 AAACTGGACTCTAAAACAAATGG - Intronic
1137459443 16:48646702-48646724 AAACTGTACAATAGACCAAATGG - Intergenic
1137470380 16:48750248-48750270 AAACTGCACCATAGACCAAATGG + Intergenic
1138141065 16:54568912-54568934 AATCCAAACAATAAAACAAACGG + Intergenic
1138712938 16:58989492-58989514 AATCTGCACTATAGACCAAAGGG + Intergenic
1138738859 16:59283380-59283402 AAACTGGACTTTAGATCAAATGG + Intergenic
1138864952 16:60806240-60806262 AATTGGCACTATAGAACAAATGG + Intergenic
1139004683 16:62555913-62555935 AGTCTGCACTATAGACCAAATGG - Intergenic
1139031709 16:62891077-62891099 CATCTGCACCATAGAACATATGG - Intergenic
1140157819 16:72452098-72452120 AATCTGCTCTATAGACCAAATGG - Intergenic
1140566840 16:76053205-76053227 AATCTGCACTATAGACCAATGGG - Intergenic
1140646362 16:77035482-77035504 AATCTGCACTGTAGACCAAATGG - Intergenic
1140735369 16:77893322-77893344 AATCAGAAATAAAGGACAAAGGG + Intronic
1141038240 16:80647667-80647689 CATCTGCACTATAGGCCAAATGG + Intronic
1141221632 16:82074827-82074849 AATCTGCACTATAGACCAAATGG + Intronic
1142086026 16:88182302-88182324 AAACTGAGCTATAGATCCAATGG + Intergenic
1143257043 17:5566675-5566697 AATCTGCATTACAGACCAAATGG - Intronic
1143413979 17:6732175-6732197 AATCTGCACTATAGACCAAATGG + Intergenic
1143420125 17:6782899-6782921 AATTTGCATTATAGACCAAAAGG + Intronic
1143431313 17:6888328-6888350 AATGTGCACTATAGACCAAATGG - Intronic
1144614320 17:16754739-16754761 AACCTGCACTATAGACCACATGG - Intronic
1144898387 17:18560938-18560960 AACCTGCACTATAGACCACATGG + Intergenic
1145133988 17:20384783-20384805 AACCTGCACTATAGACCACATGG - Intergenic
1145556109 17:24776014-24776036 AAGCTGAACTATCAAAGAAAAGG - Intergenic
1145626204 17:25796338-25796360 AACCTGAACTATCAAAGAAAGGG - Intergenic
1145665834 17:26371483-26371505 AACCTGAACTATCAAAGAAAGGG - Intergenic
1146086285 17:29833102-29833124 AATCTGCACTATAGACCAAATGG - Intronic
1146215552 17:30976466-30976488 AATCTGTACTGTAGATCAAATGG - Intronic
1146615341 17:34352350-34352372 AATCTGCACTATAGACCAATTGG + Intergenic
1147657149 17:42097543-42097565 ACCCTGGATTATAGAACAAAGGG - Intergenic
1148518319 17:48243358-48243380 TGTCTGATTTATAGAACAAAGGG - Intronic
1148762311 17:50012693-50012715 TATCTGAACTCTAGAAAACATGG - Intergenic
1149180438 17:53930471-53930493 AATCTGCACTATAGATATAATGG - Intergenic
1149303007 17:55322251-55322273 AATGTTTACTATAGACCAAAAGG + Exonic
1150192351 17:63256607-63256629 AATCTGCATTATAGACCAAATGG - Intronic
1150567846 17:66358030-66358052 AATGTTAACTCCAGAACAAAAGG - Intronic
1150835412 17:68559106-68559128 CTTCTGACCTATAGGACAAATGG + Intronic
1150871226 17:68912877-68912899 AATGTGCACTATAGATCAAATGG + Intronic
1150935857 17:69634785-69634807 AGTCTTAATGATAGAACAAATGG + Intergenic
1151503499 17:74509562-74509584 AATCTGTACTATAGACCAAATGG - Intergenic
1152909638 17:82993611-82993633 AATCTGTGCTACAGACCAAATGG + Intronic
1153075041 18:1153093-1153115 AATCTGTACTACAGATCAAATGG - Intergenic
1153425313 18:4956341-4956363 AAACTGTACCCTAGAACAAATGG + Intergenic
1153454794 18:5269096-5269118 AATCTGCACTGTAGAAAAAATGG + Intergenic
1153699810 18:7681149-7681171 AATATGAACTACATCACAAAAGG - Intronic
1153926860 18:9842185-9842207 AATACGAACTATTGAACACAAGG - Intronic
1153938658 18:9956133-9956155 TTTCTCAACCATAGAACAAAGGG - Intronic
1154407696 18:14109341-14109363 AATCTGTGCTATAAACCAAATGG + Intronic
1154931121 18:20997614-20997636 AATCTGCACTATAGACCAAATGG + Intronic
1154945096 18:21155074-21155096 AAACTGGACTTTAGACCAAATGG - Intergenic
1155088263 18:22478787-22478809 AAACTGCACTTTAGACCAAATGG + Intergenic
1155411150 18:25546562-25546584 AATCTGCACTGTAGAACAAATGG + Intergenic
1155443676 18:25887777-25887799 AATCTGCACTATAGGCCAAATGG + Intergenic
1155681941 18:28498608-28498630 AATCTGTACTTTACAAGAAATGG - Intergenic
1155731840 18:29169720-29169742 AATCTGCAATATAGACCAAATGG - Intergenic
1155771594 18:29707724-29707746 AAACTACACTCTAGAACAAATGG - Intergenic
1155781821 18:29847075-29847097 AATCTGCACTATAGACAAAAAGG - Intergenic
1156025697 18:32652215-32652237 AATCTGCACTGTAGACCAAATGG - Intergenic
1156055889 18:33002155-33002177 AATTTCCACTATAGGACAAATGG + Intronic
1156094566 18:33513602-33513624 TATCTGCACTATAGAACAAATGG + Intergenic
1156432936 18:37095208-37095230 AATCTGCACTATAAACCATATGG + Intronic
1158119054 18:54028110-54028132 AAGCTGAAGGATAGAACAAAAGG - Intergenic
1158431608 18:57392870-57392892 AATCTGCACTATAGACCAAATGG + Intergenic
1158735850 18:60077999-60078021 AAACTGTACTTTAGACCAAATGG + Intergenic
1158948769 18:62472393-62472415 AATCTGCACTGTAGAACAAATGG - Intergenic
1159080948 18:63735181-63735203 AATCTGCACTACAGACCAAATGG + Intergenic
1159382497 18:67679804-67679826 AAGTTGAACTCTAGAGCAAATGG + Intergenic
1159565202 18:70040601-70040623 AATCTGCACTAAAGACCAAACGG + Intronic
1159648479 18:70948579-70948601 AATCTGCACTGTAGGCCAAATGG + Intergenic
1159802418 18:72918097-72918119 AATGTGCACTATAGAAAATATGG - Intergenic
1159896215 18:73998746-73998768 AATCTGAACTATAGACCAAATGG - Intergenic
1160018766 18:75164510-75164532 AAACTCAAATATAGAACAAATGG + Intergenic
1160138224 18:76293598-76293620 AATCTGCACTAAAGACAAAATGG - Intergenic
1160141849 18:76331060-76331082 AAACTGACCTCTAGACCAAATGG + Intergenic
1162274574 19:9642661-9642683 AATCTGAACTTTGTATCAAATGG + Intronic
1162610959 19:11752055-11752077 AGTCTGCACTGTAGACCAAATGG - Intergenic
1162666448 19:12217102-12217124 AATCTGCACTATAGATCAAATGG - Intergenic
1162688034 19:12404262-12404284 AATCTACACTATAGATCAAATGG - Intronic
1162692354 19:12444054-12444076 AATCTACACTATAGATCAAATGG - Intronic
1163949883 19:20573997-20574019 AAACTATACTCTAGAACAAATGG - Intronic
1164422623 19:28108961-28108983 AAACTGCATTCTAGAACAAATGG + Intergenic
1164547133 19:29176325-29176347 AATCTGCATTATGAAACAAATGG + Intergenic
1165645881 19:37435972-37435994 AATCTGCACTACAGATCAAATGG + Intronic
1165964120 19:39560232-39560254 AATCCCTACTATAGAAGAAATGG - Intergenic
1166407984 19:42536322-42536344 AATCTGAACTATAGAACAAATGG - Intronic
1166924267 19:46255540-46255562 AATCTAAGCTATAAGACAAACGG + Intergenic
1167053156 19:47092247-47092269 AATCCGAATTATAGAAAAACAGG + Intronic
1167773144 19:51534814-51534836 AAACTACACTATAGACCAAATGG - Intergenic
1168602977 19:57734869-57734891 AATCTGCACTATAGAACAAATGG + Intronic
925249339 2:2418466-2418488 AATCTTCACTATAGACCAAATGG - Intergenic
925269697 2:2594508-2594530 AATTTGCACTATAGACCAAATGG + Intergenic
925484005 2:4308083-4308105 AATCTGCACTACAGACCAAGTGG - Intergenic
926478896 2:13363412-13363434 AATGTGTACTGTAGAACAAATGG + Intergenic
926512237 2:13796304-13796326 AATCTACACTGTAGAACAAATGG - Intergenic
926609788 2:14935176-14935198 AATATGAAATATAGATCTAAGGG - Intergenic
926624558 2:15080302-15080324 AATCTGAACTGAAGAAGACAAGG + Intergenic
926638446 2:15208530-15208552 AATCGGTACTATGGATCAAATGG + Intronic
927080791 2:19628349-19628371 AATGTGCACTATAGAACAAATGG + Intergenic
927139913 2:20122855-20122877 AAGCTGAACTATGGAAGTAAAGG + Intergenic
927309530 2:21614525-21614547 AATCTGCACTATAGAACAAATGG - Intergenic
927348174 2:22071868-22071890 AATCTGCACTATAAACCAAATGG + Intergenic
927349804 2:22096568-22096590 AATTTGAACTGAAGAACATAAGG + Intergenic
927897515 2:26793414-26793436 AACCTTTACTAGAGAACAAAGGG - Intronic
928067314 2:28178123-28178145 AAACTGCACTTTAGACCAAATGG + Intronic
928459697 2:31458947-31458969 AATCTGCACTATAGACCAAATGG + Intergenic
928485986 2:31732153-31732175 AATCTGCACTACAGACTAAATGG + Intergenic
928495180 2:31824038-31824060 AATCTACACTATGGAACAAATGG - Intergenic
928535270 2:32233795-32233817 AATCTGCACTATACACCAAATGG - Intronic
928609668 2:32979692-32979714 AATCTACACAATAGACCAAATGG - Intronic
928663717 2:33529522-33529544 AATCTGAACTCTAGAAATAAAGG + Intronic
928783855 2:34857492-34857514 AATCTGCACTATAGACCAAATGG + Intergenic
928834455 2:35526845-35526867 AATCTGCACTATAGACCAAATGG - Intergenic
928843623 2:35641781-35641803 TATCTCAACTATAAAAAAAAGGG + Intergenic
928851746 2:35756510-35756532 GATCTGCACTATAGACCAAAGGG - Intergenic
928863711 2:35892670-35892692 AATCTGCATTATAGGCCAAATGG - Intergenic
928932754 2:36641303-36641325 AATCTGTACTATAGATCAAATGG + Intronic
929281397 2:40084235-40084257 AATCTGCACTACAGATTAAATGG - Intergenic
929348199 2:40913842-40913864 AAACTGAACCATAGACAAAATGG - Intergenic
929388387 2:41439465-41439487 AATCTTCACAATAGACCAAATGG - Intergenic
929541028 2:42821876-42821898 TATCTGCACTATAGACCTAATGG - Intergenic
929926284 2:46214154-46214176 AATCTGCACGATAGACCAGATGG - Intergenic
930141839 2:47958939-47958961 AACCTGCACTACAGACCAAAAGG + Intergenic
930288447 2:49464605-49464627 AATCTTCACTGTAGACCAAATGG - Intergenic
930294641 2:49539597-49539619 AATCTCCACTATAGACCAAATGG + Intergenic
930555629 2:52892443-52892465 ACACTGAACTCTAGATCAAATGG - Intergenic
930728031 2:54700071-54700093 AATCTGCACTATAGACCCAATGG + Intergenic
930778666 2:55200657-55200679 GATCTGCACTATAGACAAAATGG + Intronic
931406545 2:61984670-61984692 CATCTGCACTATAGACCAAATGG - Intronic
931457166 2:62419734-62419756 AATCTGCACTATAGGCCAAATGG + Intergenic
931521606 2:63103900-63103922 AAACTGGACTTTAGACCAAATGG - Intergenic
931568755 2:63645517-63645539 AATCTGCACTATAAACCAAATGG - Intronic
931736742 2:65201145-65201167 AATCTGCACTATCAACCAAATGG + Intergenic
931966358 2:67540150-67540172 AAACTTGACTCTAGAACAAATGG - Intergenic
931989899 2:67779525-67779547 AATCTGCACTATAGGCCAAATGG + Intergenic
932796417 2:74699847-74699869 AATGAGAACTAGAGAACATAGGG + Intergenic
932920798 2:75913050-75913072 AATCTGCAGTATAGAACTAATGG - Intergenic
932946344 2:76236585-76236607 AACCTGCACTCTAGACCAAATGG - Intergenic
933098137 2:78213849-78213871 AATCTTTACTATAGACCAAATGG + Intergenic
933317275 2:80730454-80730476 TAACTGCACTATAGACCAAATGG + Intergenic
933339249 2:81001048-81001070 AATATACACTATAGACCAAATGG - Intergenic
933388434 2:81640525-81640547 AATCTGTACTATATGCCAAATGG + Intergenic
933399826 2:81781312-81781334 AAACTGCACTCTAGACCAAATGG - Intergenic
933416461 2:81992776-81992798 AATTTGAACTATACATCAAGTGG + Intergenic
933433260 2:82212562-82212584 AATCTATACCCTAGAACAAATGG - Intergenic
933447244 2:82397649-82397671 GATGTGAACTATAGTACAAATGG - Intergenic
933450911 2:82450017-82450039 AATCTGCACTATAGACCAAATGG + Intergenic
933601262 2:84333356-84333378 AATCTGCACTATAGACCAAATGG + Intergenic
933617891 2:84502531-84502553 AATCTGCATTATAGAGCAAATGG - Intergenic
933852395 2:86380203-86380225 AAACTACACTATAGACCAAATGG - Intergenic
934905788 2:98201189-98201211 AATCTGATCTATAGACTTAAGGG - Intronic
935018595 2:99208458-99208480 AATCTGCACTATACACCAAATGG - Intronic
935356334 2:102204396-102204418 TATCTGCACTATAGACCAAATGG - Intronic
935439330 2:103073781-103073803 AATCTGCAGTATAGACCAAACGG + Intergenic
935478357 2:103554132-103554154 CATCTGCACTATAGGCCAAATGG - Intergenic
935532857 2:104256175-104256197 AATCTGCACTATATACCAAATGG + Intergenic
935576226 2:104713983-104714005 GTTCTGCACTATAGACCAAATGG - Intergenic
935688059 2:105702986-105703008 AATCTGTCCTATAGGCCAAATGG + Intergenic
935835519 2:107048333-107048355 AAGCTACCCTATAGAACAAATGG - Intergenic
936640694 2:114309199-114309221 AATTAGCACTATAGAGCAAATGG - Intergenic
936824899 2:116570274-116570296 AATCTGCACTGTAGGCCAAATGG - Intergenic
936832125 2:116659450-116659472 AAACTGCACTACAGATCAAATGG + Intergenic
936899987 2:117471854-117471876 AAACTATACTCTAGAACAAATGG - Intergenic
937136848 2:119560596-119560618 GGTCTGGACTATAGAGCAAAGGG - Intronic
937172549 2:119890029-119890051 AAACTGAACATTAGATCAAATGG - Intronic
937410892 2:121674023-121674045 AAACTATACCATAGAACAAATGG + Intergenic
937465430 2:122128598-122128620 AAACTGGACTTTAGACCAAATGG - Intergenic
937502918 2:122502514-122502536 AAGTTGAATTATAGAACAGATGG - Intergenic
937560839 2:123222253-123222275 AATCTGCATTATAGACCAAATGG + Intergenic
937604813 2:123786505-123786527 AATCATAACAATAGAATAAAGGG - Intergenic
937617870 2:123947426-123947448 AATCTTCACTATAGAATAAATGG + Intergenic
937628505 2:124070826-124070848 AATCTGCACTGTACAGCAAATGG + Intronic
937797007 2:126035681-126035703 AAACAGAACGACAGAACAAATGG - Intergenic
937805752 2:126142348-126142370 AATCTGCACTATGGATCAAATGG - Intergenic
938609209 2:132929859-132929881 AATCTGAAATATACAACAAAGGG - Intronic
