ID: 1166409670

View in Genome Browser
Species Human (GRCh38)
Location 19:42548096-42548118
Sequence CCTCCCAGAGACCACACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 2, 1: 0, 2: 4, 3: 28, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166409664_1166409670 29 Left 1166409664 19:42548044-42548066 CCTGAGTGTCAGGGGCAGAAAGA 0: 1
1: 0
2: 3
3: 25
4: 313
Right 1166409670 19:42548096-42548118 CCTCCCAGAGACCACACCCTGGG 0: 2
1: 0
2: 4
3: 28
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166409670 Original CRISPR CCTCCCAGAGACCACACCCT GGG Intronic
900380901 1:2383297-2383319 CTTGCCAGAGACCAGACTCTGGG - Intronic
904442473 1:30540700-30540722 GTTCCCAGAGCCCACACCCCAGG + Intergenic
904897512 1:33828048-33828070 CCTGCCAGGGAACAAACCCTTGG - Intronic
904993163 1:34610259-34610281 CCTCCCTCACTCCACACCCTTGG + Intergenic
906344763 1:45008259-45008281 CCTGCCTGGGACCACACACTGGG - Exonic
906543929 1:46608354-46608376 CCTCCCAGAGCCTCCACTCTGGG - Exonic
907735751 1:57110152-57110174 CCTAGCAGAGAGCAGACCCTTGG - Intronic
908793518 1:67807014-67807036 ACTAACAGAGACCACACACTGGG + Intronic
912385445 1:109269102-109269124 CCTCCCAGAGACGCCCCCCGTGG + Exonic
914921572 1:151851036-151851058 CCTACCAGTGACCTTACCCTGGG + Exonic
915266491 1:154721719-154721741 CATCACAGAGGCCACTCCCTGGG - Intronic
918046274 1:180942992-180943014 CCTCCCAGCAAACACACTCTTGG - Intronic
919811606 1:201412318-201412340 CCCCCTAGAGATCACACCCTGGG - Intronic
920211786 1:204333728-204333750 CCTCCCAGAGAGCAGGACCTGGG - Intronic
920299144 1:204977772-204977794 TCTCCCAGACTCCACACCCTGGG - Intronic
920329307 1:205193979-205194001 CCTGCCACATCCCACACCCTGGG + Intronic
920826584 1:209428695-209428717 CCTCTCAGAACCCACACCCCTGG - Intergenic
921359554 1:214318084-214318106 CCACCCAGAGAGAACACCTTCGG + Exonic
921660243 1:217792733-217792755 CCTCCCCGAGACCACAGTCGTGG - Intronic
922586697 1:226738753-226738775 CCGCCCCGAGACCCCAGCCTGGG + Intronic
922785804 1:228281736-228281758 CCCCACAGGGACCAAACCCTGGG - Intronic
923561594 1:235046007-235046029 CTTCTCAGAGAGCTCACCCTGGG + Intergenic
924665517 1:246067606-246067628 CCCCCCACAGCCCACAGCCTTGG + Intronic
1062820472 10:530953-530975 CCGACCAGACACCCCACCCTGGG + Intronic
1063178128 10:3570611-3570633 CTCCCCAGTGACCACTCCCTGGG - Intergenic
1064824937 10:19387740-19387762 CCTCCCAAAGACCACACACTTGG + Exonic
1064927466 10:20584907-20584929 ACTTCCAGAGACCACATTCTTGG - Intergenic
1065185230 10:23164573-23164595 AATCCCAGAAGCCACACCCTTGG - Intergenic
1065622242 10:27594171-27594193 CCTCCAAGAGAGCTCACACTTGG - Intergenic
1066612547 10:37265348-37265370 CATCCCAGAGACCCCACCCTGGG + Intronic
1067027855 10:42859341-42859363 CCTCCCAGAGTTCACTCCCCTGG - Intergenic
1069740674 10:70685190-70685212 CCTCACTGAGAGCCCACCCTGGG - Intronic
1071520296 10:86327371-86327393 ACTGCCAGAGACCCCACCATTGG + Intronic
1072801885 10:98397811-98397833 TATCGCAGAGACCACACCCTAGG - Intronic
1074892692 10:117748683-117748705 CCTGCCAGGGACCAGACTCTTGG + Intergenic
