ID: 1166415037

View in Genome Browser
Species Human (GRCh38)
Location 19:42589172-42589194
Sequence CTGTCTCAGTAGAAACAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166415037_1166415042 18 Left 1166415037 19:42589172-42589194 CCCCGCTGTTTCTACTGAGACAG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1166415042 19:42589213-42589235 GTTTCTCCCATCAGAAGATGTGG 0: 1
1: 0
2: 16
3: 40
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166415037 Original CRISPR CTGTCTCAGTAGAAACAGCG GGG (reversed) Intronic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901170502 1:7253528-7253550 CTGTCTCAGTAGTAATTGTGTGG - Intronic
901214362 1:7547308-7547330 CTCTCTCAGTAGATAGAGCTGGG + Intronic
902882218 1:19379920-19379942 CTCTGACAGTGGAAACAGCGAGG - Intronic
904586210 1:31582321-31582343 CTGTCTCAAAAAAAAAAGCGGGG + Intronic
904966322 1:34377316-34377338 CTGCCTCACCAGAAACAGCCAGG - Intergenic
905793318 1:40801795-40801817 CTGTCTCTGTAAGAACAGCCTGG + Intronic
907317547 1:53582073-53582095 CAGTCTAAGTAGAGACAGTGAGG - Intronic
907647443 1:56258393-56258415 CTGTCTCCATAGACACAGCCTGG - Intergenic
911168283 1:94744633-94744655 CTGGCTCAGGAGAACCAGGGAGG + Intergenic
912852107 1:113135830-113135852 GTGGCTCAGTAGAAAGAGCAGGG - Intergenic
915188886 1:154131629-154131651 CTTTGTCAGTAAAAACAGCTTGG - Intronic
915639915 1:157216563-157216585 ATGTCTGAATAGAAACAGCTGGG - Intergenic
919067211 1:192707709-192707731 CTGTCTCAGTTCAAGCAGCCAGG - Intergenic
920118570 1:203638525-203638547 CTGTCTCAGTAAAATGAGCCTGG - Intronic
920745732 1:208626284-208626306 CAGTCTCAGTTGAAAAAGCCAGG + Intergenic
923511823 1:234659672-234659694 CTGTCCCAGTAGACACAGGGAGG + Intergenic
1064694661 10:17953333-17953355 CTGTCTCAGTAGAAAAAACACGG - Exonic
1065330263 10:24589166-24589188 CTGTCTCATTAGACATAGAGAGG + Intronic
1066005130 10:31140035-31140057 CTGTCTCATGAGAAGCAGCAAGG - Intergenic
1066809898 10:39315969-39315991 CTGTTTTAGTAGAATCTGCGAGG - Intergenic
1071162849 10:82771082-82771104 GTGTCTCAGTACAACCAGCTAGG + Intronic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075186363 10:120262225-120262247 CTGTTTCAGTAGACAGAGCTGGG + Intergenic
1079161330 11:17997190-17997212 CTGTCTCAACAAAAAAAGCGAGG + Intronic
1082575055 11:54792449-54792471 CTGTTTTAGTAGAAACTGCAAGG - Intergenic
1086501315 11:87456550-87456572 ATGTCTCAGTGCAAACAGTGAGG + Intergenic
1088556771 11:111069887-111069909 GTGACTCAGAAGAAACAGCAAGG + Intergenic
1092095409 12:5838200-5838222 TGGTCCCAGTAAAAACAGCGTGG - Intronic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1100494385 12:95110985-95111007 CTGTCTCAGGAAAAAAAGAGTGG - Intronic
1101893513 12:108736264-108736286 CTGTCTCATTAAAAAGAGAGAGG + Intergenic
1102594873 12:113984536-113984558 CTGACCCAGTGGAATCAGCGAGG + Intergenic
1102683136 12:114704052-114704074 TTGTCTGAGAAGAAACAGAGAGG - Intergenic
1109085746 13:57969177-57969199 CTGTCTCATTAAAAAAAGAGAGG + Intergenic