939085428 2:137713058-137713080 AAACTGTACTCTAGACCAAATGG + Intergenic
939244548 2:139606988-139607010 AATCTGTACTATAGACCAAATGG - Intergenic
939273851 2:139973992-139974014 AATCTGCACTATTGAACAAATGG + Intergenic
939404905 2:141744498-141744520 AATCTGCACTGTAGACCAAATGG - Intronic
939838945 2:147164515-147164537 AAACTGCATTATAGACCAAATGG - Intergenic
939846994 2:147259325-147259347 GATTTGAACTATAGAGAAAAAGG + Intergenic
939913343 2:148009693-148009715 AATCTGCACTATAGATTAAATGG + Intronic
940395943 2:153192510-153192532 AAACTGCACTTTAGACCAAATGG - Intergenic
940429517 2:153572954-153572976 AATCTGCACTATTGACCAAATGG - Intergenic
940471130 2:154102157-154102179 AAACTGCACTTTAGACCAAATGG - Intronic
940547401 2:155105556-155105578 AATCTGCACTATAGAATAAATGG + Intergenic
940695787 2:156976520-156976542 AATCAATACTATAGACCAAAGGG - Intergenic
940706493 2:157110997-157111019 AAACTATACTCTAGAACAAATGG + Intergenic
940795695 2:158075250-158075272 AATCTGTACTGTAGAACAAATGG + Intronic
940923835 2:159341509-159341531 AATCTGCACCATAGACCAAATGG + Intronic
941234136 2:162947871-162947893 AATCTTTACTATAGGCCAAATGG + Intergenic
941302773 2:163824851-163824873 AATCTGCACTATAAAACAAATGG - Intergenic
941527984 2:166629422-166629444 AATCTGCACAATAGACCAAATGG - Intergenic
941749888 2:169123563-169123585 AAACTGGACTTTAGACCAAATGG + Intergenic
941780110 2:169434473-169434495 AATCTGCACTATAGACCAAATGG + Intergenic
942001241 2:171649723-171649745 AATCTGCACTATAGAGCAAATGG - Intergenic
942129351 2:172863046-172863068 AATCTGAAATATATTTCAAAAGG + Intronic
942391525 2:175499579-175499601 ATTCTGCACTATAGACCAAATGG - Intergenic
942391626 2:175501396-175501418 AGTCTGCACTGTAGACCAAATGG + Intergenic
942479397 2:176367752-176367774 AATTTGAACTATATTACAAAGGG + Intergenic
942597229 2:177602654-177602676 ACTCTGCACTACAGAACACATGG + Intergenic
942734446 2:179093848-179093870 AAAATGCACTATAGACCAAATGG - Intergenic
942750488 2:179281093-179281115 AATCAGCACTACAGACCAAATGG + Intergenic
942769400 2:179498184-179498206 AGTCTATACTATAGACCAAATGG + Intronic
942791469 2:179766100-179766122 GATCTGAGCTTTAGAACAACAGG - Intronic
942814042 2:180031026-180031048 AATCTGCACTCTAGAACAAATGG - Intergenic
942840621 2:180356828-180356850 AAACTACACTCTAGAACAAATGG - Intergenic
942863099 2:180639292-180639314 AATCTGCACCATAGACCCAATGG + Intergenic
942882269 2:180875215-180875237 AATATGCACTATAGACCAAATGG + Intergenic
943067475 2:183104312-183104334 AATCTGCACTGTAGACCAAATGG - Intergenic
943128161 2:183822749-183822771 AATCTGCACTACAGACCAAATGG + Intergenic
943216394 2:185042642-185042664 AAACTGAACATTAGACCAAATGG + Intergenic
943302904 2:186225729-186225751 AATCTGCACTATAGATCGAATGG + Intergenic
943331444 2:186564340-186564362 AATCTGCTCTATAGACCAAATGG + Intergenic
943427635 2:187756261-187756283 AATCTGTACTATAGATCAAATGG - Intergenic
943916772 2:193644809-193644831 AATCTGACCAATAAACCAAAGGG + Intergenic
944102178 2:196039006-196039028 AAACTGCACTGTAGACCAAATGG + Intronic
944751377 2:202714319-202714341 AATCTATACTATAAATCAAATGG - Intronic
945162070 2:206902307-206902329 AATGTGCACTACAGAACAAATGG - Intergenic
945334433 2:208575123-208575145 AATCTGCACTATAGACCAAATGG + Intronic
945521238 2:210830386-210830408 AAATTGGACTCTAGAACAAATGG - Intergenic
945573960 2:211506386-211506408 AAACTGGACTCTAGACCAAATGG + Intronic
945575923 2:211528485-211528507 AATCTGCTCTATACACCAAATGG + Intronic
945713695 2:213331565-213331587 AATCTGCACCATAGAACAAATGG + Intronic
945738636 2:213633537-213633559 AATCAGCACTATAGACCAAATGG - Intronic
945754209 2:213826753-213826775 AATCCATACTATAGAACAAATGG - Intronic
945824380 2:214702286-214702308 AATCTGCACTATAGACCAAATGG + Intergenic
946508816 2:220331996-220332018 AATCTGCACTATAGACCGAAGGG - Intergenic
946513769 2:220388801-220388823 AATCTGCGCTATAGACTAAATGG - Intergenic
946697640 2:222376403-222376425 AATCTACACTATAGACCAAATGG + Intergenic
946802097 2:223429147-223429169 AAACTGTACCCTAGAACAAACGG - Intergenic
947039493 2:225899914-225899936 AATCTGTACTGTAGAGAAAATGG + Intergenic
947130719 2:226921848-226921870 AATCTGCACTATAGACTAAATGG - Intronic
947209156 2:227690898-227690920 AATCTGCACTATAGAAAAAATGG + Intronic
947311950 2:228813587-228813609 AATCTGCACTATAGACAAAATGG - Intergenic
947439434 2:230105721-230105743 CATCTGCACTGTAGACCAAATGG - Intergenic
947449378 2:230192864-230192886 AAACTACACTCTAGAACAAATGG - Intronic
947460758 2:230302536-230302558 AAACTGTACACTAGAACAAATGG + Intronic
948475156 2:238213204-238213226 AATCTGCACTACAGACCAAATGG - Intergenic
1168744167 20:222099-222121 AGTCTGCACTATAAACCAAATGG + Intergenic
1168905072 20:1396703-1396725 AATCTGAACAACAGAGAAAAAGG - Intergenic
1169587295 20:7099569-7099591 AATCTGCACTATAGGCCAAATGG + Intergenic
1169617665 20:7468248-7468270 AATCTGCACTATAGACCAAGTGG - Intergenic
1169628949 20:7603631-7603653 AATCTGCAGTATAGAACAAATGG + Intergenic
1169987886 20:11467049-11467071 AATTTGTACTTTAGACCAAATGG - Intergenic
1170063005 20:12279253-12279275 AATCTGGACTATAGACCAAATGG + Intergenic
1170236330 20:14108892-14108914 AACCCGCACTATAGACCAAATGG + Intronic
1170241499 20:14171849-14171871 AATCTATACCTTAGAACAAATGG - Intronic
1170490437 20:16867440-16867462 AATCTGCAATATAGACCAAATGG + Intergenic
1170708927 20:18772026-18772048 AATCTGAACTATAGACCAAATGG - Intergenic
1171137167 20:22706301-22706323 AAACTGCACTATAGACCAAGTGG - Intergenic
1171254417 20:23678136-23678158 AAGTTGAACTCTAGAGCAAATGG - Intergenic
1171378432 20:24712665-24712687 AAACTATACCATAGAACAAATGG - Intergenic
1171509667 20:25671316-25671338 AAACTGCACTTTAGACCAAATGG - Intergenic
1172203503 20:33145308-33145330 AATCTGCACTATAGAACAAATGG - Intergenic
1172235758 20:33372695-33372717 TATCTGCAATAAAGAACAAAAGG + Exonic
1173099229 20:40068633-40068655 AATCTGCACTATAGACCCAATGG + Intergenic
1173127195 20:40348938-40348960 AATCTGCACTATAGACCAAATGG + Intergenic
1173203947 20:40976985-40977007 AATCTGTACAGTAGACCAAATGG - Intergenic
1173561680 20:44010586-44010608 CATCTGAACCACAGGACAAAGGG + Intronic
1173955134 20:47026187-47026209 AATATGAACTATTGAATGAATGG + Intronic
1174651768 20:52131847-52131869 AATCTGCACTATAGACTAAATGG + Intronic
1174691122 20:52506259-52506281 AATCTGCACTAGAGACCAAATGG + Intergenic
1174939112 20:54904561-54904583 AACCTGCACTATAGACCAAATGG + Intergenic
1174952447 20:55057221-55057243 AATTTGAACTATACAAAGAAAGG + Intergenic
1175617853 20:60417830-60417852 AAACTGCACTCTAGAACAAATGG - Intergenic
1176899596 21:14423415-14423437 AATCTGCACTATAGATCAAATGG + Intergenic
1177039329 21:16087395-16087417 TTTCTGAAGTATAAAACAAAGGG - Intergenic
1177105425 21:16949214-16949236 AATCTGCATGATAGACCAAATGG + Intergenic
1177121984 21:17149067-17149089 AATCTGCACTGTAAACCAAATGG + Intergenic
1177169884 21:17643336-17643358 AATATGCCCTAGAGAACAAAAGG + Intergenic
1177294936 21:19161873-19161895 AATCTGCATTATGGAGCAAATGG - Intergenic
1177373561 21:20238734-20238756 AATCTGCACTACAGACCCAACGG - Intergenic
1177456549 21:21346509-21346531 AATCTGCACTATAGATCTAATGG + Intronic
1177518642 21:22188180-22188202 ATTTTTAACTATAAAACAAAAGG + Intergenic
1177575143 21:22944602-22944624 AATCTACACAATAGACCAAATGG - Intergenic
1177584850 21:23077954-23077976 AATCAGAACAATTGAACTAATGG + Intergenic
1177652255 21:23972895-23972917 AATCTGCACTGTAGACCAAATGG - Intergenic
1177771581 21:25522242-25522264 AATCTGCACTATAGACCAAATGG + Intergenic
1177850240 21:26337543-26337565 AATCTGAATTATAGACCAAATGG + Intergenic
1177858176 21:26422678-26422700 AATCTTAACTATTGAACAGTTGG + Intergenic
1177933354 21:27313606-27313628 AAACTGTACTATAGACCAAATGG - Intergenic
1177951014 21:27537431-27537453 AAACTAAACTCTAGAAGAAATGG + Intergenic
1177964397 21:27709618-27709640 AATCTGCACTGTAGACCAAATGG - Intergenic
1178212039 21:30546441-30546463 AATCTGCACTGTAGACCAAATGG - Intronic
1178226750 21:30728271-30728293 AATCCTAACTATAGAAAAAGAGG + Intergenic
1179652788 21:42823908-42823930 AATCTCTGCTATAGACCAAATGG + Intergenic
1180034677 21:45239121-45239143 AATCTGCACTGTAGACCAAATGG + Intergenic
1180088302 21:45518306-45518328 AACCTGAACAAAAGAAAAAATGG + Intronic
1180570294 22:16710186-16710208 ATTCTGAACAATAGAAAAAGAGG + Intergenic
1181445204 22:22966759-22966781 AATCTGCACTATAGTCCAAATGG - Intergenic
1181448396 22:22998507-22998529 AATCTGGTCTACAGACCAAATGG + Intergenic
1182822590 22:33230885-33230907 AGTCTGAACTATAGATGACAAGG - Intronic
1183405511 22:37628776-37628798 AATCTGACCTAGAGAAGATAAGG - Intronic
1184071139 22:42147932-42147954 AATCTGCACTACAAAAGAAATGG + Intergenic
949225713 3:1692591-1692613 AAAGTGAACTTTAGACCAAATGG - Intergenic
949368519 3:3309158-3309180 AAGGTGAACTATAGGACACAAGG + Intergenic
949428509 3:3946067-3946089 AATCTGCACTATACACCAAATGG - Intronic
949622822 3:5834856-5834878 AATTTGTACTATGGACCAAATGG - Intergenic
950695257 3:14695505-14695527 AATCTATACTATAGACCAAATGG - Intronic
950960621 3:17102242-17102264 ACTCTATACGATAGAACAAATGG + Intergenic
950992373 3:17452791-17452813 AATCAGCAAAATAGAACAAATGG + Intronic
951028628 3:17857286-17857308 AATCTGCACTATTGACCAAATGG - Intronic
951124996 3:18973755-18973777 AATCTGCACTATAGACCACATGG - Intergenic
951171843 3:19551569-19551591 AATGTGTACTATAGACCAAATGG - Intergenic
951271287 3:20627792-20627814 AATCTGCACTATAGAAAAACTGG - Intergenic
951310016 3:21114168-21114190 AATCTGTACTATAGACCATATGG - Intergenic
951392703 3:22126695-22126717 AATCTGCTCCATAGACCAAATGG - Intronic
951398957 3:22206406-22206428 AATCTGCACTACAGACCAAATGG + Intronic
951404841 3:22283308-22283330 AAACTAAACCCTAGAACAAATGG + Intronic
951423389 3:22513925-22513947 AATCTGCACTATAAACCAAAAGG + Intergenic
951794277 3:26520999-26521021 AGTCTGCACTATAGACTAAATGG - Intergenic
951860674 3:27248867-27248889 AATCTGCACTGTAGACCAAATGG - Intronic
951929529 3:27949266-27949288 AATCTGCACTATAGACCAAATGG - Intergenic
952066184 3:29574073-29574095 AATCTGCAGTATAGAAAATATGG - Intronic
952132379 3:30380388-30380410 AATCTGCACTTTAGACCGAATGG - Intergenic
952517040 3:34115585-34115607 AATCTGCACTATAGGCCAAATGG - Intergenic
952567149 3:34672653-34672675 AATCTGAAGTGTAGAACAAATGG + Intergenic
952676631 3:36039040-36039062 AAACTGTACTCTAGATCAAATGG - Intergenic
952811387 3:37407078-37407100 CATCTGCACTATAGACCAAATGG - Intronic
953087582 3:39685874-39685896 AATCAGCACTATAGACCAAATGG + Intergenic
953195560 3:40729547-40729569 AAACTGTACCCTAGAACAAATGG - Intergenic
953217478 3:40933652-40933674 AATCTGCACTACATAACAAATGG + Intergenic
953229214 3:41049617-41049639 AATCTGCACTATAGATCAAATGG - Intergenic
953295757 3:41714223-41714245 AATCTGAAATTGAGCACAAAGGG + Intronic
953309169 3:41860239-41860261 AATCTTCACTATAGACAAAAAGG - Intronic
953822266 3:46217440-46217462 AAACTGTACCCTAGAACAAATGG + Intronic
954471828 3:50704286-50704308 AACCTGCACTATAGAACAAATGG - Intronic
955165291 3:56505128-56505150 TATCTGCACTATAAACCAAATGG + Intergenic
955446032 3:59010686-59010708 AAACTATACTCTAGAACAAATGG + Intronic
955584970 3:60467825-60467847 AATCTGCAGTACAGACCAAATGG - Intronic
956223247 3:66926490-66926512 AGTCTGTACTATAGAATAAATGG + Intergenic
956237213 3:67086696-67086718 GATCTGTGCTATAGACCAAATGG + Intergenic
956298585 3:67742957-67742979 AAACTGCACTATAGACAAAATGG - Intergenic
956377168 3:68626542-68626564 AAACTGTACCCTAGAACAAATGG - Intergenic
956550275 3:70450468-70450490 AATCTGCACTATAGACCAAATGG + Intergenic
957066785 3:75529745-75529767 AAGCTGCACTTTAGACCAAATGG + Intergenic
957108271 3:75919572-75919594 ATTCTGAACAATAGAAAAAGAGG - Intronic
957161264 3:76612268-76612290 AATCTGCGCTATAGACCCAATGG - Intronic
957166938 3:76686593-76686615 AATATGATCTTGAGAACAAATGG - Intronic
957175038 3:76797074-76797096 AATCTGCACTATAAATCAAATGG + Intronic
957267928 3:77991327-77991349 AATCTACATTATAGATCAAATGG - Intergenic
957287357 3:78233528-78233550 AATCTGCACTGTAGACCAAATGG + Intergenic
957369491 3:79274141-79274163 AATCTGTAGTATACATCAAAAGG + Intronic
957526295 3:81382670-81382692 AAACTGGACTTTAGACCAAAGGG + Intergenic
957622171 3:82607627-82607649 AACCTGCACTGTAGACCAAATGG + Intergenic
957889846 3:86342756-86342778 AATCTGAACCATAGAACAAATGG - Intergenic