1075298486 10:121299264-121299286 CATCTGAAAGACCACACCCTTGG - Intergenic
1075386935 10:122061786-122061808 GCTCCCAGAGACCCCACCTAGGG - Intronic
1075420817 10:122299148-122299170 CCTCTCAGGGGCCGCACCCTGGG - Intronic
1076249224 10:128972066-128972088 CCTCCCAGACAACACACACAAGG - Intergenic
1076463225 10:130660472-130660494 TCGCCCTGGGACCACACCCTGGG - Intergenic
1076583757 10:131531946-131531968 CCTACCAGAGCCCTCACCCCCGG + Intergenic
1076705430 10:132298679-132298701 CCTCCCAGTGACCCCACACACGG - Intronic
1078723717 11:13908700-13908722 CCTCCCAGAGACATCCGCCTTGG - Intergenic
1079350326 11:19686439-19686461 CCACCCTGAGACCACACAATGGG - Intronic
1083325743 11:61872143-61872165 CCTCTCAGAAAACACACCCCAGG + Intergenic
1083652590 11:64211805-64211827 CATCCCAGAGCCCATACCCCAGG - Intronic
1084212505 11:67630468-67630490 CCTCCCCGCGGCCACACCCCCGG - Intergenic
1084503965 11:69553715-69553737 CCTCCCAGGGTCCACCCCCTGGG + Intergenic
1086103875 11:83128964-83128986 CCTCCCATGGACCACCCCCATGG + Intergenic
1089292218 11:117444209-117444231 GCTCCCAGGGACCAAACCCAGGG - Intronic
1089610531 11:119666237-119666259 CCACCCAGAGAGCACATGCTGGG + Intronic
1090602967 11:128391682-128391704 CCTTCCAGAGAACACACACTAGG + Intergenic
1091214065 11:133889428-133889450 CCTTCAAGGGACCACATCCTCGG + Intergenic
1091548463 12:1519837-1519859 CTGCCCAGAGTCCACTCCCTTGG - Intergenic
1092228420 12:6764078-6764100 GCTCCCAGACACCCCTCCCTGGG + Intronic
1092575789 12:9781702-9781724 CCTCCCAGAGTGCACAGCCCAGG - Intergenic
1094482503 12:30896036-30896058 CATTACAGAGACCACACCATAGG + Intergenic
1096540801 12:52305908-52305930 ACTCACAGAGACCACAACCAGGG - Intronic
1097264862 12:57738848-57738870 CCTCCCAGACCCCAGACCCGTGG - Intronic
1099585077 12:84505208-84505230 CCTCAAAGAGACCACACACAGGG - Intergenic
1100346939 12:93741884-93741906 CTTCCCAGAGACAGCAACCTCGG + Intronic
1102624564 12:114224724-114224746 AGGGCCAGAGACCACACCCTAGG + Intergenic
1102944468 12:116973997-116974019 CCTCCAAGAGATCACAGCCATGG - Intronic
1104692660 12:130838840-130838862 CCGCCCGGAGCCCCCACCCTAGG + Intronic
1104795140 12:131511968-131511990 GCTCCCAGAGTCCCCTCCCTGGG + Intergenic
1105780479 13:23701779-23701801 GCCCCCAGAGACCACAGCCAGGG + Intergenic
1105830577 13:24160602-24160624 ACTCCCTCAGGCCACACCCTCGG - Intronic
1106509330 13:30399317-30399339 CCTCCAAGAGGCCAAGCCCTGGG - Intergenic
1106807042 13:33320319-33320341 CTTCCCAGAGACCACACTCCAGG + Intronic
1109412619 13:61993160-61993182 CCTCCCAGAGAGCAAACAATGGG + Intergenic
1113013978 13:105806537-105806559 CATGCCTGAGACTACACCCTGGG - Intergenic
1113133874 13:107067649-107067671 CCTGCCTGCTACCACACCCTTGG + Intergenic
1113833300 13:113313629-113313651 CCTCCAGGAGGCCACACCCCAGG - Intronic
1113833325 13:113313725-113313747 CCTCCAGGAGGCCACACCCCAGG - Intronic
1118745738 14:68771751-68771773 GCTCCCCGAGACCTCTCCCTGGG - Intergenic
1118852345 14:69593598-69593620 CCTCCCTGACACCTCACCCACGG + Intergenic
