ID: 1166412214

View in Genome Browser
Species Human (GRCh38)
Location 19:42563141-42563163
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 3, 1: 0, 2: 5, 3: 69, 4: 539}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166412214 Original CRISPR CCTGATTTGTAAAAGGAGGA TGG Intergenic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
903137835 1:21320960-21320982 CCTGGTTTGGAAAAGGGGAAAGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903754316 1:25650208-25650230 CCTGATTTATAAAAGCAAGAAGG - Intronic
904982195 1:34515210-34515232 CCTGATTGGTGAAAAGAGGCTGG - Intergenic
905254560 1:36671849-36671871 CATGACTGGTATAAGGAGGATGG - Intergenic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905861034 1:41351605-41351627 CCTGATTAGAACAAAGAGGAGGG + Intergenic
906431988 1:45762466-45762488 CATGATTTGTGAAAAGAAGAAGG + Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906834075 1:49064045-49064067 TCTGATTTGTAAAATGGGAATGG + Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908239529 1:62177064-62177086 CCTGAATTCCAAAAGGAGAATGG - Intergenic
908494540 1:64681088-64681110 CATGTTTTTTTAAAGGAGGAGGG - Intronic
909391852 1:75129136-75129158 TCTCATTTGTAAAATGAAGATGG - Intronic
910559450 1:88575104-88575126 CCTAATTGTTAAGAGGAGGAAGG + Intergenic
910577149 1:88777780-88777802 CCTGAATTCCAAAGGGAGGAAGG - Intronic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
911491566 1:98575540-98575562 CCAGAGTTGGAAAAGGAGAAAGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911646093 1:100338442-100338464 CCTGAATTCTAAAGGGAGGAGGG + Intergenic
911704556 1:100996361-100996383 TCTGATTTTTAAAAGGAAGAGGG + Intronic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912940260 1:114038553-114038575 CCTGAATTCCAACAGGAGGAAGG - Intergenic
914044594 1:144080050-144080072 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
914133516 1:144880636-144880658 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
915632359 1:157162437-157162459 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
916016846 1:160757342-160757364 GCTGATCTGGAAAAGGAGGTGGG + Intergenic
916508023 1:165445494-165445516 TTTGATCTGTGAAAGGAGGAGGG + Intergenic
916805768 1:168259919-168259941 CCTGATTTTTAAATGGACAAAGG - Intergenic
917231992 1:172847216-172847238 CCTCATTTGTTAAAGGGAGATGG - Intergenic
917370925 1:174293298-174293320 CCTATTTTGTTAAAGGAGTAAGG - Intronic
917823625 1:178792998-178793020 CCTGATTTTACAAAGGGGGAGGG - Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918892312 1:190291473-190291495 CCTGATTTGAAAATGAAAGAAGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
921568776 1:216753467-216753489 ACTGTTTTTTAAAAGGAGGGTGG - Intronic
921630874 1:217432185-217432207 CCTTATTTGAAAAAGGAGATTGG + Intronic
921665833 1:217869701-217869723 CCTGAATTCCAAAGGGAGGAGGG + Exonic
921790929 1:219289753-219289775 CTTAATTTATAAAATGAGGATGG - Intergenic
922166472 1:223119570-223119592 CCTGAATTCCAAAGGGAGGAGGG - Intronic
923187796 1:231590826-231590848 CACGATTTGTAAATTGAGGAAGG - Intronic
923325043 1:232873499-232873521 CCTGTTCAGTAAGAGGAGGATGG + Intergenic
923328790 1:232903486-232903508 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923955222 1:239010124-239010146 CCTGATCTATAATAGGAGGAAGG - Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924661497 1:246022934-246022956 CCTGATTTGAAAAAGGGAAATGG - Intronic
1062839835 10:661654-661676 CCACATTTGGAAATGGAGGAAGG - Intronic
1063371796 10:5527019-5527041 CCTCGTTTGTAAGATGAGGAAGG - Intergenic
1063986134 10:11504888-11504910 CCAGAGTGGTAAAAGAAGGATGG + Intronic
1064066076 10:12182664-12182686 CCTGATTAGGAAATGCAGGAAGG + Intronic
1065212453 10:23417461-23417483 CCTGAATTCTAAAGGGAGGAGGG - Intergenic
1065825184 10:29564226-29564248 CCGGATCTGTAAACTGAGGATGG - Intronic
1065952222 10:30662684-30662706 CCAGATCTGTAAACTGAGGATGG + Intergenic
1066192899 10:33072048-33072070 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1066336821 10:34486238-34486260 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1066956721 10:42179737-42179759 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1067144539 10:43685030-43685052 GCAGATTTGTAAAAGTGGGATGG + Intergenic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1068972769 10:62976942-62976964 TCTGATTTGTAAGAGGAAAAGGG - Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069176659 10:65297873-65297895 CCTATTTTTTAAAAGGGGGAAGG + Intergenic
1069248721 10:66243075-66243097 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1070095710 10:73336486-73336508 AATAATTTGTAAAATGAGGATGG - Intronic