957907386 3:86575483-86575505 AATCTACACTATAGAACAAATGG - Intergenic
957975882 3:87444551-87444573 AATCAGTACTGTAGACCAAATGG - Intergenic
958002622 3:87770730-87770752 AAATTGGACTTTAGAACAAATGG - Intergenic
958067923 3:88568626-88568648 AGCCTGCACTATAGACCAAACGG + Intergenic
958141440 3:89567609-89567631 AATCTGCACTATAGACCAAATGG + Intergenic
958509221 3:95023636-95023658 AAACTGGACTATAGACCAAATGG - Intergenic
958544665 3:95529214-95529236 ACTCTGATCTACAGAAGAAAAGG - Intergenic
958617797 3:96517721-96517743 AATTTGCATTATAGATCAAATGG + Intergenic
958631947 3:96696554-96696576 AATCTACACGATAGAACAAATGG - Intergenic
958682655 3:97352136-97352158 AATTTGAAAAACAGAACAAAAGG + Intronic
958715575 3:97775946-97775968 AAACTGAACTCTAGACCAAATGG - Intronic
958757480 3:98268139-98268161 AATCTGCACTATAGACCAAATGG - Intergenic
958765662 3:98364394-98364416 TAACTGCACTATAGATCAAATGG - Intergenic
958827107 3:99043564-99043586 AAACTGAACTTTAGACCAAATGG + Intergenic
958837739 3:99165816-99165838 AATCTGCACTAGAGATCCAATGG + Intergenic
958842245 3:99220860-99220882 AATCTGCACTATAGGAACAATGG + Intergenic
958847437 3:99281945-99281967 AATCTGCACTATACACCAAATGG + Intergenic
958865011 3:99489937-99489959 AATCTGCACCATAGACCAAATGG + Intergenic
959038323 3:101390728-101390750 AATCTACACTATTGATCAAATGG + Intronic
959042131 3:101433912-101433934 AATCCACACTATAGACCAAATGG + Intronic
959046138 3:101475967-101475989 TTTCTGCACTATAGACCAAATGG + Intronic
959127773 3:102311008-102311030 AATCTGCACAATAGAACAAATGG + Intronic
959189637 3:103095036-103095058 CATCTACACGATAGAACAAATGG - Intergenic
959259268 3:104053607-104053629 AATCTGCACTACAGACCAAATGG + Intergenic
959293507 3:104504633-104504655 AATCTAAACTATAGGCCAAATGG + Intergenic
959448033 3:106464673-106464695 AATCTGCACTATAGACCAAATGG - Intergenic
959459062 3:106601772-106601794 AAACTGCACCATAGACCAAATGG - Intergenic
959474610 3:106793721-106793743 ACTCTTCACTATAGAACAAATGG + Intergenic
959492594 3:107008354-107008376 AAACTGTACTTTAGACCAAATGG + Intergenic
959646003 3:108702073-108702095 AATCTGGACTATGGAACAAATGG - Intergenic
959717399 3:109447946-109447968 AATCTGCACTATAGACCAAATGG + Intergenic
959818758 3:110706748-110706770 AGCCTACACTATAGAACAAATGG - Intergenic
959846359 3:111038456-111038478 AAGCTGGACTTTAGATCAAATGG + Intergenic
960152386 3:114263428-114263450 AATCTGAAGTGCAGACCAAATGG - Intergenic
960214365 3:115012694-115012716 AATCTGTGCTATAGACCAAATGG + Intronic
960264304 3:115602740-115602762 TATCTGAACAATAAAATAAAGGG + Intergenic
960353757 3:116625836-116625858 AATCTGCATTATAAACCAAAGGG - Intronic
960471469 3:118071677-118071699 AATCTACACTATAGACCAAATGG - Intergenic
960495371 3:118367453-118367475 AATGTGAAATAAATAACAAAAGG - Intergenic
960607275 3:119519740-119519762 AAACTGTACTGTAGATCAAATGG + Intronic
960705688 3:120478539-120478561 AGTCGGAACTAAAGAACACAAGG + Intergenic
960752250 3:120968114-120968136 AAACTGAACTCTTGACCAAATGG - Intronic
960792286 3:121446444-121446466 AATCTGCACTGTAGACCAAATGG - Intronic
960870223 3:122240659-122240681 AATCTGCAGTATGAAACAAATGG + Intronic
961225611 3:125242758-125242780 AAGCTGAACTTTTCAACAAATGG - Intronic
961900403 3:130204656-130204678 AAGCTGCACTTTAGACCAAATGG + Intergenic
961964100 3:130884518-130884540 AATCTGCACTGTAGACCAAGTGG - Intronic
962078472 3:132111597-132111619 AATCTGCACTATAGACCAAATGG - Intronic
962584514 3:136828253-136828275 AATCTGCAATATAGAACAAATGG - Intronic
962598706 3:136973575-136973597 AAACTGGACTTTAGACCAAATGG - Intronic
962638573 3:137358644-137358666 AATCTGCTTTATATAACAAATGG - Intergenic
962641679 3:137393464-137393486 ATTCCGAACTATAGAAAAAGAGG - Intergenic
962644483 3:137422788-137422810 AAACTGTACTTTAGAACAAATGG + Intergenic
962688664 3:137871930-137871952 AATCTGCACTATAAACCAAATGG + Intergenic
962767984 3:138583432-138583454 AATCTGCACTATAGAACAAATGG + Intronic
962774459 3:138645923-138645945 AAACTGCACTTTAGACCAAATGG - Intergenic
962817206 3:139012189-139012211 AATCTCCACTATAGAATACATGG - Intronic
962861953 3:139412227-139412249 AATCTATACCCTAGAACAAATGG - Intergenic
962870669 3:139489074-139489096 AACCTGCACTATACACCAAATGG - Intergenic
963371077 3:144401025-144401047 AATCTACACTGTAGAACAAATGG - Intergenic
963430814 3:145199961-145199983 AAACTGCACTATAGACCAAATGG + Intergenic
963439456 3:145319236-145319258 AAACTGAACATTAGACCAAATGG - Intergenic
963448360 3:145443383-145443405 AATTTGCACTATTGATCAAATGG + Intergenic
963514849 3:146295649-146295671 AAGCAGTACTGTAGAACAAATGG - Intergenic
963528461 3:146444275-146444297 AATCTGCACTATAAACCAAATGG - Intronic
963546151 3:146661035-146661057 AAATTGGACTCTAGAACAAATGG + Intergenic
963701663 3:148633816-148633838 GATCTGCATTATAGACCAAATGG + Intergenic
963763041 3:149304614-149304636 AATCTGCACTATAGACCAAATGG - Intergenic
963802528 3:149690743-149690765 AATCTGCACTATACACCAAATGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
963996349 3:151714031-151714053 GATCTGCACTATAGATCAAATGG + Intergenic
964059326 3:152502499-152502521 AATCTGCACTACAGACCAAATGG - Intergenic
964208796 3:154205017-154205039 AATCTGCACTATAGACCAAATGG - Intronic
964239740 3:154577629-154577651 AATTTGCACTATAGATCAAATGG + Intergenic
964253960 3:154753129-154753151 AATCTTCCCTATAGATCAAATGG + Intergenic
964258592 3:154808160-154808182 AATCTGCACTATAAACCAAATGG - Intergenic
964266912 3:154908161-154908183 AATCTGCATTCTAGACCAAATGG + Intergenic
964350160 3:155795026-155795048 AATCTGCACGATAGACCAAATGG + Intronic
964603961 3:158538882-158538904 TGACTGAAATATAGAACAAAGGG + Intronic
964670500 3:159220055-159220077 AATCTGAGATATAGAAAGAATGG - Intronic
964687069 3:159407511-159407533 AATCTGCACTATAGACCAAATGG + Intronic
964804335 3:160590586-160590608 AATCTGCACTATAGACCAAATGG + Intergenic
964930441 3:162014710-162014732 ACTCTGAATTATCTAACAAATGG - Intergenic
964961288 3:162430202-162430224 AATCTGCACTATAGAAGAAATGG + Intergenic
964962907 3:162450196-162450218 ATTCTAAACAATAGAAAAAAAGG - Intergenic
964986610 3:162748964-162748986 AATCTGCACTATAGATCAAATGG - Intergenic
965014385 3:163138420-163138442 AATCTACACTGCAGAACAAATGG - Intergenic
965026421 3:163307006-163307028 AATCTGCACTATAGACCAAATGG + Intergenic
965047743 3:163600499-163600521 AATCTGCATTATAGACCAAATGG + Intergenic
965118083 3:164517304-164517326 AGTCTGCACTACAGACCAAATGG - Intergenic
965174942 3:165319417-165319439 AATCTGCACTATAGACCAAATGG - Intergenic
965209311 3:165764865-165764887 AATGTGCACTATAGGCCAAATGG - Intergenic
965318346 3:167219255-167219277 AATCTGCATTATACACCAAATGG + Intergenic
965322156 3:167263730-167263752 AATATGCACTATAGAACAACTGG - Intronic
965349074 3:167591419-167591441 ACTTTGCACTATAGAAGAAATGG - Intronic
965377617 3:167944979-167945001 AATCTGAACACTAAAATAAAAGG + Intergenic
965414920 3:168381375-168381397 AATCTGCAGTATAGAACAAATGG - Intergenic
965573450 3:170194048-170194070 AAACTACACTCTAGAACAAATGG + Intergenic
965923576 3:173950163-173950185 ACTTTAAACTATTGAACAAATGG + Intronic
966151514 3:176872285-176872307 AATCTGTACTGTAGACCAAATGG + Intergenic
966152108 3:176876481-176876503 AATCTTCACTATAGACCAAATGG - Intergenic
966312689 3:178612264-178612286 AATTTGCACTGTAGACCAAATGG - Intronic
966337782 3:178889137-178889159 AATCTGCACTATAGAGCAAATGG + Intergenic
966348832 3:179007898-179007920 AATCTGCCCCATAAAACAAATGG + Intergenic
966359300 3:179117523-179117545 AATCTGTACCGTAGACCAAATGG + Intergenic
966391916 3:179461830-179461852 AATCTTAAACATAGAACACAAGG + Intergenic
966463894 3:180207465-180207487 ATTCTGCACTATAGACCTAATGG + Intergenic
966470772 3:180286428-180286450 AATCTGAATTAAAGATCAAGAGG + Intergenic
967435058 3:189434281-189434303 AAACTGCACTCTAGAACAAATGG + Intergenic
967442240 3:189521778-189521800 AAATTAAACTTTAGAACAAATGG + Intergenic
967498132 3:190164624-190164646 AATCTGCACTATAAACCAAATGG - Intergenic
967505078 3:190244709-190244731 AAGGTGAACTATAAAACACAAGG - Intergenic
967551402 3:190800093-190800115 AATCTGCAATATAGACCAATTGG + Intergenic
967573392 3:191059434-191059456 AATCTGCACTATATAACAAATGG + Intergenic
967636854 3:191811853-191811875 AGTCTGAACTATAGAACAAGTGG + Intergenic
968004606 3:195232892-195232914 AATCTGCACCATAGACGAAATGG - Intronic
969011384 4:4065840-4065862 AAGCTGCACTTTAGACCAAATGG + Intergenic
969165439 4:5306218-5306240 AAACTGTACCCTAGAACAAATGG - Intronic
969742686 4:9044060-9044082 AAGCTGCACTTTAGACCAAATGG - Intergenic
970491168 4:16575431-16575453 AATCTGCACTAGAGACCAAATGG + Intronic
970582847 4:17489257-17489279 GATGTGATCTCTAGAACAAAAGG + Intronic
970771468 4:19617755-19617777 AAACTGCAATTTAGAACAAATGG + Intergenic
970805562 4:20026439-20026461 GATGTGGACAATAGAACAAAAGG - Intergenic
970821600 4:20222141-20222163 TATCTACACTATAGACCAAACGG - Intergenic
971061959 4:22981765-22981787 AAACTACACTCTAGAACAAATGG + Intergenic
971105183 4:23516850-23516872 AAGCTGCACTGTAGAACAAATGG - Intergenic
971567564 4:28165168-28165190 AATATGCAATATAGACCAAATGG - Intergenic
971592977 4:28492836-28492858 ATTCCGAACAATAGAAAAAAAGG + Intergenic
971611130 4:28728373-28728395 AAACTCAACTATAGACCAACTGG - Intergenic
971690613 4:29829956-29829978 AATCTGCACTATAGACCAAATGG + Intergenic
971914218 4:32847592-32847614 AATCTGCACTACAGATCAAATGG - Intergenic
972009681 4:34161405-34161427 AATCGTCACTGTAGAACAAATGG + Intergenic
972018509 4:34278260-34278282 GAACTGCACTCTAGAACAAATGG - Intergenic
972025232 4:34367626-34367648 AATCTGTAATATAGAAGACAGGG + Intergenic
972210103 4:36826032-36826054 AAACTGTATTCTAGAACAAATGG + Intergenic
972270518 4:37506793-37506815 TATCTGCATTATAGACCAAATGG - Intronic
972272092 4:37521699-37521721 ATTCTGCACTCTAGACCAAATGG - Intronic
972280470 4:37597255-37597277 AATATGACCTAGAGACCAAAAGG + Intronic
972468361 4:39380618-39380640 TATCTGCACTATAGACCAAATGG - Intergenic
972856809 4:43117076-43117098 AATCTGCACTATAGACCAAATGG + Intergenic
972868413 4:43263770-43263792 AATTTGCACTGTAGACCAAATGG - Intergenic
972884912 4:43473471-43473493 AATCTGCACTATAGGCCAAATGG - Intergenic
972909330 4:43795450-43795472 AATAAGAACTATAGGACAAAAGG + Intergenic
972915428 4:43871888-43871910 AATCTGCCCTATAGAGCAAAAGG - Intergenic
973025876 4:45269986-45270008 AAACTCTACTATAGACCAAATGG + Intergenic
973037305 4:45421959-45421981 AAACTAAACTCTAGAACAAATGG - Intergenic
973079141 4:45968015-45968037 AAACTGGACCATAGACCAAATGG - Intergenic
973287600 4:48436969-48436991 AATCTGCACTATAGACCAAATGG - Intergenic
973327139 4:48874573-48874595 AACCTGCACTATGGAACAAATGG - Intergenic
973596094 4:52491449-52491471 AAACTGGACTTTAGACCAAATGG + Intergenic
973763604 4:54143324-54143346 AAACTGCACTATAGAACAAATGG + Intronic
974167319 4:58220323-58220345 AATCTTCACTATAGACCAAATGG + Intergenic
974290927 4:59929145-59929167 TATCTGCACTAAAGAACAAATGG + Intergenic
974292538 4:59951197-59951219 AATCTGCACAACAAAACAAATGG + Intergenic
974333484 4:60509287-60509309 ACTCTACACTATAGATCAAATGG + Intergenic
974337360 4:60567158-60567180 AATCTGTACTGTAGACCAAATGG - Intergenic
974352617 4:60769798-60769820 AATTTGCATTATAGACCAAAAGG - Intergenic
974469919 4:62305390-62305412 AATCTGCACTACAGACCAAATGG + Intergenic
974589836 4:63931533-63931555 AAACTGAACATTAGACCAAATGG + Intergenic
974593558 4:63987117-63987139 AAACTGGACACTAGAACAAATGG + Intergenic
975028403 4:69581474-69581496 AAACTGATCTATACAAGAAAAGG + Intergenic
975276594 4:72508765-72508787 GATCTACACTATAGACCAAATGG + Intronic
975285741 4:72617462-72617484 AATCTACACTATTGACCAAATGG + Intergenic
975295464 4:72729438-72729460 AATTTGTACTATAGACAAAATGG + Intergenic
975312831 4:72922321-72922343 AATCTGCACTGTAGACCAAATGG - Intergenic
975375167 4:73635031-73635053 AAACTAAATTCTAGAACAAATGG + Intergenic
975630039 4:76391108-76391130 AATCTGTACTATAGACCAAATGG + Intronic
975674979 4:76818266-76818288 AATCTGCACTACAGATCAAATGG - Intergenic
975859534 4:78661868-78661890 AATCGGAATTAAAGAACTAATGG + Intergenic
975918230 4:79350133-79350155 AATCTGCACTGTAGACCAAATGG - Intergenic
976082534 4:81372125-81372147 AATCTGCACTATAGACCAAATGG - Intergenic
976253939 4:83081620-83081642 AATCTGCACAATAGACCAAATGG - Intergenic
976885817 4:89982804-89982826 AATCTGAACTAGATGTCAAAAGG + Intergenic
976954007 4:90871677-90871699 AATCTGGACTATAGACCAAATGG - Intronic