1121231019 14:92358533-92358555 CCTCCCAGACACCTCCTCCTGGG + Intronic
1122354441 14:101114597-101114619 GCTCCCAGACTCCACACCCCAGG - Intergenic
1122494059 14:102139668-102139690 CCGCCCGGAGGCCACACCCGGGG + Exonic
1122829633 14:104389484-104389506 CCTCCCAGTGACAACACTCAAGG + Intergenic
1122836371 14:104432852-104432874 CCTCCCGGCGGCCACATCCTAGG - Intergenic
1122919088 14:104872645-104872667 TGCCCCAGAGACCACAGCCTGGG + Intronic
1122955257 14:105067373-105067395 CTTCTCAGAGACAACACCCCAGG - Intergenic
1122969845 14:105148052-105148074 CCTCCCAGGCACCGCTCCCTCGG - Intronic
1123494689 15:20814259-20814281 CCTCCCAGAGACCAGGAACTTGG + Intergenic
1123551184 15:21383352-21383374 CCTCCCAGAGACCAGGAACTTGG + Intergenic
1126806190 15:52351738-52351760 CATGCCAGTGAACACACCCTGGG - Intronic
1126806269 15:52352428-52352450 CTTCCCAGAGACAAAACCTTAGG + Intronic
1126894915 15:53247721-53247743 CCTCACAGAGACCCGACCCCTGG + Intergenic
1127812518 15:62576929-62576951 CCTCCCAGACCTCACTCCCTGGG - Intronic
1128534257 15:68478940-68478962 CCTCCATGGGAGCACACCCTGGG - Intergenic
1129035266 15:72645220-72645242 CCATCCAGAGACCCAACCCTAGG - Intergenic
1129214618 15:74091996-74092018 CCATCCAGAGACCCAACCCTAGG + Intergenic
1129237486 15:74232501-74232523 TCTCCCAGAGCCCCCACACTTGG + Intergenic
1129390822 15:75220141-75220163 CCATCCAGAGACCCAACCCTAGG - Intergenic
1129473514 15:75767943-75767965 CCATCCAGAGACCCAACCCTAGG + Intergenic
1129731752 15:77936342-77936364 CCATCCAGAGACCCAACCCTAGG + Intergenic
1129933623 15:79431951-79431973 CCTCCCCGGGACCGCCCCCTCGG + Intergenic
1130893296 15:88151274-88151296 CCTCTCACAGACCAGACTCTGGG + Intronic
1131538990 15:93260447-93260469 CTTCGCAGAAACCTCACCCTGGG + Intergenic
1131989508 15:98079824-98079846 GCTCCCAGAGACCCTGCCCTTGG + Intergenic
1132336325 15:101050721-101050743 CCTGACAGAGACCAGACCCTGGG - Intronic
1202959526 15_KI270727v1_random:110595-110617 CCTCCCAGAGACCAGGAACTTGG + Intergenic
1132656009 16:1042044-1042066 CCCCACAGTGACCACACCATGGG - Intergenic
1132761073 16:1508950-1508972 CCCCCCAGACACCAGACCCTTGG + Intronic
1133002502 16:2858337-2858359 CCTTCCAGAGGCCACATCCTGGG - Intergenic
1133273570 16:4623739-4623761 CCTTCCAGAGACCACAGTCCAGG - Intronic
1133315439 16:4880671-4880693 CCCCACAGTGAGCACACCCTAGG - Exonic
1134190767 16:12119628-12119650 ACTGCCAGAGGCCACACCCTGGG + Intronic
1135590993 16:23705200-23705222 TCACCCAGAGGGCACACCCTTGG - Intronic
1135608827 16:23847173-23847195 CTTCCCAGAGACCAGACTTTGGG + Intronic
1136058898 16:27711200-27711222 CCCCCAAAAGACCACACCCGTGG - Intronic
1138179174 16:54930790-54930812 CCTCCCACCGACTACACCCCGGG + Intergenic
1138328172 16:56192143-56192165 CCCCCCAGAGAGCAGAGCCTGGG - Exonic
1138416151 16:56872527-56872549 CCTCCCAGTGTCCACACAATGGG - Intronic
1139550602 16:67670711-67670733 CTTGCATGAGACCACACCCTGGG + Intergenic
1139601308 16:67989166-67989188 CATCCCAGTGACCCCACTCTAGG - Intronic
1140895104 16:79317656-79317678 CCTCCCAGAGGGAACAGCCTAGG + Intergenic