1110908701 13:80926487-80926509 CTGTCTCAGTAGTAAGAAAGGGG + Intergenic
1112630485 13:101156395-101156417 CTCCCTCAGCAGAAAGAGCGGGG + Intronic
1113378000 13:109782492-109782514 CTCTCTCAGGAAAAGCAGCGAGG - Exonic
1115499244 14:34034811-34034833 CTGCCTCAGTAGGAATAGCTGGG - Intronic
1117653272 14:57928259-57928281 CCGTGTCAGTAGAGACAACGTGG + Intronic
1121745215 14:96283636-96283658 ATGACACAGTAGAAAGAGCGTGG - Exonic
1122977066 14:105175114-105175136 CTGTACCAGTAGAACCACCGCGG + Intronic
1126008453 15:44280521-44280543 CTGTCTCAAAAGAAATAGCAGGG - Intergenic
1126052139 15:44695630-44695652 CTGTCTCTGTAGTGACAGAGAGG - Intronic
1127314964 15:57786077-57786099 CTGTCTCATCAGAAACAACTGGG - Intergenic
1128228427 15:66018536-66018558 CTGACTCAGCAGATACAGCCAGG - Intronic
1134173117 16:11984656-11984678 CTGTCTCAAAAGAAAAAGAGAGG - Intronic
1138925867 16:61590771-61590793 CTGTCACACTAGCAACAGGGGGG - Intergenic
1140148652 16:72338716-72338738 CTGTCTCAAAAGAAACAGGAAGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143276563 17:5715645-5715667 CTGTCTCAGCCAAAACAGCATGG - Intergenic
1144782729 17:17816049-17816071 CTGTCACAGTGGACACAGCCTGG + Intronic
1144908001 17:18653504-18653526 CCGTTTCAGTAGAAAGAGCATGG + Intronic
1145220882 17:21087495-21087517 CCATCTCAGCAGAAACAGCTTGG - Intergenic
1147471703 17:40668368-40668390 CTGTCTCAGTGAACACAGCTTGG - Intergenic
1147635727 17:41962718-41962740 CTGTGTCACTAGAAACAGTGTGG - Intronic
1150689598 17:67353319-67353341 CTGTCTCAAAAGAAAGAGAGAGG - Intronic
1151787803 17:76283868-76283890 CTGTCTCAAAAAAAAAAGCGGGG + Intronic
1153806604 18:8713936-8713958 CTGTCTCTTTAAAAAAAGCGGGG + Intronic
1159859180 18:73626924-73626946 TTGTTTCAGTAGCAACAGCATGG - Intergenic
1160443152 18:78907947-78907969 CTGTCTCAAAAAAAAAAGCGGGG + Intergenic
1165822817 19:38687271-38687293 AGGTCTCAGTAGAACCAGAGGGG - Intronic
1166415037 19:42589172-42589194 CTGTCTCAGTAGAAACAGCGGGG - Intronic
1167886306 19:52502730-52502752 CTGTCTCAAAAGAAAAAGAGAGG + Intronic
1168142360 19:54397054-54397076 CTGTCTCAGAAAAAAAAGTGAGG + Intergenic
931292657 2:60889244-60889266 CTGTGTCAGTGGAAAAAGAGCGG - Intronic
934760264 2:96851620-96851642 GTATCTCAGTAGAGACAGCTGGG - Intronic
935243363 2:101197003-101197025 CTTTCTCAGCAGAAACACTGTGG - Intronic
941080063 2:161050403-161050425 ATGTGTCAGAAGAAACAGTGGGG - Intergenic
944533769 2:200689837-200689859 CTGTCTCTGAGGGAACAGCGGGG - Intergenic
945283563 2:208060313-208060335 CTGTCTCAAAAGAAAAAGGGGGG - Intergenic
1169305854 20:4489724-4489746 CTGTTGCAGAAGAAACAGTGTGG - Intergenic
1174269316 20:49355779-49355801 CTGTCTCAGAAAAAAAAGGGGGG - Intergenic
1175325787 20:58127622-58127644 GTGTGTCTGTAGAAACAGTGTGG - Intergenic
1179341480 21:40514276-40514298 CTGGCTCAGTGAAAACAGGGTGG - Intronic
1183646103 22:39127698-39127720 CTGTCTCAAAAAAAACAGGGTGG + Intronic
949917402 3:8975521-8975543 CTGCCTCAGTGCAAGCAGCGAGG - Intergenic
951317338 3:21203640-21203662 CAGTCTCAGTGGAAGCAGCATGG + Intergenic