977102847 4:92839832-92839854 AATCTGTACGATAGACCAAATGG - Intronic
977185816 4:93934334-93934356 CATCTGAACTATAGACCAAATGG + Intergenic
977219190 4:94319047-94319069 AATCTGCGCTAGAGACCAAATGG - Intronic
977307710 4:95345483-95345505 AATCTAAACTATGGACCAAATGG + Intronic
977325374 4:95568981-95569003 AATCTGCATTACAGAAGAAATGG - Intergenic
977341744 4:95767057-95767079 TATCTGCACTGTAGACCAAATGG + Intergenic
977396802 4:96481223-96481245 AATCTGCACTATAGAAAAAATGG - Intergenic
977398090 4:96496804-96496826 AATCTTCATTATAGACCAAAAGG + Intergenic
977399428 4:96512850-96512872 AATCTTCACTATAGACCAAATGG + Intergenic
977521953 4:98095796-98095818 AATCTGCACTATAGAACAAGTGG + Intronic
977773384 4:100886834-100886856 AATCTGCAATATAGACCAAATGG - Intergenic
977830140 4:101580643-101580665 AAACTGCACTATAGACCAAATGG - Intronic
977841900 4:101717131-101717153 AAACTGCACCATAGAAAAAATGG + Intronic
977873329 4:102120280-102120302 AATCTGCACCATAGACTAAATGG - Intergenic
977985921 4:103383021-103383043 AATCTGAACTATAGACCAAATGG + Intergenic
978027795 4:103899136-103899158 AAACTGCACTCTAGAACAAATGG + Intergenic
978032696 4:103954855-103954877 AATCTGCACTATAGACCAAATGG + Intergenic
978047015 4:104142543-104142565 TATCTACACTATAGACCAAATGG - Intergenic
978059007 4:104312566-104312588 AATCTGCACTATAAACCAAATGG + Intergenic
978112682 4:104981593-104981615 AATCTGCACTATACACCAAATGG + Intergenic
978116792 4:105028512-105028534 AATCTGAACTGTAGACCAAATGG + Intergenic
978212374 4:106153579-106153601 AACCTGCATTATAGACCAAATGG - Intronic
978214276 4:106179753-106179775 AAACTGTACTGTAGACCAAATGG - Intronic
978410927 4:108424529-108424551 AATCTGAACAACAAAATAAACGG + Intergenic
978446134 4:108781731-108781753 GATTTTAACTATAGAATAAATGG - Intergenic
978519984 4:109605542-109605564 AATCTGCACTATGGACCAAATGG - Intronic
978654995 4:111054534-111054556 AATCTGCACTATAGACCAAATGG + Intergenic
978665166 4:111173555-111173577 ACTCTGAACTAATGAACTAAAGG - Intergenic
978703171 4:111673892-111673914 ATTGTGAACTATATAACACATGG + Intergenic
978762050 4:112363677-112363699 GATTTAAACTATACAACAAATGG + Intronic
978934309 4:114356400-114356422 AATCTGCACTTTAGATCAAACGG - Intergenic
979111658 4:116764785-116764807 AATCTCTCCTATAGACCAAATGG + Intergenic
979599184 4:122568731-122568753 AATCTGCACTATAGATCAAATGG - Intergenic
979757189 4:124355753-124355775 AATCTGCACTATAGACAAAATGG + Intergenic
979879211 4:125933134-125933156 AATCTGCACTATAGACCAAATGG + Intergenic
979912979 4:126393996-126394018 AATCTGTACTCTAGACCAAATGG - Intergenic
980151939 4:129058723-129058745 GATTTAAACTATAGACCAAATGG - Intronic
980268727 4:130555299-130555321 AATCTGCACCATAGACCAAATGG + Intergenic
980284362 4:130763110-130763132 AAATTGAACAATAGAACACATGG + Intergenic
980300485 4:130985197-130985219 AACCTGACTTATAGCACAAATGG - Intergenic
980339294 4:131522299-131522321 AATCTGCACTATAGACTACATGG - Intergenic
980403774 4:132329165-132329187 ATTCCGAACTATTAAACAAATGG + Intergenic
980413244 4:132450202-132450224 AATCTGCACTATAGACCAAATGG + Intergenic
980712975 4:136594364-136594386 AATCTTCACTATAGACCAAGTGG + Intergenic
980850225 4:138372807-138372829 AATCTGCACCACAGACCAAATGG + Intergenic
980864033 4:138532805-138532827 AAACTGTGCTATAGACCAAATGG + Intergenic
981139338 4:141250504-141250526 AAACTGCACTCTAGAACAAATGG - Intergenic
981177486 4:141699342-141699364 AAGCTATACCATAGAACAAATGG - Intronic
981203510 4:142012298-142012320 AATCTGCACTATCAACCAAATGG - Intergenic
981328590 4:143481936-143481958 AATATGAACTAGATAATAAATGG + Intergenic
981329476 4:143491356-143491378 AATCTGCACTGTAGACCAAATGG + Intergenic
981444031 4:144814066-144814088 AAACTGCACTTTAGACCAAATGG + Intergenic
981454240 4:144934923-144934945 AATCTGCACTATAGATGAAATGG - Intergenic
981517987 4:145631162-145631184 AATCTGCACTACAGACCAAATGG - Intronic
981530494 4:145748881-145748903 AATCTGCACTATTGACCAAATGG - Intronic
981558337 4:146020104-146020126 TATCTGCACTATAGACCAAATGG - Intergenic
981591164 4:146363482-146363504 AATCTGCACTATAGACCAAATGG + Intronic
981837215 4:149068027-149068049 AATCTGTACCATAGATCAAAGGG + Intergenic
981884873 4:149662428-149662450 AAACTGCACTATAGACCAAATGG - Intergenic
981975857 4:150727015-150727037 CATCTGTACTACAGAACAAGTGG + Intronic
982683040 4:158455653-158455675 AATCTGCACTATAGAACCAATGG - Intronic
982718341 4:158832408-158832430 AATCAAAAATAAAGAACAAAAGG + Intronic
982891231 4:160853518-160853540 CATCTGAAGTATAGAGAAAAAGG + Intergenic
982898936 4:160972995-160973017 AATATGCAATATAGATCAAATGG + Intergenic
982976307 4:162066634-162066656 AAGTTGAACAATAGAACACATGG - Intronic
983017481 4:162631377-162631399 AATCTGCACTGTAGACTAAATGG + Intergenic
983138647 4:164120461-164120483 AATCTGCACTATAGACTAAATGG + Intronic
983164209 4:164454629-164454651 TAACTGCACTATAGACCAAATGG + Intergenic
983165699 4:164474753-164474775 AATCTGCACCATACAGCAAATGG - Intergenic
983458456 4:167995759-167995781 AATCTATACTATAGACCAAATGG - Intergenic
983579849 4:169297661-169297683 AATCTTCAGTATAGACCAAATGG + Intergenic
983593933 4:169444730-169444752 AAACTGCACTTTAGACCAAATGG + Intronic
983658172 4:170103957-170103979 AATCTGTACTATAGACCAAATGG + Intergenic
983683741 4:170382973-170382995 AATCTGCACTATAAACCAAATGG - Intergenic
983749680 4:171250837-171250859 AAACTGTACCCTAGAACAAATGG - Intergenic
983845378 4:172511951-172511973 AAACTGTACCCTAGAACAAATGG - Intronic
984020400 4:174478187-174478209 AAACTATACTCTAGAACAAATGG + Intergenic
984068480 4:175081340-175081362 AATCTGCACTATAGACCAAATGG - Intergenic
984069956 4:175097931-175097953 GATCTGCACTTTAGAACAAATGG + Intergenic
984178767 4:176454212-176454234 AAACTGGACTCTAGACCAAATGG + Intergenic
984310309 4:178049760-178049782 AATCTGCACTATAGACCAAATGG - Intergenic
984434699 4:179694582-179694604 AATCTAAACTAAAGCACAGATGG + Intergenic
984529420 4:180898434-180898456 AATCTGCACTATGGAACAAATGG - Intergenic
984627903 4:182028957-182028979 AATCTGCACTATAGACTAAATGG - Intergenic
984915713 4:184721874-184721896 AATCTGCACTGTAGACCAAATGG + Intronic
985229853 4:187802974-187802996 AATCTGCACTATCAAATAAATGG + Intergenic
985919110 5:2954423-2954445 AAGCGGCACTATATAACAAATGG - Intergenic
986096870 5:4565639-4565661 AATCTGCTCTATAGACCAAATGG + Intergenic
986657309 5:10027754-10027776 ACTCTGCATTATAGATCAAATGG - Intergenic
986884989 5:12223167-12223189 AATCTGCACTACAGATCAAATGG - Intergenic
986899102 5:12410035-12410057 AAACTGCACTATGGACCAAATGG - Intergenic
986915907 5:12620563-12620585 AAACTTCACTGTAGAACAAATGG - Intergenic
986947418 5:13040588-13040610 AATCTGCACTATAGACCAAATGG + Intergenic
987164229 5:15177188-15177210 AATGTGCACTATAGACCAAATGG + Intergenic
987167144 5:15212072-15212094 AAACTGCACTTTAGACCAAATGG + Intergenic
987175080 5:15299662-15299684 AAGCCTAACTATAGGACAAATGG - Intergenic
987377918 5:17254033-17254055 AAACTCAAGTATAGTACAAATGG - Intronic
987496336 5:18650017-18650039 AATCTGCACTATAGAAAAAATGG - Intergenic
987631741 5:20481442-20481464 AATCAGCACTATAGAAAAAATGG + Intronic
987823372 5:22994750-22994772 AATGTGCATTATAGACCAAACGG - Intergenic
987870584 5:23612072-23612094 AATCTGTGCTATAGAACAAATGG - Intergenic
987895467 5:23940963-23940985 AATCTGCAATATAGACCAAATGG - Intergenic
987916685 5:24224292-24224314 AAACTGCACTCTAGAACAAATGG - Intergenic
987951708 5:24685188-24685210 AATCTGCATTATAGACCAAATGG + Intergenic
988083063 5:26437362-26437384 AATGTGCACTATAGACCAAATGG + Intergenic
988091365 5:26544614-26544636 GGTCTGAGCTATAGCACAAAAGG + Intergenic
988118150 5:26923552-26923574 AATCTGTACTGTAAACCAAATGG + Intronic
988153748 5:27421980-27422002 AGTCTGTACTGTAGACCAAATGG - Intergenic
988338661 5:29940138-29940160 AATCAGAACTATACAAAGAAGGG - Intergenic
988353808 5:30146334-30146356 AATTTGCACTATTGATCAAATGG - Intergenic
988608037 5:32698489-32698511 AACCTGCATTATAGACCAAATGG - Intronic
988955989 5:36320125-36320147 ACTCTGCACTATAGACCAAATGG - Intergenic
989074569 5:37550487-37550509 AATCTGCACTGCAGACCAAATGG - Intronic
989083005 5:37645487-37645509 AATCTGCACTATAGACCAAAAGG - Intronic
989211803 5:38863671-38863693 AAACTGCACTTTAGACCAAATGG - Intronic
989215197 5:38898114-38898136 AATCTGCACTATAGAACAAATGG - Intronic
989428085 5:41319238-41319260 AATCTGCAGTATAGACCAAATGG + Intronic
989504572 5:42212610-42212632 AATCTCCACTAAAGACCAAAGGG - Intergenic
989689391 5:44122339-44122361 AAACTGTACCCTAGAACAAATGG - Intergenic
989974572 5:50568720-50568742 AATCTGCATTATAGAACAAATGG + Intergenic
989998159 5:50860346-50860368 GAACTGAAAGATAGAACAAAAGG - Intergenic
990578184 5:57143820-57143842 AATCTGCACTATTGACCAAATGG - Intergenic
990593211 5:57286885-57286907 AATCTGCACTACAGACCACATGG + Intergenic
990900304 5:60742798-60742820 AATCTGCCCTACAGAACAAAGGG + Intergenic
990907242 5:60817531-60817553 AATATCAACTATAAAACAAATGG + Intronic
990932678 5:61111327-61111349 AATCTGCACTACAGACCAAATGG - Intronic
991028479 5:62056987-62057009 AATCTGCACTATAGACCAAATGG - Intergenic
991120393 5:63007138-63007160 AAACTGTACTCTAGATCAAATGG - Intergenic
991180330 5:63743908-63743930 AATCTGCACTACAGGCCAAATGG - Intergenic
991623197 5:68567798-68567820 AAACTATACTCTAGAACAAATGG + Intergenic
991672350 5:69061087-69061109 AATCTGTGCTATAGACCAAATGG - Intergenic
992276159 5:75121435-75121457 AAATTGAACTTTAGACCAAATGG + Intronic
992309807 5:75484847-75484869 AATCTATACTATAGACCAAATGG + Intronic
992471755 5:77063994-77064016 AATCTGATTTCTAGTACAAAAGG + Exonic
992602438 5:78416174-78416196 AAAATGAACAATAGAAAAAAGGG - Intronic
992699442 5:79327001-79327023 AAGCTGCACTAAAGAGCAAAAGG - Exonic
992781563 5:80132763-80132785 AATCTGAAAGAAAGAACTAAGGG - Intronic
992934766 5:81690699-81690721 AATCTTCACTATAGGCCAAATGG + Intronic
992945572 5:81805613-81805635 AAGCTGCACCATAGACCAAATGG + Intergenic
993197017 5:84762235-84762257 AATCTGCACTACAGACCAAATGG - Intergenic
993206813 5:84892413-84892435 AATTTGCCCTATAGAACAAATGG - Intergenic
993266845 5:85737357-85737379 AATCTAAACAATTGAACACATGG - Intergenic
993268973 5:85768608-85768630 AATCGGCACTACAGACCAAATGG - Intergenic
993436550 5:87902560-87902582 ATTCAGAACTATAAAACATATGG - Intergenic
993450245 5:88064418-88064440 AAACTGGACTTTAGACCAAATGG + Intergenic
993473771 5:88338915-88338937 AATGTGCACTATAGGCCAAATGG + Intergenic
993981588 5:94549059-94549081 AATCTGCACTATAGAACAAATGG + Intronic
994028978 5:95119012-95119034 AATCTGCACTACAGAACACATGG + Intronic
994133036 5:96252808-96252830 GATCTGAACTATTGATAAAATGG + Intergenic
994226481 5:97257235-97257257 AATCTGCACTATAGATCAAATGG + Intergenic
994309816 5:98256359-98256381 AATATGCACTATAAACCAAATGG - Intergenic
994344365 5:98667425-98667447 CATCTGCATTATAGAACAAATGG + Intergenic
994347425 5:98703142-98703164 AAACTGTACCCTAGAACAAATGG + Intergenic
994391966 5:99200536-99200558 ATTCTGAACAATAACACAAAGGG + Intergenic
994392576 5:99204464-99204486 ATTCTGAACAATATCACAAAGGG + Intergenic
994428440 5:99625006-99625028 AATCTGCACAATAGACCAAATGG - Intergenic
994497075 5:100526460-100526482 AAATTGCACTCTAGAACAAATGG + Intergenic
994526352 5:100910033-100910055 AACCTGGACTATATAACTAAAGG - Intergenic
994596937 5:101850933-101850955 AATCTGCGCTGTAGACCAAATGG - Intergenic
994628045 5:102245669-102245691 AATCTGTACTATAGACCAAATGG + Intronic
994633630 5:102317483-102317505 AATCTGCACTATAGACCATATGG - Intergenic
994654141 5:102568562-102568584 AATCTGCAGTATAGACCAAGTGG - Intergenic
994660250 5:102644721-102644743 AATTTGCACTACAGAACAAATGG + Intergenic
994803672 5:104414847-104414869 AAACTGGACTATAGACCAAATGG + Intergenic
994854060 5:105093977-105093999 AATCTGCACTATAGATCAAATGG + Intergenic
994892233 5:105650582-105650604 AAACTAAACTTTAGACCAAATGG + Intergenic
994893307 5:105667743-105667765 AATCTGTACTATAGACCTAATGG - Intergenic
995049907 5:107690914-107690936 AATCTGTACTACATATCAAATGG + Intergenic
995099481 5:108281146-108281168 AAACTGGACTTTAGACCAAATGG + Intronic
995115637 5:108475357-108475379 AAACTGCACTCTAGAACAAATGG + Intergenic
995187243 5:109284682-109284704 AAACTACACTCTAGAACAAATGG + Intergenic
995262449 5:110121122-110121144 AATCTTCACTATAGACTAAATGG - Intergenic
995265598 5:110155756-110155778 AATCTGCACTATTGGACAAATGG + Intergenic