1141081113 16:81053591-81053613 CCTATCAGAGACCACAGCCATGG + Intronic
1141565024 16:84895654-84895676 CCTCACAAAGCCCACACTCTAGG - Intronic
1141675708 16:85516159-85516181 CCTCACAGGGACCAGACCCCTGG + Intergenic
1142374195 16:89698340-89698362 CCTCCCATAGGCCAGACCCTAGG + Intronic
1142376352 16:89708888-89708910 CACCCCAGAGGCCACACCCCAGG - Exonic
1142626941 17:1198184-1198206 CCTCCCAGAGGCCACACATGAGG + Intronic
1142712536 17:1731166-1731188 CCTCTCAGACACCACACTCATGG + Exonic
1143027806 17:3951429-3951451 CCCCCCGCAGACCACCCCCTTGG + Intronic
1143705678 17:8696434-8696456 CCTCAGAGAAACCACACTCTGGG - Intergenic
1144126341 17:12206256-12206278 CCTCCGACAGACACCACCCTCGG - Intergenic
1145387543 17:22426850-22426872 CATCTCAGAGACCTCCCCCTAGG + Intergenic
1146456714 17:33014640-33014662 CCTCCCACCCACCACAGCCTGGG - Intronic
1147318942 17:39634476-39634498 CCCAGCAGAGACCACATCCTAGG - Intronic
1147513693 17:41096036-41096058 CCTCCCACACACCCCACCCCTGG - Intronic
1147515795 17:41116325-41116347 CCTCCCAAACACCCCACCCCAGG - Intergenic
1148676966 17:49451338-49451360 ACTTCCAGAGCCCCCACCCTGGG + Intronic
1148906360 17:50914975-50914997 CCACCCAGAGACCGCAGGCTGGG - Intergenic
1148907198 17:50919158-50919180 CCACCCAGAGGGCCCACCCTTGG + Intergenic
1149991312 17:61385051-61385073 CTTGTCAGAGACCACACTCTGGG - Intronic
1151327120 17:73386294-73386316 CCTCCCTGAGACCCTACCCCGGG + Intronic
1151342553 17:73481211-73481233 CCTCCCAGAGGACAGACACTGGG + Intronic
1151442096 17:74136067-74136089 CCTCCCAGAGACTCTCCCCTGGG + Intergenic
1151576618 17:74955697-74955719 CCTCCCAGAGGCCACCTCCTGGG + Intronic
1152377153 17:79924774-79924796 CCACCCAGAGCCCAAGCCCTCGG + Intergenic
1152634854 17:81426740-81426762 CCTGCCTCAGGCCACACCCTGGG + Intronic
1152649139 17:81483906-81483928 CCTCCCAGCGCCCACATCCATGG + Intergenic
1152888751 17:82867935-82867957 CCTCCCGGAGTCCTCCCCCTGGG - Intronic
1157583246 18:48785600-48785622 CTCCCCAGAGACCAAACCCAGGG + Intronic
1157678366 18:49584192-49584214 CCTCCCACAGACCTCATCCATGG - Intronic
1160857687 19:1224683-1224705 CCTCCCAGGCACCTCACCCCAGG - Intronic
1161277183 19:3425054-3425076 CATCACAGAGACCCCACCCCAGG - Intronic
1161550218 19:4908774-4908796 CCTCCCTGAGACCACCAACTGGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1163157661 19:15448288-15448310 CCTGCCAGAGACCCCTCCATCGG + Exonic
1164625158 19:29723053-29723075 CCTCCAAGAGACCCCACCCGTGG + Intergenic
1164876652 19:31695439-31695461 ACTGTCACAGACCACACCCTTGG + Intergenic
1166253881 19:41588947-41588969 CCTCCCAGAGACCACACCCTGGG - Intronic
1166409670 19:42548096-42548118 CCTCCCAGAGACCACACCCTGGG + Intronic
1167516109 19:49924127-49924149 CCTCCCAGAGACTACACCATGGG + Intronic
1167639057 19:50670351-50670373 CCCTCCAGAGTCAACACCCTGGG + Intronic
1168171821 19:54594669-54594691 CCTCCCCAAGCCCACACTCTGGG + Exonic
1168387857 19:55980822-55980844 CCTCCTACAAATCACACCCTTGG - Intronic
1168528285 19:57106089-57106111 CCTTCCTGAGACCACAGTCTGGG + Intergenic