1070333192 10:75432192-75432214 ACTTATTTGTAAATGGAGGAAGG + Intronic
1071012697 10:80956201-80956223 CCAGATTTGAAACAGGAGTAAGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071863040 10:89695539-89695561 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1075226084 10:120630453-120630475 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
1076832496 10:133003317-133003339 CCTGAATTCCAAAAGGGGGAGGG + Intergenic
1076902305 10:133345951-133345973 CCTGAATTCCAAAAGGAGGCGGG + Intronic
1077559194 11:3246792-3246814 CCTGAATTCCAAAGGGAGGAAGG + Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078583175 11:12556222-12556244 CCCCATTTCTAAAAGGAAGACGG - Intergenic
1079576589 11:22011108-22011130 CCTCATTTATAAAATGAGAATGG + Intergenic
1080964333 11:37196510-37196532 GCTGATTGGTAAAAAGAGGCTGG - Intergenic
1081154057 11:39667262-39667284 CCTGAATTCTAAAGAGAGGAGGG - Intergenic
1081226025 11:40523353-40523375 CCTGATTTTAAAAATGAGAAAGG - Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1083083108 11:60113981-60114003 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1083175968 11:60950863-60950885 CCTGATTTGAAAGAAGAGGGGGG - Intronic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085619610 11:78027956-78027978 CCTGAATTCCAAAAGGGGGAAGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085831028 11:79901134-79901156 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1086022846 11:82252766-82252788 CTTTATTTGTGAAAGGATGATGG - Intergenic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1087382024 11:97417393-97417415 ACTGATTAGTAAAATGAGAAAGG - Intergenic
1087387952 11:97497081-97497103 CCTGATTAGAAATAGGAGGAAGG + Intergenic
1087576233 11:99993373-99993395 CCTCATTTCTAAAAGAAGAAGGG + Intronic
1087785689 11:102351844-102351866 CGTTGTTTGTAAAATGAGGAGGG + Intronic
1088117118 11:106325094-106325116 TCTGCTCAGTAAAAGGAGGATGG - Intergenic
1088330031 11:108641891-108641913 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1089467272 11:118693310-118693332 CCTGATTTGTCAAAGGAAGGTGG + Intergenic
1089574908 11:119435197-119435219 CCTGGTTTGTGAAAGGGGGATGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089817759 11:121191412-121191434 GTTGATTTGTAAAAAGAGAAGGG - Exonic
1090290057 11:125535390-125535412 CCTGAATTTCAAAGGGAGGAGGG - Intergenic
1091807978 12:3369605-3369627 CCTTATTTGGAAAAATAGGAGGG + Intergenic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1092669499 12:10847194-10847216 GCTGATTTTGAAAAGGAGGTGGG + Exonic
1092895618 12:13007466-13007488 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
1092980350 12:13788524-13788546 CCTCATTTTTAAAACGAGGTTGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094215606 12:27938893-27938915 GCTGATTTTAAAAAGGATGAAGG + Intergenic
1094261772 12:28508564-28508586 CCTGATCAATAAAAGGAGGTAGG - Intronic
1095481358 12:42639278-42639300 CCCTATTTGTAAAATGAGGAGGG - Intergenic
1097079885 12:56422191-56422213 CCTGAATGGTGAAAGGAGAAAGG + Exonic
1097371387 12:58785661-58785683 CCTTATTGGGGAAAGGAGGAAGG + Intronic
1097459768 12:59846631-59846653 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1098876591 12:75872160-75872182 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1099956509 12:89355905-89355927 ACTGGTGTGTAAAAGGAGCAGGG - Intergenic
1100029325 12:90166638-90166660 CCTGAGTTGTAAAAGGCATAAGG - Intergenic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1100784635 12:98065910-98065932 CCTTATAAGTAAAAGTAGGAAGG + Intergenic
1101002546 12:100371228-100371250 CCTCATTTATGAAAGGAAGATGG - Intronic
1101462458 12:104910631-104910653 CCTGAATTTTAAAGGGAAGAGGG - Intronic
1102099932 12:110270444-110270466 CCTGATTTCAAATAGGGGGAGGG - Intergenic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102444412 12:112990826-112990848 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1102757176 12:115351232-115351254 CCTTATTCTTAAAGGGAGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104355331 12:128080174-128080196 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1104402423 12:128487246-128487268 GCTGATTAGAACAAGGAGGATGG - Intronic
1104530471 12:129565473-129565495 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1104694071 12:130850164-130850186 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106276184 13:28209808-28209830 CCAGAGTGGTAAAAGGAGAAAGG - Intronic
1106836272 13:33638691-33638713 CCTGAATTCTAAAAGGAGGAAGG + Intergenic
1107117411 13:36762052-36762074 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1107519330 13:41163596-41163618 TGTGTTTTGTAAAGGGAGGAGGG - Intergenic