995271938 5:110230221-110230243 AAACTGGACATTAGAACAAATGG + Intergenic
995278311 5:110304320-110304342 AATCTCCACTATAGACCAAAAGG - Intronic
995310871 5:110709360-110709382 AATTAGCACTATAGGACAAATGG + Intronic
995339756 5:111044832-111044854 ATTCAGAACCATAGAACAATAGG - Intergenic
995557867 5:113348191-113348213 AATCTGCATAATAGAACAAATGG + Intronic
995572880 5:113499937-113499959 AATCTGCAGTATAGACCAAATGG - Intergenic
995770924 5:115668533-115668555 AATCTGCACTATAAACCAAAAGG + Intergenic
995777715 5:115743030-115743052 AATCTTCACTATAGACCAAATGG - Intergenic
995816052 5:116169445-116169467 ATTCTGAACAATAGAAAAAGAGG + Intronic
995944758 5:117630950-117630972 AATCTGAACTATAGACCACATGG - Intergenic
996042110 5:118826713-118826735 ATTCTGAATAATAAAACAAATGG - Intergenic
996133089 5:119806242-119806264 AATCTACACTACAGAACAAATGG - Intergenic
996459791 5:123728332-123728354 AATCGGTACTATAGAACAAATGG + Intergenic
996470035 5:123849681-123849703 AAACTGTACTCTAGACCAAATGG - Intergenic
996653394 5:125910609-125910631 AATCTGCACTCTAGGCCAAATGG - Intergenic
996789445 5:127277050-127277072 TATCTGAAGTATAGAGCAAGAGG + Intergenic
996789446 5:127277082-127277104 TATCTGAAGTATAGAGCAAGAGG + Intergenic
996906196 5:128603570-128603592 AACCTGCACTATAGACCAAATGG - Intronic
996927810 5:128849045-128849067 AATCTGCGCTATAGACCAAATGG + Intronic
996931400 5:128893384-128893406 AATATGCACTATAGGCCAAATGG - Intronic
997060154 5:130491400-130491422 AATCTGCACAATAAACCAAATGG + Intergenic
997068612 5:130592745-130592767 AATCTGCACTATAGAGCAAGTGG + Intergenic
997105182 5:131010066-131010088 AATCTGCACTATAGACCAAATGG + Intergenic
997180304 5:131821509-131821531 AATCTGCACTGTAGAACAAATGG - Intronic
997184016 5:131863306-131863328 AAACTGGACTTTAGACCAAATGG - Intronic
997901243 5:137767075-137767097 AATCTGCACTACAGACCAAATGG - Intergenic
997928455 5:138052602-138052624 AATCTGAATTATATAATAAAAGG - Intergenic
998276217 5:140755801-140755823 AAACTGCACTGTAGACCAAATGG - Intergenic
998492135 5:142556388-142556410 ACTCTGAACATTAGAACAAGAGG + Intergenic
998634324 5:143935724-143935746 AATCTGTACTATAGACTAAATGG + Intergenic
998695547 5:144634384-144634406 AATCTGCACTGTAGACCAAGTGG + Intergenic
998717002 5:144895696-144895718 AATCTGCACCATAGACCAAAGGG + Intergenic
998924625 5:147108361-147108383 GATATGATCTATAGAAAAAATGG + Intergenic
999849333 5:155521624-155521646 AATCTGCATTATAGACCAAATGG - Intergenic
999919273 5:156300625-156300647 AAACTGAACTGTATATCAAATGG - Intronic
999946611 5:156603908-156603930 AAACTGTACCATAGACCAAATGG - Intronic
1000392217 5:160735622-160735644 AATTTGCATTATAGACCAAATGG + Intronic
1001306797 5:170580630-170580652 ACTCAGAACTATATAACATAAGG + Intronic
1001364790 5:171125646-171125668 GATCTGCACTGTAGACCAAATGG + Intronic
1002551718 5:179998718-179998740 AAACTGCACTTTAGACCAAATGG - Intronic
1002630169 5:180568722-180568744 AATGTGAAGTATAGAAAAAATGG + Intronic
1002646143 5:180656617-180656639 AATCTATACTCTAGACCAAATGG - Intergenic
1002959628 6:1902267-1902289 AAACTAAAATATAGAATAAAAGG + Intronic
1003219901 6:4151047-4151069 CATCTGCACTATAGACCAAATGG - Intergenic
1003437711 6:6108424-6108446 AATCTGCACTATAGACCAAAGGG - Intergenic
1004782525 6:18926566-18926588 AATCTGCATTATAGATTAAATGG - Intergenic
1005037078 6:21566249-21566271 AATCCGCACTACAGATCAAATGG - Intergenic
1005159256 6:22839454-22839476 AAACTGAACTTTAGACCAAATGG + Intergenic
1005262542 6:24077123-24077145 AAACTGCACTCTAGAGCAAATGG - Intergenic
1005395142 6:25374537-25374559 AAACTATACTCTAGAACAAATGG - Intronic
1005435373 6:25805011-25805033 AAACTACACTTTAGAACAAATGG + Intronic
1005454036 6:26001556-26001578 AATCAGATTTATAGAAGAAAGGG + Intergenic
1005528294 6:26674522-26674544 AATCTGAACTATAGAGAGAAAGG + Intergenic
1005529063 6:26683647-26683669 AATCTGACCTATAGAAAGAAAGG + Intergenic
1005531072 6:26706548-26706570 AATCTGAGCTATAGAGAGAAAGG + Intergenic
1005531796 6:26714856-26714878 AACCTGAACAATAGAGAAAAAGG + Intergenic
1005538999 6:26786809-26786831 AACCTGAACAATAGAGAAAAAGG - Intergenic
1005539724 6:26795088-26795110 AATCTGAGCTATAGAGAGAAAGG - Intergenic
1005541733 6:26817999-26818021 AATCTGACCTATAGAAAGAAAGG - Intergenic
1005542501 6:26827117-26827139 AATCTGAACTATAGAGAGAAAGG - Intergenic
1005593317 6:27350935-27350957 AATCTGCACTACAGACCAAATGG + Intergenic
1005787667 6:29263028-29263050 AAAATGAACTATAGAATAAGGGG - Intergenic
1005908007 6:30282654-30282676 AATCTGCACTGTAGATCAAATGG - Intergenic
1007952278 6:45883108-45883130 ATTCTTACCTGTAGAACAAAGGG + Intergenic
1008018065 6:46543434-46543456 AATCTGCACTATAGACCAAATGG + Intergenic
1008100784 6:47388723-47388745 AATTTGCACTGTAGATCAAATGG - Intergenic
1008215346 6:48781507-48781529 AATCTGCACTACAGACCAAATGG + Intergenic
1008250063 6:49228845-49228867 AATCTGCACTATAGACCAAATGG - Intergenic
1008304304 6:49882980-49883002 AATCTGCACTATAGACCAAATGG - Intergenic
1008312470 6:49993070-49993092 AATCTGCACTATAGACCAAATGG + Intergenic
1008672294 6:53782402-53782424 AAACTGCACCATAGATCAAATGG + Intergenic
1008727288 6:54438027-54438049 AATCTGCACTTCAGAACAAAAGG - Intergenic
1008822180 6:55646899-55646921 AATCTACACTACAGAACAAATGG - Intergenic
1008847908 6:55990766-55990788 AACCTGCACTATAGCCCAAATGG - Intergenic
1008882098 6:56390947-56390969 AATCTGCACTATGGACCAAATGG + Intronic
1009010543 6:57837230-57837252 AATCTGAGCTATAGAGAGAAAGG - Intergenic
1009012541 6:57860056-57860078 AATCTGACCTATAGAAAGAAAGG - Intergenic
1009013311 6:57869235-57869257 AATCTGAACTATAGAGAGAAAGG - Intergenic
1009269352 6:61598793-61598815 ATTCTAAACTCTAGAATAAAGGG + Intergenic
1009309840 6:62135911-62135933 AATGGGAAATATAGATCAAAGGG + Intronic
1009329484 6:62398655-62398677 ACTCTGCACTATAAACCAAATGG - Intergenic
1009352890 6:62704828-62704850 AATGTGCACTATAGACCAAATGG - Intergenic
1009408633 6:63339187-63339209 AATCTGCATTATAGACCAAATGG - Intergenic
1009627380 6:66152764-66152786 AATCTGCACTATGGACCAAATGG + Intergenic
1009710520 6:67311976-67311998 AAACTGCACTCTAGAACAAATGG - Intergenic
1009748364 6:67849651-67849673 AATCTGCACTATGGACCTAATGG + Intergenic
1009802080 6:68551524-68551546 AATCTGCACTATAGACTAAATGG + Intergenic
1010017191 6:71118971-71118993 AAACTGTACCCTAGAACAAATGG - Intergenic
1010130196 6:72483323-72483345 AATCAAAACGATTGAACAAATGG + Intergenic
1010182176 6:73099807-73099829 AATCTGCACAATAGACCAAATGG + Intronic
1010264099 6:73848564-73848586 AAGCTGTACTAGAAAACAAATGG - Intergenic
1010314089 6:74424644-74424666 AATCTGCACTATAGACCAACTGG + Intergenic
1010333279 6:74649361-74649383 AATCTGCCCGATAGACCAAATGG + Intergenic
1010376851 6:75180841-75180863 ATTCTGAACTATAAAGCAGATGG + Intronic
1010482047 6:76367310-76367332 AATCTGCACTATGGGCCAAATGG - Intergenic
1010485742 6:76411196-76411218 AAGCTGCACTCTAGACCAAATGG - Intergenic
1010544453 6:77133221-77133243 ATTCTGAACTACAGTGCAAACGG + Intergenic
1010546235 6:77159861-77159883 AATCTGCACTATAGAACAAATGG - Intergenic
1010559975 6:77337315-77337337 AATCTTCACTATAAAAGAAATGG - Intergenic
1010626523 6:78142591-78142613 AATCTGCACTCTAGACCAAATGG + Intergenic
1010629904 6:78186789-78186811 AATCTGAACTATAGAATAAATGG - Intergenic
1010638739 6:78294696-78294718 AATTTGTACTAGAGACCAAATGG + Intergenic
1010644941 6:78375649-78375671 AATCAGCACTATAGATCAAGTGG + Intergenic
1010647668 6:78411600-78411622 AATCTGCACTTTAGGCCAAATGG + Intergenic
1010772750 6:79850620-79850642 AATCTGCACTATAGAATAAATGG + Intergenic
1011102660 6:83741232-83741254 AATCTGCACTATAGAACAAATGG - Intergenic
1011225861 6:85106018-85106040 AATCTACACTTTACAACAAAAGG - Intergenic
1011232326 6:85176657-85176679 AATCTGCACTATAGACCAGATGG - Intergenic
1011365831 6:86581591-86581613 AAACTATACTCTAGAACAAATGG - Intergenic
1011404415 6:87002951-87002973 AATCTGCACTATAGACCAAATGG + Intronic
1011404708 6:87006862-87006884 TAGCTGAACAATAGAACACATGG + Intronic
1011914374 6:92485331-92485353 AATCTGCACTATAGACCAAATGG - Intergenic
1012199727 6:96391038-96391060 ACTCAGAAATAAAGAACAAAAGG + Intergenic
1012201392 6:96410842-96410864 AATATGAAATATAAAACAATAGG + Intergenic
1012297602 6:97544887-97544909 AATCTGCACTATAGATCAAATGG - Intergenic
1012504087 6:99924913-99924935 AATGTGCACTGTAGACCAAATGG - Intronic
1012600382 6:101089693-101089715 AAACTGGACTTTAGAGCAAAAGG - Intergenic
1012679199 6:102157048-102157070 AATCTGTACTCTAGACCAAATGG + Intergenic
1012690356 6:102303098-102303120 AATCTAAAATATAGAAAAAATGG + Intergenic
1012715525 6:102664029-102664051 AATCTCCACCATAGACCAAATGG + Intergenic
1012892507 6:104912470-104912492 AATCTTCACTATAGACCAAATGG + Intergenic
1012940762 6:105412671-105412693 CATCTGAACTATAAAACAAATGG + Intergenic
1013568714 6:111397622-111397644 AAACTGCACTTTAGACCAAATGG - Intronic
1013720267 6:113017640-113017662 AAGCTGAACCATGGAATAAAAGG + Intergenic
1013908794 6:115249591-115249613 AATCTGTACTATAGACCAAATGG + Intergenic
1013913371 6:115305464-115305486 AATCTGCACTACAAACCAAAGGG - Intergenic
1014093327 6:117430757-117430779 AATCTGCAATATAGATCAAATGG - Intronic
1014118709 6:117697786-117697808 AATCTGCACTGTAGACCAAATGG + Intronic
1014186627 6:118442244-118442266 AATCTGCACTATACAACAAATGG - Intergenic
1014290262 6:119550311-119550333 AAACTGATCATTAGAACAAATGG - Intergenic
1014378705 6:120711874-120711896 AATCCATACTATATAACAAATGG + Intergenic
1014583321 6:123164822-123164844 AATCTGTACTATAGACCAAGTGG + Intergenic
1015238766 6:131000476-131000498 AATCTGAACCATACATCAACGGG + Intronic
1015257386 6:131194542-131194564 AATCTGCACTATAGACCAAATGG - Intronic
1015578474 6:134698505-134698527 AATCTGCACTGTAGACCAAATGG - Intergenic
1016054260 6:139562651-139562673 AATCTGCACTATAGACCAAATGG - Intergenic
1016061220 6:139632987-139633009 AATCTACACTATAGACCAAATGG - Intergenic
1016064871 6:139670806-139670828 AATCTGCACTATGGACCAAATGG + Intergenic
1016103406 6:140131093-140131115 GAACTGGACTTTAGAACAAATGG + Intergenic
1016127643 6:140425443-140425465 AATCTGCACTATAGACAAAGTGG - Intergenic
1016136607 6:140551831-140551853 AATCTGCACTATAGACCAAATGG - Intergenic
1016369078 6:143352713-143352735 AATCTGCACTTTAGACCAAATGG - Intergenic
1016567823 6:145476428-145476450 AATCTGTACTATAGACTAAATGG + Intergenic
1016612242 6:146003572-146003594 AATCTGCAATATAGACCAAATGG + Intergenic
1016643236 6:146375408-146375430 AATCTGCACTATAAAACAAATGG - Intronic
1016728733 6:147405640-147405662 AATCTGCACTAGAGACCAAATGG - Intergenic
1016866087 6:148768428-148768450 AAACTGACTTTTAGAACAAAAGG - Intronic
1017228101 6:152043218-152043240 TAGCTGAAATATAGATCAAAAGG - Intronic
1017243007 6:152192259-152192281 AATCTGCACTGCAGACCAAATGG - Intronic
1017366037 6:153639413-153639435 AATCTGCACTACAGACCGAATGG - Intergenic
1017397915 6:154025033-154025055 AATCTGTACTATAGACCAAATGG - Intronic
1017998139 6:159552589-159552611 AACCTGCACCATAGACCAAATGG - Intergenic
1018520723 6:164647734-164647756 AAACTGCACTATAGACTAAATGG + Intergenic
1018555508 6:165045892-165045914 AAACTGCACTCTAGACCAAACGG + Intergenic
1018569301 6:165191567-165191589 AATCTGTAGTATAGAACTGATGG - Intergenic
1018781562 6:167072018-167072040 AAACTGTACTCTAAAACAAATGG - Intergenic
1019382922 7:736220-736242 AATCTGTACTATAGATCTAATGG - Intronic
1020422802 7:8028087-8028109 AATCTGCACTGTAGAACAAATGG + Intronic
1020515283 7:9110011-9110033 AACCTGCACTATAGACCAAATGG + Intergenic
1020519016 7:9163230-9163252 AATCTGCACTATTGAACAAATGG - Intergenic
1020573305 7:9893504-9893526 AATCTGCGCTATAAAACAAACGG + Intergenic
1020592078 7:10152220-10152242 AAACTGGACTGTAGATCAAAGGG + Intergenic
1020864928 7:13547712-13547734 AATCTGCACTGTAGACAAAATGG + Intergenic
1021035189 7:15789246-15789268 AATCTGCACTATAGAACAAATGG + Intergenic
1021130738 7:16910315-16910337 AATCTACACTACAGACCAAATGG - Intergenic
1021353988 7:19631108-19631130 GATTTGTACTATAGACCAAATGG + Intergenic
1021376042 7:19907768-19907790 AGTCTGCACTATAGACCAGATGG + Intergenic
1021681269 7:23135445-23135467 AATCTGCACTATAGACCAAATGG - Intronic
1021765699 7:23946507-23946529 AAACTGAACTTTAGACAAAATGG + Intergenic
1022061416 7:26799687-26799709 AATCTGCACTATAGACCAAATGG + Intronic
1022346676 7:29522612-29522634 AAACTGCACCACAGAACAAATGG + Intergenic