1168641771 19:58035430-58035452 CCTCCCACAGACCTCAGCCCAGG + Intronic
925736794 2:6970722-6970744 TGTCCCAGTGTCCACACCCTCGG + Intronic
926231170 2:11005322-11005344 CCTCCCAGAGACCCCTCCCCAGG - Intergenic
926756804 2:16243085-16243107 CCTTCCACAGACCACACACAGGG + Intergenic
926977197 2:18526759-18526781 CCTCCCAGAAACCTCACCCTGGG - Intergenic
927787164 2:25982048-25982070 CCTCCCAGCGTCCCCACCCTAGG - Exonic
928087822 2:28356730-28356752 TCTCCCAGAGACCACCCACGTGG + Intergenic
928167739 2:28982853-28982875 CCTCCCAGAACCCACCCCCGTGG + Intronic
928430896 2:31217615-31217637 CCTTCCAGAGAACACACAGTGGG - Intronic
928946785 2:36778872-36778894 CCTCCTAAAGACTACACCCCAGG + Intronic
931385443 2:61794018-61794040 CCTCCCCTAGACCCCACCCCCGG + Intergenic
934937452 2:98475750-98475772 CCTCCCAAAGCCCCCACCCCAGG - Intronic
935432070 2:102986997-102987019 CCTCCCAGAGCCCACCCACAGGG - Intergenic
936092990 2:109512758-109512780 TCTCCCAGAGCCTCCACCCTGGG + Intergenic
937131597 2:119518099-119518121 CCCACCAGAGACCAAACCCTTGG + Intronic
937236421 2:120434099-120434121 CCTCCCAGCGACATCACCATGGG - Intergenic
937295085 2:120805228-120805250 CCTCCCAGAGTCCAGACCCCGGG - Intronic
937295633 2:120808248-120808270 CCACACAGAGACCACATGCTTGG - Intronic
939591760 2:144073030-144073052 CCTCTCACAGACCTCACCCAGGG - Intronic
942840949 2:180360096-180360118 CCACCCAGATACCACACACTTGG + Intergenic
946302099 2:218830313-218830335 ATTCCCCAAGACCACACCCTTGG - Exonic
947674115 2:231961828-231961850 CCCCCCAGAGGCCAGACCCCGGG - Intronic
948509547 2:238454553-238454575 AGTGCCAGAGAGCACACCCTGGG + Intergenic
1169112265 20:3041857-3041879 CCTCCCACTGCCCACACCCAGGG + Intergenic
1169193009 20:3669602-3669624 CCACACAGGGACCACCCCCTGGG - Exonic
1170460474 20:16573083-16573105 GCCCCCAGAGGCCACAGCCTGGG + Intronic
1170489860 20:16862001-16862023 CCTCCCAGTGACCACAAATTTGG + Intergenic
1171360916 20:24585839-24585861 CCTCCCTGAGAACACCCCATGGG - Intronic
1171372531 20:24670725-24670747 CCACCCTGGGACCCCACCCTGGG - Intergenic
1172183721 20:33018889-33018911 CCTCCCAGAGGCCAAATCATGGG + Intronic
1173053625 20:39589561-39589583 CCTCCCAGAGGCCCATCCCTGGG - Intergenic
1173430223 20:42981380-42981402 CTTCCCTGTAACCACACCCTTGG + Intronic
1174068532 20:47883390-47883412 CCTCCCACAGCCCTCACCATGGG + Intergenic
1174657859 20:52186727-52186749 ATTCCCAGAGCCCACCCCCTAGG - Intronic
1174815760 20:53685545-53685567 CCTAAGAGAGACCACCCCCTGGG + Intergenic
1175244916 20:57576283-57576305 CCTGCCAGAGGCAAGACCCTGGG - Intergenic
1175715239 20:61251188-61251210 CCTCCCAGAACCCCCACCCTTGG - Intergenic
1175789178 20:61731041-61731063 GACCCCAGAGACCTCACCCTGGG + Intronic
1176151061 20:63590890-63590912 TCTCCCACAGACCTCACCTTTGG - Intronic
1176270076 20:64231758-64231780 CCACCTAGAGGCCACTCCCTGGG - Intronic
1176375195 21:6083525-6083547 CCTGACAGAGGCCACACGCTGGG + Intergenic
1178356191 21:31912271-31912293 CCTTCCAGGCACCAAACCCTCGG - Intronic