1108751716 13:53454445-53454467 CCTAGTTTCTTAAAGGAGGAAGG - Intergenic
1108926045 13:55746503-55746525 ACTCATTTGGAAATGGAGGAAGG + Intergenic
1109177644 13:59176083-59176105 CCTGAATTCCAACAGGAGGAGGG + Intergenic
1110366848 13:74696369-74696391 CCTGCATTATAAAAGGCGGATGG - Intergenic
1113077384 13:106480476-106480498 CATGATGTGAAAAAAGAGGAAGG + Intergenic
1113373345 13:109742020-109742042 CCTGAGGTGGAACAGGAGGATGG - Intergenic
1113479775 13:110612009-110612031 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1113699262 13:112372061-112372083 CCTGATCTGAAATACGAGGACGG - Intergenic
1113907675 13:113827521-113827543 CCTTATCTGTGAAACGAGGAGGG + Intronic
1114004825 14:18301121-18301143 CCTGATTAGTAGGAGGAGGCAGG - Intergenic
1114426300 14:22626425-22626447 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
1114826728 14:26089895-26089917 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1115933535 14:38526049-38526071 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116953266 14:50897875-50897897 CCTAATTTGTAACAGAAAGAGGG - Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118160731 14:63287332-63287354 CCTGAGCTGTGAAATGAGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121126823 14:91413329-91413351 CCTGATCTGTAATAAGGGGATGG - Intronic
1121425011 14:93844331-93844353 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1202936396 14_KI270725v1_random:92023-92045 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1124208749 15:27744880-27744902 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1124828983 15:33129303-33129325 CCTCATTTGGAAAAGAAGTATGG - Intronic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1126158284 15:45585590-45585612 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1127560373 15:60130380-60130402 CATAATTTGTAAAGGTAGGAAGG - Intergenic
1128078860 15:64844364-64844386 CCTCCTTTGTAAAAGGAAAAGGG + Intronic
1128221704 15:65973881-65973903 CAGGATTTGTAAATGGAGCAGGG + Intronic
1128446293 15:67764253-67764275 TCTGTTTTGTATAAGGAGAAGGG + Intronic
1128736731 15:70057845-70057867 CCTGCTCTGTAAAAAGAGGTGGG - Intronic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129263581 15:74382328-74382350 CCTGATCTGTACAAAGAGTAGGG - Intergenic
1129937701 15:79464441-79464463 CCTCATTTGTAAACTGAAGATGG - Intronic
1130695050 15:86122835-86122857 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130960554 15:88656026-88656048 TCCTATTTGTAAAATGAGGAAGG + Exonic
1131655992 15:94459678-94459700 CATGAATAGTAAAATGAGGAGGG + Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134912217 16:18037939-18037961 GCTGATTGTTAAAAGGAGGCTGG + Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1137509404 16:49085753-49085775 CCTATTTTTTTAAAGGAGGAAGG - Intergenic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137833138 16:51563519-51563541 CCAGAGTTGTAAAAAGAGTATGG - Intergenic
1138031605 16:53563659-53563681 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138261721 16:55628405-55628427 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1138898482 16:61239810-61239832 CCTCATTTCCAAAAGGAGTAGGG - Intergenic
1138950944 16:61912155-61912177 CCGTATTTATAAAAGGAGTATGG + Intronic
1141271635 16:82546266-82546288 CCTGATCTGTAAAATCAAGATGG - Intergenic
1143280169 17:5748035-5748057 CCTGGCTGGTGAAAGGAGGACGG - Intergenic
1144138774 17:12324758-12324780 CCTGATTTGCAAAAAGGTGAGGG + Intergenic
1145031848 17:19510447-19510469 CCTGAATTCCAAAGGGAGGAAGG + Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146350363 17:32087043-32087065 CCTCATTTATAAAATGAAGATGG + Intergenic
1146411116 17:32586225-32586247 CCTGAATTTTAAGAGGATGAGGG - Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147790961 17:43014091-43014113 CCTGATCTGGAAAAGGAGCCAGG - Exonic
1148020393 17:44549390-44549412 CCTGAGATCTAAATGGAGGATGG + Intergenic
1148335378 17:46837525-46837547 CCTTATTTGTAAAACGAGGGTGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1148951839 17:51320168-51320190 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1149453037 17:56765106-56765128 GCTGCTTTGTCAGAGGAGGACGG + Intergenic
1150610414 17:66728772-66728794 GGTGACTTGTCAAAGGAGGAAGG + Intronic
1150631623 17:66884428-66884450 CCTGAATTGCAAAGGGAGGTGGG + Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1150879422 17:69006615-69006637 AATGATTTTTACAAGGAGGAGGG + Intronic
1151922510 17:77168082-77168104 CGTGATTTGTAAGAGAAGGAGGG + Intronic
1151923443 17:77174999-77175021 CATGATTTGTAAGAGAAAGAGGG + Intronic