1022348513 7:29542354-29542376 AGTCTGCACCATAGACCAAATGG + Intergenic
1022366705 7:29727921-29727943 AATCTGCACTGTAGATCAAAAGG - Intergenic
1022541709 7:31143138-31143160 AATCTGCACTATAGACCAAATGG - Intergenic
1022749580 7:33210399-33210421 AATCTGCACTATAGACCAAATGG - Intronic
1022985935 7:35653536-35653558 AAACTGCACTTTAGACCAAATGG + Intronic
1023208707 7:37779520-37779542 AATCTGCACTATAGACCAAATGG - Intronic
1023241223 7:38149737-38149759 AATCTACACTGTAGACCAAATGG + Intergenic
1023500577 7:40844976-40844998 TATGTGAAATATAGAACTAAAGG - Intronic
1023716467 7:43049135-43049157 AATCTGCACTATAGACCAAATGG + Intergenic
1024368804 7:48556316-48556338 AATCTGTACTATAGAACAAATGG - Intronic
1024411081 7:49042184-49042206 AATCTGTAATATAGAAGAAATGG + Intergenic
1024419478 7:49146454-49146476 AAACTATACTACAGAACAAATGG + Intergenic
1024660983 7:51494485-51494507 AATCTGCACTACAGAACAAATGG - Intergenic
1024892075 7:54214884-54214906 AATCTGCACTGTAGATTAAATGG + Intergenic
1024956770 7:54929633-54929655 AATCTCCACTTTAGAACAAATGG + Intergenic
1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG + Intronic
1026049919 7:66937376-66937398 AATCTGCACTACAGACCAAATGG - Intronic
1026144553 7:67735276-67735298 AATCTGAGCTATTTAATAAATGG - Intergenic
1026208815 7:68283434-68283456 AAACTGCACTTTAGAACAAATGG + Intergenic
1027430556 7:78108487-78108509 AATCTGTACTATAGACCAAATGG - Intronic
1027524386 7:79248494-79248516 AATCTGCACTATAGACCGAATGG + Intronic
1027605156 7:80291005-80291027 AATTTTCACTACAGAACAAATGG + Intergenic
1027626916 7:80557018-80557040 AAACTTCACTCTAGAACAAATGG - Intronic
1027674872 7:81144452-81144474 AATCTGCACTGTAGACCAAATGG + Intergenic
1027753787 7:82185432-82185454 AATATCAACAATGGAACAAAGGG + Intronic
1027808537 7:82861607-82861629 AATCTACACTATAGACCAAATGG + Intronic
1027964007 7:84982038-84982060 AATATGATATGTAGAACAAATGG - Intergenic
1028028464 7:85877009-85877031 AAACTGTACCATAGAATAAATGG + Intergenic
1028033349 7:85947450-85947472 AATCTGTACCACAGACCAAATGG - Intergenic
1028036978 7:85996688-85996710 AATCTGCACTGTAGAACAAAGGG - Intergenic
1028161270 7:87487796-87487818 AATCTGCACTATAGACCAAATGG + Intergenic
1028186513 7:87792340-87792362 AATCTGCACTATAGACCAAATGG + Intronic
1028206930 7:88028494-88028516 AATCTGCATTATAGAACAAATGG - Intronic
1028259868 7:88649793-88649815 AATCTGCACTATAGAACAAGTGG + Intergenic
1028266273 7:88730294-88730316 AGTCTGCACTATAGGCCAAATGG - Intergenic
1028339292 7:89698105-89698127 AATCTGCACTATAGACTAAATGG + Intergenic
1028365506 7:90025043-90025065 AATCTATACTATAGGCCAAATGG + Intergenic
1028522776 7:91750236-91750258 AAACTGCACTACAGACCAAATGG + Intronic
1028702845 7:93802314-93802336 AATCTGCACTATAAACCAAATGG + Intronic
1028783097 7:94759579-94759601 AAACTATACTGTAGAACAAATGG + Intergenic
1028915549 7:96254905-96254927 AATCAAAACTATACAACAGAAGG - Intronic
1028950306 7:96627781-96627803 AATTTTTACTATAGACCAAATGG - Intronic
1028972957 7:96879335-96879357 AATCTGTACTATAGATCAAATGG + Intergenic
1029070676 7:97893852-97893874 AAGCTGCACTTTAGACCAAATGG + Intergenic
1029796844 7:102905125-102905147 AATCTGCACTATAGACAAAATGG - Intronic
1029825575 7:103189622-103189644 AATCTGCACTATAGATCAAAAGG + Intergenic
1030237186 7:107276697-107276719 AATGTGACCTTTAGAAGAAAAGG - Intronic
1030370205 7:108691281-108691303 AATCTGCACTATAGACAAAATGG - Intergenic
1030390629 7:108923258-108923280 AATCTGCGCTATACACCAAATGG - Intergenic
1030408041 7:109139815-109139837 AATCTGTACTACAGACCAAATGG - Intergenic
1030706171 7:112696240-112696262 AATCTGCATTATAGACCAAATGG - Intergenic
1030709288 7:112731156-112731178 AAACTGTACCATGGAACAAATGG - Intergenic
1030734177 7:113025181-113025203 AGTCTGCATTATAGACCAAATGG - Intergenic
1030741463 7:113114608-113114630 AATCTGAATAAGAGAAAAAAAGG + Intergenic
1030881014 7:114879852-114879874 AATCTGTACTAAAGAACAGATGG - Intergenic
1030990619 7:116294925-116294947 AATTTGCACTATAGAACAAATGG + Intronic
1031015215 7:116567845-116567867 AATCTGAACAACAAAACATAAGG - Intergenic
1031098756 7:117451947-117451969 AATTTGCACTGTAGAACAAATGG + Intergenic
1031260277 7:119508940-119508962 AAGGTGGACTATAGACCAAATGG + Intergenic
1031472657 7:122185357-122185379 AATCTGCACTGTAGACCAAATGG + Intergenic
1031553251 7:123141423-123141445 AATCTGTACTACAGGCCAAATGG - Intronic
1031566269 7:123300787-123300809 AATCTGAACTATAAACCAAATGG + Intergenic
1031638844 7:124137391-124137413 ATTCTGCACTATAGACCAAATGG - Intergenic
1031677050 7:124623571-124623593 AAATTGCACTATAGACCAAATGG + Intergenic
1031722198 7:125190356-125190378 AATCTACACTCTAGACCAAATGG + Intergenic
1032008598 7:128325410-128325432 ATACTCGACTATAGAACAAATGG + Intronic
1032138473 7:129304395-129304417 AATCTGCACTACAAACCAAATGG - Intronic
1032779695 7:135154852-135154874 AAATTGAACTTTAGACCAAATGG - Intronic
1032901797 7:136318334-136318356 AAACTGGACTTTAGACCAAATGG - Intergenic
1032928128 7:136632874-136632896 AATCTGAACGATAGACCAAATGG - Intergenic
1033677015 7:143552793-143552815 TAACTGGACTATAGAACAAATGG - Intergenic
1033694820 7:143776644-143776666 TAACTGGACTATAGAACAAATGG + Intergenic
1033715701 7:143999819-143999841 AATGTGAACTATTGGTCAAATGG + Intergenic
1033819745 7:145120709-145120731 AATCTCCACTATATACCAAATGG - Intergenic
1033833457 7:145281297-145281319 AATCTGTACTGTAGACCAAATGG - Intergenic
1033877399 7:145839538-145839560 AATCTTCACTATAGAACAAATGG - Intergenic
1034003162 7:147439594-147439616 AATATATACTATAGACCAAATGG - Intronic
1034019826 7:147629455-147629477 AAACTATACTCTAGAACAAATGG + Intronic
1034048587 7:147957321-147957343 AATCTAAACTAATGAAGAAAAGG + Intronic
1034581397 7:152046315-152046337 AATCTGTACTACTGACCAAATGG - Intronic
1035139347 7:156741774-156741796 AATCTGTACTGTACAACAAATGG + Intronic
1035343627 7:158182804-158182826 AGTCTACACTCTAGAACAAATGG - Intronic
1035887473 8:3307575-3307597 TTTCTGAACTAAAGAAGAAAAGG - Intronic
1036083568 8:5587403-5587425 AATCTGAAAAATAAAAAAAATGG + Intergenic
1036247893 8:7135913-7135935 AAGCTGCACTTTAGACCAAATGG - Intergenic
1036252920 8:7178448-7178470 AAGCTGCACTTTAGACCAAATGG + Intergenic
1036364577 8:8109014-8109036 AAGCTGCACTTTAGACCAAATGG - Intergenic
1037000467 8:13711674-13711696 AATCTGCACTATAGACCAAATGG - Intergenic
1037034432 8:14147685-14147707 ATTCTGCACTACAGACCAAATGG + Intronic
1037255740 8:16950726-16950748 AATCTGCACTATAGAAAAAATGG + Intergenic
1038859659 8:31373640-31373662 AATCTGAACACTTGACCAAATGG - Intergenic
1039002063 8:32992610-32992632 AATCTGCACAATAGAATAAATGG - Intergenic
1039112386 8:34054506-34054528 AAACTATACTCTAGAACAAATGG + Intergenic
1039647199 8:39300493-39300515 AATCTGCATTATAGACCAAATGG - Intergenic
1039665274 8:39519135-39519157 AAACTGCACTTTAGACCAAATGG - Intergenic
1040063370 8:43123573-43123595 AATCTGCATTATAGACCAAATGG - Intergenic
1040502625 8:48018665-48018687 AAGCTACACTATAGAACAAATGG - Intronic
1040511192 8:48096985-48097007 AATCTGCACTATAAACCAAATGG - Intergenic
1040628218 8:49176125-49176147 AATCTGCACTATATACCAAATGG + Intergenic
1040720824 8:50321047-50321069 AATCTGTGCTATAAATCAAAAGG - Intronic
1040838252 8:51755122-51755144 AGTCTGAACAAAAGGACAAATGG + Intronic
1041027554 8:53702775-53702797 ATTCTGCACTATAGACCAGATGG - Intergenic
1041027555 8:53702822-53702844 CATCTGCACTATAGACCAAATGG + Intergenic
1041079102 8:54199006-54199028 AAACTGGACTGTAGACCAAATGG - Intergenic
1041150533 8:54928052-54928074 AAACTCTACTCTAGAACAAATGG + Intergenic
1041226502 8:55705845-55705867 AATCAAAACTTTAGAAAAAATGG + Intronic
1041273031 8:56127456-56127478 AATGTGAACCTTAGAACAACAGG - Intergenic
1041365665 8:57101140-57101162 AATCTGCACTATAGATCAAATGG + Intergenic
1041454794 8:58046909-58046931 AATTTGTACTATAGGACATAGGG + Intronic
1041500069 8:58530728-58530750 AATCTGCAGTATGGTACAAATGG - Intergenic
1041883098 8:62775805-62775827 AAACTGTACAATAGATCAAATGG - Intronic
1041908218 8:63056850-63056872 AAGCTGCACTTTAGAGCAAATGG - Intronic
1042162987 8:65916083-65916105 AATCTATACCATAGAACAAATGG + Intergenic
1042298299 8:67246239-67246261 AATCTGCACTACATAACAAATGG + Intronic
1042428490 8:68676506-68676528 AATCTGCATTATAAACCAAATGG + Intronic
1042637230 8:70891771-70891793 AAACTGCACTTTAGACCAAATGG - Intergenic
1042726566 8:71885146-71885168 AATCTGCACTAAAGACCAAATGG - Intronic
1042898702 8:73698782-73698804 ATTCTGCACTATAGACAAAATGG + Intronic
1042937493 8:74074998-74075020 AATCTATGCTATAGAATAAATGG - Intergenic
1043133799 8:76495532-76495554 AATCTGCACTATAGACCAAATGG - Intergenic
1043198191 8:77327766-77327788 AAACTGGACTTTAGACCAAATGG - Intergenic
1043302945 8:78757400-78757422 AATCTGTGCTATAGACCAAGTGG - Intronic
1043308428 8:78826709-78826731 AAACTGCACCATAGACCAAATGG + Intergenic
1043311743 8:78869073-78869095 AATCTGCACTATAGAACACATGG - Intergenic
1043340009 8:79226701-79226723 AATCTACACTATAGATCAAATGG - Intergenic
1043551939 8:81384179-81384201 AAACTGGACTTTAGACCAAATGG - Intergenic
1043554227 8:81411611-81411633 AATCTGCACTACAAACCAAATGG + Intergenic
1043600514 8:81931501-81931523 ACTCCGTATTATAGAACAAATGG + Intergenic
1043627235 8:82276587-82276609 AATCTGCACTATAGATCAAATGG + Intergenic
1043638790 8:82422549-82422571 AATCTACAGTATAGATCAAATGG - Intergenic
1043760264 8:84059774-84059796 AATCTGCACTATAGTAAAAATGG - Intergenic
1043998312 8:86846382-86846404 AATTTGCACTGTAGATCAAATGG + Intergenic
1044192768 8:89339311-89339333 AATCTGCACTATAGACCAAATGG - Intergenic
1044241757 8:89896281-89896303 AATCTGCATGATACAACAAATGG + Intergenic
1044644271 8:94421490-94421512 AATCTGGGCTAGAGAAAAAAAGG - Intronic
1044765126 8:95563590-95563612 AATCTGTGCTATAGACCAAATGG + Intergenic
1044878222 8:96694401-96694423 AATCTGCACAGTAGATCAAATGG + Intronic
1045067391 8:98461005-98461027 AAACTTCACTGTAGAACAAATGG - Intronic
1045147724 8:99366108-99366130 AATCTGCACTGTAGACCAAATGG - Intronic
1045590304 8:103586224-103586246 AATATTCACTATAGATCAAATGG + Intronic
1045598734 8:103689369-103689391 AATCTGCACTACAGACCAAATGG - Intronic
1045600136 8:103705458-103705480 AAACTAAACTCTAGACCAAATGG - Intronic
1045602148 8:103730062-103730084 AATCTGCAGTATAGTCCAAATGG - Intronic
1045732077 8:105254405-105254427 AATCTGTCCTACAGAACAAATGG - Intronic
1045777193 8:105819299-105819321 AATCTGCACTGTACATCAAATGG - Intergenic
1045875028 8:106970774-106970796 TATCTTAACTAAAGAACACAGGG + Intergenic
1045930300 8:107617024-107617046 AATCTAGACTAAATAACAAAGGG + Intergenic
1046113896 8:109762282-109762304 AATCTGCACTGTAGACAAAATGG - Intergenic
1046119274 8:109824986-109825008 AATCTGCACCATAGACCAAATGG - Intergenic
1046134360 8:110007362-110007384 TATCTGCATTATAAAACAAATGG - Intergenic
1046215356 8:111138887-111138909 AATTTGCACTATAGGACGAATGG - Intergenic
1046233162 8:111384954-111384976 AACCTGTACTCTAGAACAAATGG - Intergenic
1046267925 8:111856051-111856073 AATCTGCACTATAGCCCAAGTGG + Intergenic
1046449187 8:114365782-114365804 AATCTGCACTATAGACCAAATGG + Intergenic
1046975603 8:120272920-120272942 AAACTACACTCTAGAACAAATGG + Intronic
1047139127 8:122116504-122116526 AAACTGAGCTATAGACCAAATGG + Intergenic
1047342525 8:123996167-123996189 AATCTGCACCATGGAACAAATGG - Intronic
1047379395 8:124344273-124344295 AATTTGCACTATAAAATAAAGGG + Intronic
1047841442 8:128757987-128758009 AATCTGCACTATAGAACAAAAGG + Intergenic
1047902061 8:129433448-129433470 AATCTACACTATAGACTAAATGG + Intergenic
1048415041 8:134218438-134218460 AAACTGCACTCTAGAACAAATGG + Intergenic
1048644315 8:136401454-136401476 AAACTGTACTATAGACAAAATGG + Intergenic
1048688162 8:136927735-136927757 AAGGAGAACTATAGGACAAAAGG - Intergenic
1048920630 8:139226799-139226821 AATCTGAACTACATAATAGAAGG - Intergenic
1049490078 8:142893503-142893525 AATCTGAACTATAAACCAAATGG - Intronic
1050121349 9:2311652-2311674 AATCTACATTATAGAACAAATGG - Intergenic
1050356377 9:4786830-4786852 AAACTGCACTATAGACCCAATGG + Intergenic
1050438929 9:5639599-5639621 AATCTGCACTATACAACAAATGG - Intronic
1050510222 9:6386349-6386371 AATCTGTGCTGTAGACCAAATGG + Intergenic
1050823754 9:9916712-9916734 AAACTTCACCATAGAACAAATGG + Intronic
1050864932 9:10486817-10486839 AATCTGTACTAAAGACCAAATGG - Intronic
1050906219 9:11010215-11010237 AATCTGCACTATAGACCAAATGG - Intergenic
1051029964 9:12661629-12661651 AATCTGTACTGTAGACCAAATGG + Intergenic