1178375586 21:32065028-32065050 TCTCCCAGAGACCAGAGCCTTGG + Intergenic
1179748279 21:43454719-43454741 CCTGACAGAGGCCACACGCTGGG - Intergenic
1180069360 21:45428347-45428369 GATCCCAGAGACCCCATCCTTGG - Intronic
1180964497 22:19779361-19779383 CCTCCCAGCCACCAGGCCCTGGG - Intronic
1180996041 22:19965803-19965825 CCTCCCAATGCCCACCCCCTTGG - Intronic
1181108035 22:20586156-20586178 CTTCCCAGAGGCCACTACCTTGG + Intronic
1181343635 22:22201516-22201538 ACTCGCAGGGACCAGACCCTTGG - Intergenic
1182061192 22:27399016-27399038 CACCCCAGAGATCACACCCTAGG + Intergenic
1182664172 22:31945010-31945032 CCTCCCGGATCCCCCACCCTGGG - Intronic
1183206633 22:36423862-36423884 CTTCCCAGTGCCCACTCCCTAGG - Intergenic
1183304369 22:37074409-37074431 CCTCCCCGAGACCACCTCGTGGG - Intronic
1185089927 22:48760639-48760661 CCTCCCGGATCCCACACTCTGGG - Intronic
949465507 3:4339318-4339340 CCTCCCAGAGACTGCTTCCTTGG - Intronic
950973608 3:17215987-17216009 CCTCCCAGAGTGCAGAACCTAGG + Intronic
953535288 3:43772847-43772869 CCTCCCAGTCACCTCCCCCTAGG - Intergenic
953637449 3:44675253-44675275 GGCCCCAGAGACCACACCCCTGG + Intergenic
953743849 3:45558104-45558126 CCTCCCAGAGGCCTCTCCATGGG - Intronic
953969079 3:47333098-47333120 CCACCCAGAGGCCACACCCCAGG - Intronic
954223020 3:49166105-49166127 GCGCCCAGCGACCCCACCCTGGG - Intronic
954440892 3:50521442-50521464 CCTCCTACAGCCCAAACCCTGGG - Intergenic
954611646 3:51947485-51947507 CCTCCCAGTGACCAAACCCGTGG - Intronic
954662267 3:52232430-52232452 CCTCACGGACACCACACCCCTGG + Intronic
954689639 3:52388770-52388792 CCTCCCAGAGCCCACCCCACGGG + Intronic
955379142 3:58422676-58422698 CCTCACAGAGAACCAACCCTTGG - Intronic
956531003 3:70218517-70218539 CGTTCCAGCAACCACACCCTGGG - Intergenic
962359205 3:134723175-134723197 CCTCCCTGTGTCCACACCCTTGG + Intronic
962837823 3:139204425-139204447 CAGCCCAGAGAGCACAACCTAGG + Intronic
963906240 3:150775236-150775258 CCTCACAGAGCACACAACCTTGG + Intergenic
967928528 3:194672630-194672652 CCTCGGAGAGACCACACCTCGGG - Intergenic
968520404 4:1032436-1032458 CTTCCCAGAGGACACACCCCAGG - Intergenic
968654353 4:1772159-1772181 CCTCCCAGGGACCCCTCCCAGGG - Intergenic
968654364 4:1772184-1772206 CCTGCCAGGGACCAGACCCGGGG - Intergenic
969100452 4:4764282-4764304 CATCCCGGAGACCCCACTCTGGG - Intergenic
969128181 4:4969566-4969588 TCTCCTAGAAACCCCACCCTAGG - Intergenic
971237810 4:24858709-24858731 CCTCCCAGTTCCCACACCCAGGG - Intronic
975047453 4:69823416-69823438 CCTCCCAGAGATCCCCCTCTCGG - Intronic
975888564 4:78995908-78995930 CCTTCCAGAGACCTCCCCGTTGG + Intergenic
976629364 4:87220682-87220704 CCTCCCCGAGGCCACCCCCACGG + Intronic
978944843 4:114482722-114482744 CTTACCAGACACCACACACTAGG - Intergenic
982645998 4:158026325-158026347 CCTCCCAGAGACAGCTCCCAAGG + Intergenic
985487512 5:159771-159793 CCTGCCAGGGAACAGACCCTGGG + Intronic
986032078 5:3904468-3904490 CCTCCCAGAGACCAGGCCCAAGG + Intergenic
991563550 5:67981370-67981392 CCTCCCAGACACGAAACCATTGG + Intergenic