1151997598 17:77619931-77619953 CCTGATTTCAAAAAGGGGCAAGG - Intergenic
1153413515 18:4820479-4820501 CCTGATTTGTGAGAGAAGGGAGG + Intergenic
1153433000 18:5039238-5039260 CCTGAATTCCAAAGGGAGGAAGG + Intergenic
1153466088 18:5389374-5389396 GCTGATCTGTAAAATCAGGAAGG + Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154114430 18:11598758-11598780 CCTGAATTCTAAAAGGAAGGAGG - Intergenic
1154974077 18:21439948-21439970 CCCATTTTGTAAAAGGAGAAAGG - Intronic
1155579489 18:27287013-27287035 CCTCATTTATAAAATGAGAATGG - Intergenic
1155736310 18:29226719-29226741 CCTGAATTTCAAAGGGAGGAGGG - Intergenic
1155874991 18:31075158-31075180 GCTGATTTGTGAGAAGAGGAAGG + Intronic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156133218 18:34003896-34003918 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157465461 18:47940659-47940681 GCTGATTTTTAAAAGTAGTACGG - Intergenic
1157597664 18:48873684-48873706 CCCCATCTGTAAAAGAAGGATGG + Intergenic
1157876886 18:51282072-51282094 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159359905 18:67386585-67386607 CCTGATTTGTGAGAGAAGAAAGG - Intergenic
1159602654 18:70443317-70443339 TGTGATTTGTAAGAGAAGGAGGG + Intergenic
1161169195 19:2804634-2804656 CCTCATGTGTGAAGGGAGGAGGG - Intronic
1161651672 19:5489613-5489635 CCTGATTTGGAACTGGGGGATGG - Intergenic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1164004668 19:21137440-21137462 CCTGATCTCTAAAAGGAAGGTGG - Intergenic
1165391089 19:35539313-35539335 CCTGAATTCCAAAGGGAGGAAGG + Intronic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166395540 19:42437538-42437560 CCTGATTTGTGAAAGGAGGGTGG + Intronic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1167725467 19:51209864-51209886 CCTTATATTTAAAAAGAGGATGG + Intergenic
1168541355 19:57213165-57213187 AATTATTTTTAAAAGGAGGAGGG + Exonic
1202684153 1_KI270712v1_random:33469-33491 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925958321 2:8991806-8991828 GCTGATTTGTCAAGGGAAGATGG - Intronic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
927168276 2:20346968-20346990 CATGAAGTGTAAAAGGAGAAGGG - Intronic
927323140 2:21771569-21771591 CCTTATTTGTAACAAGATGAAGG + Intergenic
927890622 2:26745855-26745877 CATCATTTGTAAAAGCTGGATGG + Intergenic
928200399 2:29244279-29244301 CCTCATTTGTGAAATCAGGATGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928255463 2:29718484-29718506 CCTTTTTTGTTAAAGAAGGAAGG + Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928914443 2:36456485-36456507 ACTAGTTTGGAAAAGGAGGAAGG - Intronic
929024821 2:37589961-37589983 CCTCATTTTTAAAATGAGAACGG - Intergenic
929697018 2:44126366-44126388 CCTCATTCATAAAATGAGGATGG - Intergenic
930488339 2:52037020-52037042 CCTGAATTCCAACAGGAGGAAGG - Intergenic
930875804 2:56214236-56214258 TCTCATTTGTAAGAAGAGGATGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931191955 2:60010218-60010240 CCGGCTTTGAAAATGGAGGAAGG + Intergenic
931394854 2:61878187-61878209 ACTGATTTTTAAAAGGAAAAAGG + Intronic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932516687 2:72358332-72358354 CCTCATTTATAAAATGAGAAAGG - Intronic
932959719 2:76398346-76398368 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
934247567 2:90321383-90321405 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
934261756 2:91481218-91481240 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
934304797 2:91812197-91812219 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
934328460 2:92040553-92040575 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
934466839 2:94271068-94271090 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
934881358 2:97983308-97983330 CCTGAATTCCAAAGGGAGGAGGG + Intronic
936586439 2:113762548-113762570 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
938337702 2:130513812-130513834 CCTGATTTGAACAGGAAGGAGGG - Intergenic
938352137 2:130606923-130606945 CCTGATTTGAACAGGAAGGAGGG + Intergenic
939010300 2:136838626-136838648 CCTCATTTTGAAAGGGAGGATGG - Intronic
939098578 2:137866786-137866808 CCTGATGTCCAAGAGGAGGAAGG - Intergenic
939197854 2:138995022-138995044 ACTGAATTGTAAAGTGAGGAAGG + Intergenic
941172230 2:162153258-162153280 CCTTATTTGTAAAATGAGAGGGG + Intergenic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
942138387 2:172952395-172952417 TTAGATTTGTAAAAGGAGGAGGG + Intronic
942177420 2:173347506-173347528 CCTGATTAGAAAAAGGAATATGG - Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942412471 2:175725339-175725361 CCTGATTTTTAATAGAGGGAGGG - Intergenic