1051047495 9:12892182-12892204 TACCTGTACTATAGAATAAATGG + Intergenic
1051197559 9:14579490-14579512 AAACTGCACTATAGACCAAATGG + Intergenic
1051465448 9:17371595-17371617 AATTTGTACTGTAGACCAAATGG + Intronic
1051573967 9:18593922-18593944 AATCTGTACTAAAGACAAAATGG - Intronic
1051645803 9:19267126-19267148 AATCTGCACTATAGACTAAATGG - Intronic
1051704604 9:19863367-19863389 AATCTGTACTCTAGACCAAATGG + Intergenic
1051990813 9:23150608-23150630 AGTCTGCACTATAGACCAAATGG - Intergenic
1052063591 9:23989999-23990021 ATTCTGCACTATAGATCAAATGG + Intergenic
1052172562 9:25419000-25419022 AATCTGAGCCCTAGACCAAAGGG - Intergenic
1052258493 9:26487668-26487690 AATCTGAACTATAGACCAAATGG - Intergenic
1052573611 9:30263440-30263462 AATCTGAACTATAGACTAAAGGG - Intergenic
1053028411 9:34751677-34751699 AATATGCACTATAGACCAAATGG + Intergenic
1053454509 9:38222928-38222950 AATTTGCACCATAGACCAAATGG - Intergenic
1055180904 9:73385727-73385749 AATCTGTAGTATGGAACAAATGG - Intergenic
1055293580 9:74810866-74810888 TTTCTGAAATAAAGAACAAAAGG + Exonic
1055387481 9:75778163-75778185 AGTCTGCACTATAGGCCAAATGG + Intergenic
1055744152 9:79424375-79424397 AAACTGCACTACAGACCAAATGG - Intergenic
1055886224 9:81066566-81066588 AATTTGCACTATAGAACAAATGG - Intergenic
1056007615 9:82289281-82289303 AATCTGCATTACAGACCAAATGG + Intergenic
1056148534 9:83760494-83760516 AATCTGCACTATAAACCAAATGG + Intronic
1057074436 9:92129374-92129396 AATCTGCATGATAGACCAAATGG - Intergenic
1057084857 9:92200239-92200261 AATCTGCATGATAGACCAAATGG + Intergenic
1057175178 9:92991666-92991688 AAACTACACCATAGAACAAATGG - Intronic
1057285173 9:93747699-93747721 AAACTACACTGTAGAACAAATGG - Intergenic
1057970285 9:99549574-99549596 AATCTGCACCATAGACCAAATGG - Intergenic
1058004331 9:99899393-99899415 AATCTGTACTATAGACCAAATGG + Intergenic
1058016566 9:100039163-100039185 AACCTGCACTATAAACCAAATGG + Intronic
1058030373 9:100189924-100189946 AAACTGCACTCTACAACAAATGG - Intronic
1058127063 9:101207396-101207418 AAACTGAACTAAGGAATAAAGGG - Intronic
1058133460 9:101279457-101279479 AATCTGTAGTATAGACCAAATGG + Intronic
1058232752 9:102449820-102449842 AATCTGCACTATAGAACAAATGG + Intergenic
1058248845 9:102666509-102666531 AATTTGCACTATAGACCAAATGG - Intergenic
1058302680 9:103396128-103396150 AAACTGGACTCTGGAACAAATGG - Intergenic
1058522562 9:105826195-105826217 AATCTGCACTATAGACCAAATGG - Intergenic
1058548649 9:106088836-106088858 ATTCTGAACAATAGAAAAAGAGG - Intergenic
1058821224 9:108731908-108731930 AATCTGCATTACAGACCAAATGG + Intergenic
1059239609 9:112792733-112792755 AATCTGAACAATATAGAAAAAGG - Intronic
1059746825 9:117209681-117209703 AAACTTCACTATAGACCAAATGG + Intronic
1059839379 9:118195269-118195291 AATCAGCACTATAGGCCAAATGG + Intergenic
1060463636 9:123882681-123882703 AACCTGAACTTCAGAATAAAAGG - Intronic
1061622493 9:131820227-131820249 AAACTGACCGATAGAACAGAGGG - Intergenic
1061638569 9:131931972-131931994 AACCTGGACTACAGAACAAATGG + Intronic
1186322186 X:8440202-8440224 AATATGAAATAGAGAATAAAGGG - Intergenic
1186601867 X:11047301-11047323 AATCTGCACTATAGCCCAAATGG - Intergenic
1186911362 X:14170889-14170911 AATCTGCACTATAGATCAAATGG - Intergenic
1187110104 X:16289285-16289307 AATCTGTATTTTAGAATAAATGG + Intergenic
1187315294 X:18187619-18187641 AATCTGTACTATAGACCAAATGG + Intronic
1187610414 X:20937708-20937730 AATCTGCACTATAGACTAACTGG - Intergenic
1187618425 X:21024152-21024174 AACCTGCACTATAGACCAAGTGG - Intergenic
1187644026 X:21327314-21327336 AATCTGCACTATAGACCAAATGG + Intergenic
1187651788 X:21417427-21417449 TATCTACACTATAGAACAAATGG - Intronic
1187660194 X:21537377-21537399 AAACTGCACTATAGACTAAATGG - Intronic
1187695932 X:21920267-21920289 AAACTATACTATAGAACAAATGG - Intergenic
1187836929 X:23441214-23441236 AAACTTAACTGTAGACCAAATGG + Intergenic
1187838596 X:23461040-23461062 AATCTGCATTATAGAACAAATGG - Intergenic
1187845193 X:23528092-23528114 AATCTGCACTATAGAACAAATGG + Intergenic
1187846509 X:23543346-23543368 AATTTCCACTATAGACCAAATGG + Intergenic
1188046058 X:25426956-25426978 AATCTGCACTATAAAACAAATGG - Intergenic
1188261040 X:28024585-28024607 CATCTGATTAATAGAACAAAGGG - Intergenic
1188426789 X:30057565-30057587 AATCTGCATTATAGAACAAATGG - Intergenic
1188625351 X:32277450-32277472 AATCTGCACTATAGAATAAATGG + Intronic
1188733779 X:33686056-33686078 AATCTGCACTATAGGCCAAGTGG - Intergenic
1188777068 X:34232978-34233000 AATCTGCAATATAGACAAAATGG + Intergenic
1188814208 X:34691258-34691280 TAACTGAACTATAGACTAAATGG - Intergenic
1188815038 X:34702755-34702777 AATCTGAAGTATAGACGAAATGG - Intergenic
1188846037 X:35073567-35073589 AATCTGCCCTGTAGACCAAACGG - Intergenic
1188853947 X:35169034-35169056 AAACTACACTATGGAACAAATGG - Intergenic
1188858652 X:35229811-35229833 ACTCTGAAACATAAAACAAAAGG - Intergenic
1188890743 X:35609194-35609216 AATCTGTACTGTAGACTAAATGG + Intergenic
1188915675 X:35907180-35907202 CATCTACACTATATAACAAAAGG - Intergenic
1188924274 X:36020348-36020370 AATCTACACTATAGACCAAAAGG - Intergenic
1188929964 X:36096363-36096385 CATCTGCACTATAGACCTAATGG - Intronic
1188931819 X:36120875-36120897 CATCTGCACTATAGACAAAATGG - Intronic
1188996353 X:36890673-36890695 AATCTGCACTAAAGACCAAATGG + Intergenic
1189119287 X:38376964-38376986 AATCTGCACTGTAGACCAAGTGG + Intronic
1189183391 X:39027314-39027336 AAACTGCACTCTAGACCAAATGG - Intergenic
1189592222 X:42525692-42525714 AATGTGGATTATACAACAAATGG - Intergenic
1189639425 X:43051455-43051477 AATCTTACCTAGAGAAGAAATGG - Intergenic
1189769757 X:44413497-44413519 AATCTACACTATAGACCAAAAGG - Intergenic
1189873924 X:45414926-45414948 AATCTGCACTACAGATCAAATGG - Intergenic
1189881230 X:45495158-45495180 AATATGCACTACAGATCAAATGG - Intergenic
1189889966 X:45591054-45591076 AACCTGCCCTATAGACCAAATGG - Intergenic
1189929592 X:45995153-45995175 AATCTGCACTATAGATTAAATGG - Intergenic
1190370418 X:49735107-49735129 AATCTGAAGTAGAGAAAAAATGG + Intergenic
1190806058 X:53837966-53837988 AATTGGCACTATAGACCAAATGG - Intergenic
1190893613 X:54594116-54594138 AATCTACAGTATAGAATAAATGG - Intergenic
1190943236 X:55065062-55065084 AATCTGCACTATGGACCAAGTGG - Intergenic
1190958043 X:55216456-55216478 TATCTGCACTATAGAGCAAATGG - Intronic
1190964980 X:55291090-55291112 AATCTGCACTATAGACCGCATGG - Intergenic
1190978885 X:55436786-55436808 AATCTGCACTATAAACCAAATGG + Intergenic
1191030861 X:55969082-55969104 AATCTGGACTATAGACCAAATGG + Intergenic
1191052471 X:56208974-56208996 AATCTGCACTGTAGACCACATGG - Intergenic
1191057487 X:56257316-56257338 AATCTGCACTATAGACCAAATGG - Intronic
1191083756 X:56541751-56541773 AATCTGCACTATGGAACAAATGG + Intergenic
1191102295 X:56744341-56744363 AATCTGTACTGTAGACCAAATGG - Intergenic
1191146809 X:57175086-57175108 AAACTGCACTCTAGAACAAGTGG - Intergenic
1191188885 X:57643887-57643909 AGTCTGCACTATAGAACAAATGG + Intergenic
1191198839 X:57755361-57755383 AATCTGGACTAGAGGACAAATGG + Intergenic
1191592930 X:62907434-62907456 AATCTTCACTATAGAACAAATGG - Intergenic
1191646871 X:63491422-63491444 AATCTGCACTACAGACTAAATGG + Intergenic
1191650542 X:63532501-63532523 AATCTGTACTATAGACCAAATGG + Intergenic
1191686258 X:63894495-63894517 AAACTGGACTATAGGCCAAATGG + Intergenic
1191746379 X:64493268-64493290 AATCTGCACTACACAGCAAATGG + Intergenic
1191801193 X:65081758-65081780 AATCTAAACTGTAGACCAAATGG + Intergenic
1191814942 X:65233224-65233246 AATCTGGAGTATAGACCAAATGG + Intergenic
1191924340 X:66293463-66293485 AATCTGCACTACGGACCAAATGG - Intergenic
1191926810 X:66320954-66320976 AATCTACACTATTGACCAAATGG + Intergenic
1191942482 X:66496378-66496400 AATCAGAACAATTGAACACATGG - Intergenic
1191957081 X:66654659-66654681 AATCTGCACCATTGACCAAATGG + Intergenic
1191967308 X:66773908-66773930 AATCTGCACTATAGACCAAAAGG - Intergenic
1192002034 X:67162013-67162035 AATCTGCACTATAGACCAAATGG + Intergenic
1192010470 X:67265712-67265734 AATCTGCACTATAGACCAAGTGG - Intergenic
1192060442 X:67819651-67819673 AATCTGCACTACAGAACAAATGG + Intergenic
1192073704 X:67967976-67967998 AATCTGCACTATAGACCAAATGG + Intergenic
1192079762 X:68035875-68035897 AAACTGCACTTTAGACCAAATGG + Intergenic
1192088295 X:68124528-68124550 AATCTGCACTATGGACCAAATGG + Intronic
1192135384 X:68593748-68593770 AATCTGCACTGTGCAACAAATGG + Intergenic
1192138041 X:68623692-68623714 AATCTGCACGATGCAACAAATGG - Intergenic
1192291303 X:69798292-69798314 AAACTGAACTCTAGACCAAATGG + Intronic
1192304150 X:69941282-69941304 AATCTGCACTATAGACCAAATGG - Intronic
1192394407 X:70763962-70763984 AATTTGCACTATAGAACATATGG + Intronic
1192505389 X:71678166-71678188 AATCTGCACTATAGAGCAAACGG - Intergenic
1192521553 X:71805640-71805662 AATCTGCACTATAGGGCAAGTGG + Intergenic
1192725622 X:73749051-73749073 AGTCTGCACTGTAGACCAAATGG - Intergenic
1192790425 X:74377071-74377093 AATCTGTACTATAGACCAAAGGG - Intergenic
1192812810 X:74562134-74562156 AATCTGCAATATAGATCAAATGG + Intergenic
1192825837 X:74695438-74695460 AATCTACTCTATAGACCAAATGG - Intergenic
1192838874 X:74833125-74833147 AATCTTCTCTATAGAACAAATGG - Intronic
1192841429 X:74860383-74860405 ATTCTGCACAATAGACCAAATGG + Intronic
1192854042 X:74988263-74988285 AATCTGCACTACAGGCCAAATGG + Intergenic
1192855706 X:75009151-75009173 AATCTGCACTATAGACCAAATGG - Intergenic
1192857677 X:75031194-75031216 AATCTTCACTATAGAACGAATGG - Intergenic
1192874996 X:75219925-75219947 GATATTCACTATAGAACAAATGG - Intergenic
1192885411 X:75332320-75332342 AAGCTGCACTCCAGAACAAATGG - Intergenic
1192887623 X:75352585-75352607 CATCTACACTATAGACCAAATGG - Intergenic
1192904090 X:75531634-75531656 AAACTGTACTCTAGAACAAATGG - Intergenic
1192908244 X:75575650-75575672 CATCTGCACTATAGACCAAATGG - Intergenic
1192927675 X:75773161-75773183 AATCTGTGCTATAGATCAAATGG + Intergenic
1192959762 X:76115442-76115464 AATCTGCACTATATACTAAAAGG + Intergenic
1192968321 X:76203437-76203459 AATCTGCACTATAGACCAAATGG - Intergenic
1192972500 X:76249012-76249034 CATTTGAACTATAGAACAAATGG - Intergenic
1193005259 X:76610450-76610472 ATTCTGAAAAATAGAAAAAAAGG + Intergenic
1193017141 X:76747971-76747993 AGTCTGTGCTATAGACCAAATGG + Intergenic
1193071610 X:77312032-77312054 CATCTGCAATATAGAACAAATGG + Intergenic
1193098607 X:77581666-77581688 TATCTACACTATAGACCAAATGG + Intronic
1193176168 X:78396346-78396368 AATCTACATTATAGAACAAATGG + Intergenic
1193194578 X:78616791-78616813 CATCTGCACTATAGACTAAATGG - Intergenic
1193204590 X:78733470-78733492 GAACTGCACTATAGACCAAATGG - Intergenic
1193219665 X:78909296-78909318 AGTCTACACTATAGAATAAATGG - Intergenic
1193245914 X:79229503-79229525 AATATGCACCATAGAACAAATGG - Intergenic
1193246332 X:79234379-79234401 AATTTGCACTAAAGAACAAAGGG - Intergenic
1193247581 X:79247376-79247398 AATCTGCATTATAGAACAAATGG + Intergenic
1193280100 X:79638317-79638339 ATGCTGCACTATAGACCAAATGG - Intergenic
1193287776 X:79733337-79733359 AAACTGCACTATAGAGCAAGTGG + Intergenic
1193290248 X:79764345-79764367 ATTCTGAACTATAGACCAAATGG - Intergenic
1193293177 X:79802693-79802715 AATATACACTATAGACCAAATGG - Intergenic
1193396833 X:80993934-80993956 AATCTGCACTATAGATCAAATGG + Intergenic
1193436964 X:81486144-81486166 AAACTGGACTCTAGAACAAATGG + Intergenic
1193443516 X:81570937-81570959 AAACTGAACTTTAGACCAAATGG + Intergenic
1193487119 X:82099893-82099915 AATCTGCACAATAGGCCAAATGG - Intergenic
1193504536 X:82325946-82325968 AACCTGAACTATAGAACAAATGG - Intergenic
1193524266 X:82569802-82569824 AAGCTGCACTATAGACTAAATGG - Intergenic
1193529509 X:82639396-82639418 AATTTGCACTATAGACCATATGG - Intergenic
1193596172 X:83448664-83448686 AATCTGCACTACAGACCAAAAGG - Intergenic
1193649493 X:84112306-84112328 AAACTGGACTCTAGACCAAATGG + Intronic
1193650629 X:84126473-84126495 AATCTGCACCATAGAAAAAGTGG + Intronic
1193670531 X:84379361-84379383 GATCTGCACTATACACCAAATGG + Intronic
1193677622 X:84475831-84475853 AAGCTGTACTCTGGAACAAAAGG + Intronic
1193691732 X:84653961-84653983 AATCTTCACTATAGAACAAATGG - Intergenic
1193693122 X:84671761-84671783 AATCTGTATTATAGACCAAATGG + Intergenic
1193697049 X:84721654-84721676 AATCTGCACCATAGACCAAGCGG - Intergenic
1193729845 X:85089626-85089648 AATATGAATAATAAAACAAATGG - Intronic