991580843 5:68153490-68153512 CCTCTCAGATACCAAAACCTGGG + Intergenic
991963888 5:72072374-72072396 CCACACAGAGACCTCACCCTAGG + Intergenic
993335810 5:86657159-86657181 CCTCCCAGAGTTCTCACCCATGG - Intergenic
994729587 5:103476181-103476203 GCTCCTGGAGACCACACCCCAGG - Intergenic
998049560 5:139020776-139020798 CCTCCCTGAAAGCACCCCCTTGG + Intronic
998376190 5:141692409-141692431 CCTCCCCGAGACCATCTCCTGGG - Intergenic
998663346 5:144266082-144266104 CCTCTCAGAGGCAACACACTGGG - Intronic
999230641 5:150059872-150059894 CCTCCCTCACCCCACACCCTTGG - Intronic
1002421193 5:179149964-179149986 CCTCACAGAGACCACCCACCTGG - Intronic
1002473357 5:179450662-179450684 CCTCCCAGACTCCAGGCCCTGGG + Intergenic
1002480779 5:179499370-179499392 CCTCCCAGACTCCAGGCCCTGGG - Intergenic
1003545960 6:7058629-7058651 ACTGCCAAATACCACACCCTGGG - Intergenic
1006163239 6:32049956-32049978 CCTCCCACAGCTCCCACCCTGGG + Intronic
1006163864 6:32053346-32053368 CCTCCCACAGGCCCCACTCTGGG + Intronic
1006169759 6:32086104-32086126 CTTCCCAGGGTCCTCACCCTTGG - Intronic
1006405978 6:33845059-33845081 CCTTCCAGAGAGAACACCTTGGG + Intergenic
1006645515 6:35512128-35512150 CCTTCCGCAGCCCACACCCTGGG + Intronic
1006712813 6:36089926-36089948 TCTACCAGAGATCACAGCCTTGG + Intronic
1008142014 6:47842899-47842921 CCTCTGAAAGTCCACACCCTTGG + Intergenic
1008517758 6:52334301-52334323 CCTCCCAGAGGCCTCTGCCTGGG + Intergenic
1009434361 6:63601086-63601108 ACTACCAGAGACCAGACCCAAGG + Intergenic
1015565221 6:134563133-134563155 CCTCCCAGGGGCCAAACCCTGGG + Intergenic
1015883503 6:137892896-137892918 CCTCCCATATACCACACGGTGGG + Intergenic
1018013953 6:159695449-159695471 CCTCCCATATCCCACAACCTTGG - Intronic
1018686580 6:166308282-166308304 CATCCCAGCGACCAAACCCGGGG + Exonic
1020092928 7:5351441-5351463 CCACCCAGAGACCCCAGGCTTGG - Intronic
1020127052 7:5538969-5538991 CCTCCAAGCGCCCACAGCCTAGG - Intronic
1021847494 7:24777315-24777337 CGAACCAGAGACCACACCCATGG + Intergenic
1022470800 7:30681032-30681054 CCTCCCGCAGACCACACACCTGG + Intronic
1023258528 7:38335707-38335729 CCTCCCAGACACCACCCCTCTGG - Intergenic
1023942797 7:44780907-44780929 TCTCCCAGAGACCACAGCTCCGG - Intergenic
1025202016 7:56968317-56968339 CAGCCCAGAGCCCAGACCCTAGG - Intergenic
1025669931 7:63608611-63608633 CAGCCCAGAGCCCAGACCCTAGG + Intergenic
1025941971 7:66081637-66081659 CTTCCCAGAGTCACCACCCTGGG - Intronic
1026654540 7:72245695-72245717 CTTCCCAGACATCACACCATTGG + Intronic
1027139763 7:75648767-75648789 CTGCCCAGAGAGCAGACCCTGGG + Intronic
1029327675 7:99823769-99823791 CCTGGCAGAGAAGACACCCTGGG - Intergenic
1029609782 7:101620745-101620767 CTTCCCAGGGACCACTGCCTGGG + Intronic
1029713755 7:102314528-102314550 CCCCCCAGAGACGACAGCCGTGG + Exonic
1032012812 7:128357878-128357900 CCTCTCAGAAACCTCAGCCTTGG - Intronic
1032394717 7:131581265-131581287 CCTCCCTGTGGCCCCACCCTTGG - Intergenic
1032727277 7:134602376-134602398 CCTCCAAGAGTCCACAGCCCTGG - Intergenic
1036696550 8:10978941-10978963 TCTCACAGAGACCGTACCCTCGG + Intronic