942586416 2:177484235-177484257 ACTGATTTGTGTAAGGATGAAGG + Intronic
942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG + Intergenic
943111017 2:183606068-183606090 CTTGATTATTAAAAAGAGGAAGG - Intergenic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
943400109 2:187398100-187398122 CCCAATTAGTAAAAGGTGGAAGG + Intronic
943722161 2:191216426-191216448 ACTGATTGGAAAAAGGAGGGAGG + Intergenic
943939255 2:193970203-193970225 CCTGGTTGTTAAAACGAGGATGG - Intergenic
944635945 2:201676255-201676277 CCTCATTTCTAAAGTGAGGAAGG - Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945339800 2:208639505-208639527 CCTGATATGGACCAGGAGGAAGG + Intronic
945647805 2:212522221-212522243 CCTTGTTTGTAAAATAAGGATGG + Intronic
946437059 2:219664210-219664232 TCTGTTGTGCAAAAGGAGGAGGG + Intergenic
947438873 2:230099575-230099597 CCAGCTTTGTAAAAGGACAAAGG - Intergenic
947814671 2:233028416-233028438 TCTGAATTCCAAAAGGAGGAAGG - Intergenic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948191897 2:236065695-236065717 CCCCATTTTTAAAAGGATGATGG - Intronic
948329620 2:237154809-237154831 CCAGATTTCTAGAAGGAGCAGGG + Intergenic
1168845857 20:944355-944377 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1169986259 20:11448219-11448241 TTTGTCTTGTAAAAGGAGGACGG + Intergenic
1171165207 20:22964178-22964200 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1171531927 20:25858800-25858822 CCTGCTCTTTCAAAGGAGGAGGG - Intronic
1171837329 20:30168794-30168816 CCTGCTCTTTCAAAGGAGGAGGG - Intergenic
1172973427 20:38889624-38889646 CCTGATTTGTGCAATGAGGACGG + Exonic
1173004000 20:39125803-39125825 CCTGATATGTAAAAGGTTGGAGG + Intergenic
1173133284 20:40414754-40414776 CCTGATTTCTAAGAAGAAGAGGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173284291 20:41656190-41656212 GCTCATTTGAGAAAGGAGGAAGG - Intergenic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1175169297 20:57068813-57068835 CCCTATCTGTAAATGGAGGAGGG + Intergenic
1175436120 20:58950348-58950370 CTTAATTTGTAAAAGAAGGGAGG + Intergenic
1176071458 20:63228869-63228891 CCTGAACTCCAAAAGGAGGAGGG + Intergenic
1176362877 21:6012898-6012920 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1176587103 21:8597576-8597598 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1177535182 21:22417329-22417351 CCTAATTTTAAAAATGAGGAAGG - Intergenic
1177801727 21:25834614-25834636 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1177890499 21:26798652-26798674 GCTGCTTTGAAAATGGAGGAAGG - Intergenic
1177890789 21:26801521-26801543 CCTGATTTGAAATAGTAGAAGGG + Intergenic
1178265779 21:31141721-31141743 CCTGATGAGTTAAAGGATGACGG + Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178438425 21:32579537-32579559 CCTGATTTGAAGAAACAGGATGG - Intronic
1179760641 21:43525647-43525669 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180269932 22:10574573-10574595 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1180429339 22:15231911-15231933 CCTGATTAGTAGGAGGAGGCAGG - Intergenic
1180587976 22:16910290-16910312 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1182006259 22:26962133-26962155 CCTCATTTCTGAGAGGAGGAAGG + Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182501713 22:30752945-30752967 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1184803025 22:46774090-46774112 CCTGAGTTCAAACAGGAGGATGG - Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949461783 3:4302549-4302571 CCTGAATTCCAAAAGGAAGAAGG + Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952033796 3:29175835-29175857 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
952244008 3:31565209-31565231 TCAGAGTTGTAAAAGCAGGAAGG + Intronic
953409961 3:42685319-42685341 CCTCATTTCTAAATGGAGCACGG - Intergenic
953505409 3:43481535-43481557 CCTGAATTCCAAAGGGAGGAGGG - Intronic
954440519 3:50519349-50519371 CCTGACTGGTACGAGGAGGAAGG - Intergenic
954445583 3:50545089-50545111 CATGTTTTTTAAAAGGAAGAAGG + Intergenic
954489672 3:50891402-50891424 CATGTTTTGTAAAAGGAGAAGGG - Intronic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954842819 3:53526871-53526893 CCTAATTTGTCAAATGAGCAGGG + Intronic
955812145 3:62802739-62802761 CCTGATTTGAAAAACTATGAAGG - Intronic
955990444 3:64621459-64621481 CTTTATTTGTAAAAGTAGGTAGG + Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956258847 3:67314654-67314676 CCTTAATTGTCATAGGAGGATGG - Intergenic
956498697 3:69857483-69857505 CCTTATGTGAAAAAAGAGGAAGG - Intronic
956531757 3:70227767-70227789 CCTCATTTGTAAAACATGGAGGG - Intergenic
957305238 3:78449327-78449349 CCTGAATTCCAAAAGGAAGAGGG - Intergenic