1193765566 X:85525207-85525229 AATCTGCACTATGGACCAAATGG - Intergenic
1193816009 X:86105854-86105876 AATCTGCACTATAGACCAAATGG + Intergenic
1193821243 X:86168053-86168075 AATCTGCACTTTAGACCAAATGG - Intronic
1193863410 X:86699185-86699207 AAACTGAACTCTAGAACAAACGG + Intronic
1193877621 X:86881106-86881128 AATCTGCACTGTAGACAAAATGG - Intergenic
1193897914 X:87136149-87136171 AATTTGCATTATAGACCAAATGG + Intergenic
1193899409 X:87158643-87158665 AATCTGCACTTTAGGCCAAATGG - Intergenic
1193910029 X:87293181-87293203 AATCTTAACTGTAGAAAAAAAGG - Intergenic
1193933554 X:87586253-87586275 AATCTGCACTGAAGAACAAATGG + Intronic
1193965343 X:87978010-87978032 AAACTAAACCTTAGAACAAATGG + Intergenic
1193985054 X:88229885-88229907 AATCTGCACCATAGACCAAATGG + Intergenic
1193989489 X:88288517-88288539 AATTTGCACTCTAGACCAAATGG + Intergenic
1194007074 X:88507864-88507886 AATTTGCACTATAGACCAAAGGG + Intergenic
1194024043 X:88728963-88728985 AGTCTGTACTATAGACCAAATGG + Intergenic
1194083340 X:89495896-89495918 AATCTGCACTGCAGAACAAATGG - Intergenic
1194106967 X:89781492-89781514 AATCTGCACTATAGACCAAATGG + Intergenic
1194136344 X:90148550-90148572 ACTCTGAAATAAATAACAAAGGG - Intergenic
1194157639 X:90412672-90412694 AGTCTGCACTATGGAGCAAATGG - Intergenic
1194165937 X:90515978-90516000 AATCTGCACTGTAGAACAAATGG + Intergenic
1194173346 X:90617136-90617158 AATCTGCACTATACACCAAATGG - Intergenic
1194219084 X:91169092-91169114 AATCTAAACAATTGAACTAATGG - Intergenic
1194229504 X:91304509-91304531 AATCTGCACCATAGACCAAATGG + Intergenic
1194253459 X:91606339-91606361 AATCTGCACTATAGACAAAATGG + Intergenic
1194264703 X:91739962-91739984 AATCTGCACTATATAACAAATGG - Intergenic
1194287965 X:92034262-92034284 AATCTGCCCTATAGAGCAAATGG - Intronic
1194290746 X:92068989-92069011 AATCTGCATAGTAGAACAAATGG - Intronic
1194335519 X:92641459-92641481 AATCTGTACTCTAGAACAACTGG - Intergenic
1194338455 X:92679357-92679379 AATCTGTACTATAGAACAAATGG - Intergenic
1194348631 X:92797041-92797063 AATCTGCACTATAGAACAAATGG + Intergenic
1194378955 X:93170013-93170035 AATCTGCACTACAGACCAGATGG + Intergenic
1194431727 X:93815897-93815919 AATCTGCACTATAGAATAAATGG + Intergenic
1194439120 X:93908097-93908119 AATCTGCACTATAGACCAAATGG - Intergenic
1194451980 X:94054812-94054834 AGTCTTTACTAAAGAACAAAAGG + Intergenic
1194543493 X:95203792-95203814 AATCTGAAGGATACAACAAAAGG - Intergenic
1194546623 X:95242804-95242826 AACCTGCACTGTAGACCAAATGG + Intergenic
1194559193 X:95399498-95399520 AATCTGCACTGTAGATAAAATGG + Intergenic
1194572128 X:95565493-95565515 AATCTACACTATAGAACAAAGGG + Intergenic
1194574819 X:95599303-95599325 AATCTGCACTGTAGACCAAATGG + Intergenic
1194612944 X:96065951-96065973 AATCTGCACTGTAGACCAAATGG - Intergenic
1194630484 X:96276770-96276792 AAACTGTACCCTAGAACAAATGG + Intergenic
1194692613 X:97006292-97006314 AATCTGCACCATAGACCAAATGG - Intronic
1194780516 X:98020098-98020120 AATCTGCACAATAGAACAAACGG - Intergenic
1194839515 X:98723426-98723448 AATCTACACTATAGATAAAATGG + Intergenic
1194881838 X:99262125-99262147 AATCTGCACTATAGGCCACATGG - Intergenic
1194888117 X:99344195-99344217 CATCTGAACTCTAGACCAGATGG - Intergenic
1194902013 X:99523535-99523557 AAGCTGCACTCTAGAACAAATGG + Intergenic
1194921027 X:99764349-99764371 AATCTGTACCACAGACCAAATGG + Intergenic
1194926666 X:99833922-99833944 AATCTGCACTATAAAACAAATGG + Intergenic
1194937366 X:99967311-99967333 CATATGTACTATAGACCAAATGG - Intergenic
1194991033 X:100547206-100547228 AACATGCACTATAGACCAAATGG + Intergenic
1195036881 X:100978226-100978248 AATCTGCACTATAGAGCAAATGG - Intronic
1195171963 X:102278208-102278230 AATCTTCACTGTAGACCAAATGG - Intergenic
1195186897 X:102408885-102408907 AATCTTCACTGTAGACCAAATGG + Intronic
1195224875 X:102782993-102783015 AATCAAAACTATGGATCAAATGG - Intergenic
1195396460 X:104415667-104415689 AATCTGCACTATAGACCAAATGG + Intergenic
1195455245 X:105061550-105061572 AATCTGCACTACAGAACAAATGG - Intronic
1195592434 X:106645765-106645787 AATCTGCACTGTAGATCAAATGG - Intronic
1195595722 X:106686395-106686417 AATCTGCACTATAGACCAAATGG + Intergenic
1195601515 X:106754077-106754099 AATGTGCAGTAGAGAACAAATGG + Intronic
1195650767 X:107281565-107281587 AATCTGCACTACAGACCAAATGG + Intergenic
1195662665 X:107396360-107396382 AATCTATACTATGAAACAAATGG - Intergenic
1195807421 X:108791067-108791089 AATCAGCACTATAGACCAAATGG - Intergenic
1195820213 X:108936801-108936823 AATCTGCACTATAGACCAAATGG - Intergenic
1195823755 X:108974428-108974450 AATCTGTACTATAGACCAAGTGG + Intergenic
1195834619 X:109099972-109099994 AATCTGAACTATAGACCAAATGG - Intergenic
1195848886 X:109261423-109261445 TGTCTGCACTATAGAACAAAGGG - Intergenic
1196154337 X:112410360-112410382 AATCTGCACTGTAGACCAAGTGG + Intergenic
1196163157 X:112508158-112508180 AATCTGTACTACAGACCAAATGG - Intergenic
1196232342 X:113239127-113239149 AATCTGCACTATAAACCAAATGG - Intergenic
1196233224 X:113250026-113250048 AATCTGCACTATAGACCAAATGG - Intergenic
1196242781 X:113363072-113363094 AATCTTCACTATAGACCAAATGG - Intergenic
1196252459 X:113478443-113478465 CATCTGCACTATAGAGCAAATGG - Intergenic
1196269146 X:113690502-113690524 AATCTGCACTATGGAGGAAATGG - Intergenic
1196289816 X:113926734-113926756 AACCTTCACTATAGAGCAAATGG - Intergenic
1196304916 X:114090070-114090092 AATCTGCACTACAGAACAAATGG + Intergenic
1196361927 X:114871435-114871457 AATCTGTTCTACAGACCAAATGG - Intronic
1196385317 X:115142291-115142313 AATCTGCACTATAGACCAAATGG + Intronic
1196461123 X:115932636-115932658 AATCTGCACTATAGACCAAATGG - Intergenic
1196471108 X:116028852-116028874 AATCTGCAATATAGGCCAAAAGG - Intergenic
1196478572 X:116118909-116118931 AATCTTCACCATAGACCAAATGG - Intergenic
1196495558 X:116320545-116320567 AATCTGCACTATAGACCAAATGG + Intergenic
1196509011 X:116482975-116482997 AATCTGTACTATACGGCAAACGG + Intergenic
1196509924 X:116497391-116497413 AATCTCCACTACAGAACAAATGG - Intergenic
1196523635 X:116705607-116705629 AATCTGCATTATAGAGCAAATGG - Intergenic
1196547421 X:116978757-116978779 AATCTGCACTACAGAAAAAATGG + Intergenic
1196564816 X:117192743-117192765 AATTTGCACTATAGACCAAATGG + Intergenic
1196609817 X:117698709-117698731 TATCTGCACTATAGACCAAATGG + Intergenic
1196620104 X:117812028-117812050 AATTTGCACTATAGACCAAATGG + Intergenic
1196620423 X:117816299-117816321 AAGCTGCACTATAGACCAAATGG - Intergenic
1196621201 X:117826494-117826516 AAACTACACTCTAGAACAAATGG - Intergenic
1196626315 X:117880762-117880784 AATCTGCACTGTAGACCAAATGG + Intergenic
1196639561 X:118042333-118042355 AATCTGCACTATAGAACAAATGG + Intronic
1196922398 X:120597783-120597805 AATCTGCACTGTAGACCAAATGG + Intronic
1196980327 X:121206299-121206321 AATCTGCATTATAGACCAAATGG - Intergenic
1196986417 X:121277613-121277635 AATTTGAACTGTAGACCAAGTGG + Intergenic
1197010004 X:121549106-121549128 AAACTGCACTCTAGAACAAATGG + Intergenic
1197069790 X:122282382-122282404 AATCTACACTATAGAACAAAGGG + Intergenic
1197078044 X:122376796-122376818 AATCTGCACTGTAGAACAAATGG - Intergenic
1197139515 X:123101112-123101134 AATCTACACTATAGACCAAACGG + Intergenic
1197307919 X:124866136-124866158 AATCTGCACTATAGACCACATGG + Intronic
1197341326 X:125269728-125269750 AATCTGCACTAGAGACCAAATGG - Intergenic
1197360854 X:125501836-125501858 AATATACACTATAGACCAAATGG - Intergenic
1197365474 X:125560623-125560645 AATCTGCATTATAGATCAAATGG + Intergenic
1197391690 X:125875012-125875034 AACCTGAAGTATAGACCAAATGG - Intergenic
1197406570 X:126060440-126060462 AATCTGCATGATAGACCAAATGG + Intergenic
1197435425 X:126422318-126422340 AATCTGTACTGTAAAACAAATGG - Intergenic
1197437094 X:126444157-126444179 AATCTGCACTCTGGACCAAATGG - Intergenic
1197452320 X:126635118-126635140 AATCTGCACTGTAGAACAAATGG - Intergenic
1197458223 X:126704708-126704730 AATCTGCACTATATAACAATTGG + Intergenic
1197468663 X:126838863-126838885 AATCTGTACTATAGAATAGGTGG + Intergenic
1197514457 X:127408444-127408466 AATCTGCACTATAATGCAAATGG - Intergenic
1197520142 X:127487253-127487275 AATCTGCACTATGGAATATATGG - Intergenic
1197565094 X:128073968-128073990 AAACTACACTCTAGAACAAATGG - Intergenic
1197600609 X:128523287-128523309 ATTCTGCACTATAGATCAAATGG + Intergenic
1197661275 X:129176021-129176043 AATCTGCACTATAAACCAAATGG - Intergenic
1197670326 X:129270127-129270149 AATCTACACTATAAACCAAATGG - Intergenic
1197672149 X:129289245-129289267 AATCTGTACTATTGATTAAATGG + Intergenic
1197677368 X:129344875-129344897 AATCTGCGCTATAGACCAAATGG + Intergenic
1197677916 X:129350328-129350350 AATCTACATTATAGACCAAATGG + Intergenic
1197684614 X:129426640-129426662 AAACTGCACTTTAGACCAAATGG - Intergenic
1197876294 X:131111723-131111745 AATCTGCACTATAGACCAAATGG - Intergenic
1198008905 X:132530497-132530519 AAACTACACTCTAGAACAAAAGG - Intergenic
1198027438 X:132721056-132721078 AATCTGCACTATAGACTAAATGG + Intronic
1198192869 X:134328020-134328042 AAACTGGACTTTAGACCAAATGG - Intergenic
1198293988 X:135266755-135266777 AATCTGCACTATAGAACAAATGG + Intronic
1198559659 X:137835734-137835756 AAACTCTACTCTAGAACAAATGG - Intergenic
1198612241 X:138414615-138414637 AATCTGCACTATAGAACAAATGG + Intergenic
1198664658 X:139007475-139007497 AATCTGAACTATAGACCAAATGG + Intronic
1198702317 X:139411018-139411040 AGTCTGCACTATAGACTAAATGG - Intergenic
1198785199 X:140280442-140280464 AATCTGCACTACAGACCAAATGG - Intergenic
1198795883 X:140393742-140393764 AATCTGCACTACAGACCAAATGG + Intergenic
1198872455 X:141190271-141190293 AATCTGCACTATAAACCAAATGG - Intergenic
1198878670 X:141255147-141255169 AATCTGAACTAGATAAGGAAAGG + Intergenic
1198938656 X:141928551-141928573 ATTCTGCACTATAGAACAAATGG - Intergenic
1198982233 X:142411557-142411579 AATCTGCACTATAGACCAAATGG + Intergenic
1199115200 X:143984344-143984366 AATCTACACTATAGACTAAATGG - Intergenic
1199138728 X:144285422-144285444 CATCTGCACTGTCGAACAAATGG - Intergenic
1199158827 X:144583673-144583695 AAACTGCACTCTAGAACAAATGG - Intergenic
1199162598 X:144631076-144631098 AATCTGCACTGTATATCAAATGG + Intergenic
1199170522 X:144729680-144729702 AAACTACACTGTAGAACAAATGG + Intergenic
1199177939 X:144813860-144813882 AATATGCACTACAGACCAAAGGG + Intergenic
1199196295 X:145034658-145034680 AATCTGCAATATAGACTAAATGG - Intergenic
1199210801 X:145207366-145207388 AATCTGCATTACAGACCAAATGG + Intergenic
1199246110 X:145606010-145606032 AATCTGCACTATAGACCGAATGG + Intergenic
1199247934 X:145628558-145628580 TATCTGCGCTATAGACCAAATGG + Intergenic
1199308456 X:146294803-146294825 AATCTGCACTGCAGACCAAATGG - Intergenic
1199415358 X:147575990-147576012 AATCTGCATTATAGACTAAATGG + Intergenic
1199441286 X:147870534-147870556 AATCTGACCTATAGAATAAATGG + Intergenic
1199485403 X:148341705-148341727 AATGTGCACTATGGAACAAATGG + Intergenic
1199506960 X:148573780-148573802 AAGCTAAAAGATAGAACAAATGG + Intronic
1199584012 X:149393775-149393797 AATCTGCACTGTAGACTAAATGG - Intergenic
1199796115 X:151199266-151199288 AATCTGCACTATAGGTCAAATGG + Intergenic
1199909032 X:152265123-152265145 AATCTGCAGTATAGATCAAATGG + Intronic
1200361451 X:155611481-155611503 AAGCAGAAATACAGAACAAATGG + Intronic
1200364085 X:155642989-155643011 AATCTGCACTATAGACCAAATGG - Intronic
1200435992 Y:3151771-3151793 AATCTGCACTGCAGAACAAATGG - Intergenic
1200458928 Y:3429352-3429374 AATCTGCACTATAGACCAAATGG + Intergenic
1200482102 Y:3718610-3718632 ACTCTGAAATAAATAACAAAGGG - Intergenic
1200503969 Y:3989645-3989667 AGTCTGCACTATGGAGCAAATGG - Intergenic
1200519568 Y:4194852-4194874 AATCTGCACTATACACCAAATGG - Intergenic
1200555597 Y:4632848-4632870 AATCTAAACAATTGAACTAATGG - Intergenic
1200572237 Y:4845924-4845946 AATCTGCACTATAGACAAAATGG + Intergenic
1200605490 Y:5258815-5258837 AATCTGCACTATAGAGCAAGTGG - Intronic
1200608259 Y:5293580-5293602 AATCTGCATAGTAGAACAAATGG - Intronic
1200643948 Y:5758217-5758239 AACCTGTACTCTAGAACAACTGG - Intergenic
1200646859 Y:5796140-5796162 AATCTGTACTATAGAACAAATGG - Intergenic
1200656958 Y:5913669-5913691 AATCTGCACTATAGAACAAATGG + Intergenic
1201351239 Y:13043748-13043770 AAACTGGAATATAGACCAAATGG + Intergenic
1201392054 Y:13509430-13509452 CACCTGAACTACAGAACAGAAGG + Intergenic
1201957030 Y:19636085-19636107 AAACTGCACTGTACAACAAATGG - Intergenic