1037753550 8:21697442-21697464 CCTGGCAGAGACCACACCTTGGG - Intronic
1037841103 8:22245579-22245601 CGTTCCAGGGACCTCACCCTCGG + Exonic
1039686419 8:39807076-39807098 CCACCCAGCGACCCCACCCATGG + Intronic
1041148686 8:54908421-54908443 CCTCTCAAAGACCACTCCCATGG + Intergenic
1041456464 8:58066300-58066322 CCTCCCTGAGAACTCACACTCGG + Intronic
1047761951 8:127961052-127961074 CCACCCTAAGTCCACACCCTGGG - Intergenic
1047925672 8:129680223-129680245 CCTCCCAGACACCAAGCACTAGG + Intergenic
1048098952 8:131326148-131326170 CTTCCCAAAGGCCACACCTTTGG - Intergenic
1048985452 8:139732439-139732461 CCTCCCAGAGGCCCCTCCATTGG - Intronic
1049470716 8:142774004-142774026 ACTCCCAGGGACCCCACCCCAGG - Intronic
1049762255 8:144336825-144336847 CCTCCCAGAGACCCCCGCCGAGG - Intergenic
1050410864 9:5363417-5363439 CCTACCAGAGTCCAAAACCTTGG - Intronic
1053015617 9:34660364-34660386 CCTCCCTCCAACCACACCCTCGG + Exonic
1053198309 9:36136578-36136600 CCTCCCGGAGAGCTCACCCCTGG - Intronic
1054802848 9:69368974-69368996 CCTCCCCAGGACCCCACCCTCGG + Intronic
1054813269 9:69451576-69451598 CATTCCATAGACCCCACCCTCGG + Intronic
1059051730 9:110933973-110933995 CTTCCCAGACCCCACATCCTGGG - Intronic
1059671917 9:116500021-116500043 TCTGCCAGACACCACACCCCAGG + Intronic
1059694267 9:116715863-116715885 CCTTTCAGATACCACACCCCAGG - Intronic
1060989120 9:127838306-127838328 CCCCACAGAGTCCCCACCCTGGG + Intronic
1061046655 9:128168961-128168983 CCTCCCGGAGGCCAGACACTGGG - Intronic
1061448901 9:130658275-130658297 CTCCCCAGAGACCACTCCCCAGG - Intergenic
1061995144 9:134179402-134179424 CCTCCAGGAGCCCACACCCGCGG - Intergenic
1062095438 9:134700840-134700862 GCTCCCAGGGACCACACTCCTGG + Intronic
1062501378 9:136853425-136853447 CCTCACTCAGACCACACACTGGG + Exonic
1062514451 9:136925602-136925624 CCTGCCAGTGTCCAGACCCTCGG + Intronic
1062623463 9:137432946-137432968 CCTCGCAGAGCCCACACCAAGGG - Intronic
1062648364 9:137562312-137562334 CCCAGCAGAGACCACACTCTAGG + Intronic
1186950326 X:14617442-14617464 CCTCCCTGTGTCTACACCCTTGG + Intronic
1187526650 X:20060774-20060796 CCTCCCTGGGACCCCTCCCTGGG + Intronic
1189486998 X:41442128-41442150 CCTGCCAAAGGTCACACCCTGGG - Intergenic
1190252619 X:48738581-48738603 CATTTCAGAGACCTCACCCTGGG + Intergenic
1192045912 X:67674321-67674343 GCCCACAGAGACCACTCCCTGGG + Intronic
1193947016 X:87750876-87750898 CTTCCCAGAGACCAAATCTTGGG + Intergenic
1194978609 X:100417270-100417292 CCACCCAGAGACAGCAACCTAGG + Intergenic
1195707292 X:107746941-107746963 CCTCACAGAGTTCACTCCCTTGG + Intronic
1196257191 X:113534582-113534604 ACTGCCAGAGACCAAAGCCTTGG + Intergenic
1198178124 X:134175053-134175075 CCTCCCCCAGACCACAGCCCAGG + Intergenic
1198802378 X:140460801-140460823 CCTCCAATAGACCCGACCCTTGG + Intergenic
1199253541 X:145692755-145692777 CTTCTCACAGTCCACACCCTAGG - Intergenic
1199715541 X:150505208-150505230 CCTTCTAGAGACCTCACCCATGG - Intronic
1200076063 X:153551829-153551851 CTTCCCGGACTCCACACCCTTGG + Intronic