960135844 3:114103965-114103987 CCTGACTTGTTAGAGGAGGTTGG + Intergenic
960397341 3:117153553-117153575 CTTGCTTTTTAAAAGGAGGTCGG - Intergenic
960789597 3:121413870-121413892 TCTTATTTGTAAAATGAGGGGGG - Intronic
961036706 3:123647522-123647544 CCTTACTTATAAAAGGAGGTGGG - Intronic
963747227 3:149136615-149136637 CCTGATGTATAAAATGAGGAGGG + Intronic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965881830 3:173396569-173396591 CCTGTTTTTTAAAAGGGGGAGGG + Intronic
965959503 3:174412116-174412138 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
967328288 3:188264553-188264575 GCTGATTTTTAAAATGAGGTAGG + Intronic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969383864 4:6829486-6829508 ACTGATTTTTAAAAGATGGAAGG - Intronic
970067282 4:12112928-12112950 CCGGATTTATAAAATGAGTAAGG + Intergenic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970327659 4:14944148-14944170 CCTTCTTTGTAAAAGGTGGGTGG - Intergenic
970707045 4:18816747-18816769 ACTGATTGTTAAAAAGAGGATGG + Intergenic
970724791 4:19031051-19031073 CCTGTTTTGTAAAATGGAGATGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971851860 4:31994492-31994514 CCTGAATTCCAATAGGAGGAGGG + Intergenic
971970409 4:33612445-33612467 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
972324883 4:38006027-38006049 CCTGCTATGTAAAATGAGAAAGG - Intronic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
973653544 4:53021976-53021998 CCTGGTGTGAAAAATGAGGAGGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
974669856 4:65015367-65015389 CCTGATTTCCAAAGGGAGGAAGG + Intergenic
975037608 4:69704012-69704034 CCTGATGTGTTAAGGGTGGAAGG + Intergenic
975797297 4:78020936-78020958 ACTTATTTGTAATACGAGGAGGG - Intergenic
977659809 4:99570798-99570820 CTGGATTTGTAAATGCAGGAAGG + Intronic
977681321 4:99801555-99801577 CCTGAATTCCAAAAGGTGGAGGG + Intergenic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
979544741 4:121926892-121926914 CCTGATTTAGAAACTGAGGAAGG + Intronic
979621875 4:122807074-122807096 CCTAGTTTGTAAAAGGAGTTGGG + Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
981296117 4:143133813-143133835 CCTGTTTTACAAAAGGAGAAGGG - Intergenic
981312314 4:143309240-143309262 CCTGAATTCTACAGGGAGGAAGG + Intergenic
981344079 4:143655012-143655034 CCTGGTGTGGAAATGGAGGATGG - Intronic
981467342 4:145088475-145088497 CCTGAGTTGAGAAAGAAGGAGGG - Intronic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
982269895 4:153575731-153575753 TCTGATTTGTTAAAGGAGTATGG + Intronic
982391755 4:154872282-154872304 CCTGAATTCCAAAAGGAGGGAGG + Intergenic
982415013 4:155120769-155120791 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
982464760 4:155716286-155716308 CCTCAATTGTGAAAGGATGAGGG - Intronic
983439998 4:167769767-167769789 CCTGTTTTTAAAAAGAAGGAGGG + Intergenic
984366121 4:178802365-178802387 CCCCAATTGTAAAAGAAGGAAGG - Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989771870 5:45155047-45155069 CCTAATTAGTGAAAGGAGGTAGG - Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990902779 5:60771186-60771208 CCAGAGTTGGAAAAGAAGGAAGG + Intronic
991410255 5:66338660-66338682 CCTTATTTGGAAGAGGAGGTGGG + Intergenic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
994294828 5:98078387-98078409 CCTTATTTGTAAAATGGAGATGG - Intergenic
994529504 5:100951229-100951251 GCTGAATTGGAAAAGGAGAAGGG - Intergenic
994859253 5:105167338-105167360 CCTGAATTGTAAAGGGTGGAGGG - Intergenic
994867384 5:105293650-105293672 CCTGAATTCCAAAAGGAGGAGGG - Intergenic
995036014 5:107535119-107535141 CCTGTATTGTAAAGAGAGGAGGG + Intronic
995099302 5:108278889-108278911 CCTGTCTTGTCAAAGGAGGTTGG - Intronic
995109825 5:108416857-108416879 CCTGAATTCCAATAGGAGGAGGG - Intergenic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
995594346 5:113731724-113731746 CCTGAATTCTAAAAGGGAGAAGG + Intergenic
995626073 5:114077599-114077621 ACTGAAGTGTGAAAGGAGGAAGG - Intergenic
995662239 5:114498369-114498391 CCACAGTTTTAAAAGGAGGAGGG + Intergenic
996207543 5:120760198-120760220 ACAGATTAGTAAGAGGAGGATGG + Intergenic
996998123 5:129724369-129724391 CCTGAATTCCAAAGGGAGGAGGG + Intronic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
999464731 5:151791968-151791990 TTTGATTTGTAAATGAAGGATGG + Intronic
999480462 5:151943202-151943224 ACAGATTTGTACAAGCAGGAGGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000592593 5:163176557-163176579 CCTGATGTGAAAGAGGAGGAGGG + Intergenic
1000632168 5:163602947-163602969 CCTCATTTGTAAAATAAAGATGG - Intergenic
1000875296 5:166630063-166630085 CCTCATTTATAAAAGAATGATGG + Intergenic
1001233402 5:170009363-170009385 CCTGATCAGTAAAAGGATGGGGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002859081 6:1064192-1064214 CCTGACTTGGAAAAGGAGGAAGG - Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007897133 6:45374392-45374414 CCTCATTTATAAAATGAAGATGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1009320953 6:62287167-62287189 CCGCATTGGTAAAAGAAGGATGG - Intergenic
1010584663 6:77643218-77643240 CCTGAATTCCAACAGGAGGAAGG + Intergenic
1011602762 6:89075246-89075268 CCTCAGTGGTATAAGGAGGAGGG + Intergenic
1012318564 6:97813572-97813594 CCTTATTTGTAAAATTATGATGG - Intergenic
1013860022 6:114624430-114624452 CCTGATTTGGGAAAGGAGGCTGG + Intergenic
1013888184 6:114996665-114996687 CCTGAATTCTAAAGGGAGGAAGG + Intergenic
1014686850 6:124512397-124512419 CATTAAATGTAAAAGGAGGAAGG + Intronic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1017379448 6:153811837-153811859 ACTGATTGTTAAAAGGAGGCTGG - Intergenic
1018218315 6:161552220-161552242 CCGGAATTGTAAAAGGAAGCGGG + Intronic
1018486908 6:164249843-164249865 CCTGCATTTGAAAAGGAGGATGG - Intergenic
1018513738 6:164555258-164555280 ACTGATTTGCAAAGCGAGGAGGG + Intergenic
1019024717 6:168949457-168949479 CCTGATTAGGAAAAGGAGCCAGG - Intergenic
1019082402 6:169443938-169443960 CATTATTTATAAAAGGAAGATGG + Intergenic
1019219851 6:170464670-170464692 CCTGAGTTCACAAAGGAGGAAGG - Intergenic
1019446673 7:1074853-1074875 TCTGATCTGTGAGAGGAGGAAGG - Intronic
1020156223 7:5726920-5726942 CCTGATTTGAAACGGAAGGAAGG + Intronic
1020782104 7:12530513-12530535 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1021071184 7:16243082-16243104 CCTGATGTGTCAAGGGAGGGAGG + Intronic
1021390419 7:20086209-20086231 CCTGAGTTCTAAAGGGAGGAGGG - Intergenic
1021403597 7:20238069-20238091 CCTGGTCTGAAAAGGGAGGAGGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1025005896 7:55354499-55354521 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
1025253734 7:57369203-57369225 CCTGATATGTTCCAGGAGGAGGG - Intergenic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026247424 7:68633662-68633684 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1026406757 7:70073772-70073794 CCTTAGTTGTATAAGGAGGAAGG - Intronic
1026667737 7:72358374-72358396 TCTGATTAGTAAATGGAGAAAGG + Intronic
1026953330 7:74361695-74361717 CCTGATGTGTAAAATGAGAATGG - Intronic
1027440505 7:78214384-78214406 ATTGATTTTTAAATGGAGGATGG - Intronic
1027620683 7:80481400-80481422 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1027650270 7:80858163-80858185 AGTTATTTGTATAAGGAGGAAGG + Intronic
1028358292 7:89936247-89936269 CCTGTGTTGTAAAAGGAGCTAGG + Intergenic
1028435944 7:90803783-90803805 CTTGATTAGTAAAATGAAGATGG - Intronic
1028435949 7:90803837-90803859 CTTGATTAGTAAAATGAAGATGG - Intronic
1028503875 7:91550147-91550169 GCTGATTGGTAAAAGGAGCCTGG + Intergenic
1029002246 7:97166620-97166642 CCTGAATTCCAAAAGGAAGAAGG + Intronic
1029515261 7:101019747-101019769 CCTGAGCTGGGAAAGGAGGAGGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030684717 7:112473357-112473379 CCTCATTTGTAAAACGAGTCTGG - Intronic
1031247903 7:119340528-119340550 CTTGAATTGTATAAGGTGGAAGG - Intergenic
1031971717 7:128069389-128069411 CCTTAATGGTAAAATGAGGAGGG - Intronic
1032617683 7:133492829-133492851 TCTCAGTTGTAAAAGGAAGAAGG + Intronic
1032857327 7:135846287-135846309 TCTCATTTGTAAAATGAAGAGGG - Intergenic
1033014510 7:137658730-137658752 CCTGATTTGTAAAACAAAGGAGG - Intronic
1033162244 7:139007942-139007964 CCTGAGTTCCAAAGGGAGGAGGG - Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1036079048 8:5533445-5533467 CCTCAGTTGTAAGAGGTGGATGG + Intergenic
1036636657 8:10555255-10555277 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1037670105 8:21007615-21007637 CCTGAATTTCAAAGGGAGGAAGG - Intergenic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038712377 8:29959527-29959549 CTTCTTTTGTAAAAGGAGAATGG - Intergenic
1038892827 8:31746028-31746050 TCTGATTTGTCAAAGTAAGAGGG - Intronic
1039215460 8:35265479-35265501 CTTTATTTATAAAAGCAGGAAGG + Intronic
1039936280 8:42049111-42049133 TCTGTTTTGTGAAAGGAGGAAGG - Exonic
1041162781 8:55061916-55061938 GCTGATTTTTAAAAAGAGGCCGG + Intergenic
1041181092 8:55248927-55248949 CTTGATTTGGCAAAGGAAGATGG + Intronic
1041275804 8:56156683-56156705 CCTGCTCTATAAAAGGCGGATGG - Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042295463 8:67212682-67212704 CCTGCTGTGTGAAAGGAAGATGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1045575297 8:103414493-103414515 CCTGATTTGTAAAATAAAGAAGG - Intronic
1046089745 8:109487475-109487497 CCTTATTTGAAACAAGAGGATGG - Intronic
1046767789 8:118089148-118089170 ACTGATTTTTAAATGGAGGTAGG + Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047727640 8:127697891-127697913 CCTTATTTGGAAACCGAGGAGGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048291290 8:133183576-133183598 CCTCTTTTATAAAAAGAGGATGG - Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048559785 8:135521624-135521646 CCTCATTTGTAATATGAGGTTGG + Intronic
1048588939 8:135803018-135803040 GCTGATTTATGAAAGAAGGAAGG - Intergenic
1048800573 8:138190362-138190384 CCTGAATTCCAAAGGGAGGAAGG - Intronic
1049052663 8:140210824-140210846 CCTGATTTGTGTGAGGAGCATGG - Intronic
1049959846 9:727985-728007 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050112994 9:2235792-2235814 GCTGATTTATAAAAGTAGAAAGG - Intergenic
1050292874 9:4175057-4175079 CCTGCTCTTTAAAAGAAGGAAGG - Intronic
1050565654 9:6879762-6879784 CCTAATTTGTAAAATGTGGTTGG + Intronic
1050703853 9:8372652-8372674 CCAGATTTCTAAAAGAAAGAAGG - Intronic
1050758707 9:9039492-9039514 CCTTATTTACAAAAGCAGGATGG - Intronic
1051015258 9:12467100-12467122 ACTGGTTTGGGAAAGGAGGAGGG + Intergenic
1051522678 9:18007560-18007582 CCTTATTTGTAAAGCGAGGCAGG + Intergenic
1052171047 9:25396938-25396960 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1052419026 9:28217951-28217973 CATAATTTGGAAAAAGAGGAGGG + Intronic
1052781147 9:32783139-32783161 CCGGATTTGTAACTGGAGAAGGG + Intergenic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053696888 9:40647868-40647890 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1053943285 9:43278002-43278024 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054308140 9:63447101-63447123 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054406874 9:64771092-64771114 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054440498 9:65256558-65256580 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054489909 9:65765366-65765388 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1054784720 9:69199889-69199911 CCCTATTTGTAAAATGGGGATGG + Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056343193 9:85659550-85659572 CCTCATTTGAAAAAGAAGGGAGG + Intronic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056955977 9:91081602-91081624 CCTGAATTCCAAAGGGAGGAAGG + Intergenic
1057204865 9:93165240-93165262 CCTTATTTGCAAAAGCAGAATGG + Intergenic
1058059434 9:100479142-100479164 CCTGTTGTGTAAAATGTGGATGG + Intronic
1059723384 9:116983373-116983395 CATGACTAGTACAAGGAGGAAGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061165372 9:128919297-128919319 TCTCATTTGTAAAATCAGGAAGG + Intergenic
1061606967 9:131718033-131718055 ACTGATTTTTAAAAGGAGATGGG + Intronic
1202779341 9_KI270717v1_random:21527-21549 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1203586405 Un_KI270747v1:7907-7929 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1203617059 Un_KI270749v1:75290-75312 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1185788665 X:2911782-2911804 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1186218416 X:7324655-7324677 CCTGAATTCCAAAAGAAGGAGGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186972005 X:14856771-14856793 CATAATTTTTAAAAGGGGGAAGG + Intronic
1188058920 X:25576632-25576654 CCTTATTTGGCAAAGGGGGAAGG + Intergenic
1188120779 X:26304760-26304782 CCTGACTTTTAAAGGGAGGTGGG - Intergenic
1188937808 X:36198740-36198762 CCTGAATTCCAACAGGAGGAAGG + Intergenic
1189176201 X:38959883-38959905 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1190485112 X:50916303-50916325 GCTGATTTGGAAAGGGTGGAGGG - Exonic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192268101 X:69554308-69554330 GCTGCTTTGAAAATGGAGGAAGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195522261 X:105844821-105844843 CCTGTTTTGTAGAGTGAGGAAGG - Intronic
1195551112 X:106172550-106172572 CGAGATGTGTAAATGGAGGATGG - Intronic
1195557997 X:106249456-106249478 CCTGAATTCCAAAAGCAGGAGGG + Intergenic
1196023567 X:111015771-111015793 CCTGATTTAAAAATGGTGGAAGG - Intronic
1196141651 X:112269294-112269316 GCTGATTTGTAAAATGGGAATGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198870038 X:141168646-141168668 CATGATTTGTTAAAAAAGGAGGG + Intergenic
1199001014 X:142636254-142636276 CCTCATTTGTGAGAAGAGGAGGG + Intergenic
1199771719 X:150979478-150979500 CATGATTCTTAAAAGGAGGCTGG + Intergenic
1201194613 Y:11479808-11479830 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1201263937 Y:12187727-12187749 CCTGAATTCCAAAAGGAGAAGGG - Intergenic