952487309 3:33826406-33826428 ATGTCTCAGTATAAACACTGAGG - Intronic
953768274 3:45760453-45760475 CTTTCCCAGTAGAAACACCACGG + Intronic
954727964 3:52632118-52632140 CTGTTTCTGTAAAAACAGCAGGG - Intronic
955687386 3:61561365-61561387 CTGTCCCAGTAGAGGCCGCGCGG + Intergenic
959903592 3:111686262-111686284 CTGTCTGAGGAGAGACAGCCTGG - Intronic
961799411 3:129433806-129433828 TTGTCTTAGTAGAGACAGTGTGG - Intronic
964298206 3:155257613-155257635 CTGTCTCAGCAGACACAGCTAGG - Intergenic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
970199873 4:13593308-13593330 CTGTAACAGTAGAAACCCCGAGG + Intronic
972321107 4:37974560-37974582 CTGTCTCAAAAAAAACAGCATGG - Intronic
974993430 4:69123317-69123339 CTTTCTGAGTAGAAACACCAAGG + Intronic
978919781 4:114169418-114169440 CTTTCTTATTAGAAACAGCATGG - Intergenic
988580244 5:32462485-32462507 CTGTCTTAGGGGAAACAGCCTGG + Intergenic
991113571 5:62928513-62928535 CAGGCTCAGTAGAATCAGGGAGG + Intergenic
993057364 5:82997632-82997654 CTTTCTCACTAAAAACAGCATGG - Intergenic
996210501 5:120802828-120802850 CAGTCTGAGGAGAAACAGTGTGG - Intergenic
996888672 5:128389967-128389989 ATGGCTCAGTAGACACAGCCAGG - Intronic
1001341845 5:170854373-170854395 GTGGATCAGTGGAAACAGCGGGG + Intergenic
1001607564 5:172973190-172973212 CTGGCTCAGTATAAGCAGTGTGG - Intergenic
1002684264 5:180995610-180995632 CTCTCTCACAAGAAACAGTGAGG - Intronic
1004781824 6:18917481-18917503 CTGACTTAATAGAAACAGCTGGG - Intergenic
1006119596 6:31795845-31795867 CGGTCTCACGAGGAACAGCGCGG + Exonic
1013466504 6:110421859-110421881 CAGTTTCAGTAGAATCAGTGGGG + Intergenic
1014905592 6:127023275-127023297 TTGTCTAAGTAGAAACAGAAGGG - Intergenic
1015548246 6:134384675-134384697 CACTCTCAGTAGAAACACTGTGG - Intergenic
1018362155 6:163081749-163081771 CTGTCTCAGAAAAAAAAGTGGGG + Intronic
1020045301 7:5036109-5036131 CTGTCTCAAAAGAAAAAGCAAGG - Intronic
1022618402 7:31956106-31956128 CTGTCTCAAAAAAAAAAGCGGGG - Intronic
1025092456 7:56075091-56075113 CTGTCTCAAAAGAAAAAGCGGGG + Intronic
1025599665 7:62980078-62980100 CTGTTTTGGTAGAAACTGCGAGG + Intergenic
1027126382 7:75559604-75559626 CTGTCTTTCTAGAAACAGCTAGG - Intronic
1027373323 7:77530360-77530382 CTGTCTCAGAAAAAAAAGCTGGG - Intergenic
1032456293 7:132075725-132075747 CTGTCTCTGCAGGAACAGGGAGG + Intergenic
1033144166 7:138856710-138856732 CTGGCTGAGTAGTAACAGAGCGG - Intronic
1039078731 8:33715441-33715463 CTGATTCAGTAGAATCAGGGTGG + Intergenic
1040859144 8:51981264-51981286 CTGTCTCAGTGTAAACTGCTCGG + Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042080405 8:65045522-65045544 CATTCTCAGTAGAAACAATGAGG - Intergenic
1042477696 8:69267490-69267512 CTGTGTCATTAGAAACAACATGG - Intergenic
1046382570 8:113470782-113470804 CTGTCTCACTAGACAGAGCAGGG - Intergenic
1047979868 8:130170075-130170097 CTGTCTCCCTACAAACAACGAGG + Intronic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1058773744 9:108264269-108264291 CTGTCTCCTTAGTAACAGCAGGG + Intergenic
1061616252 9:131781386-131781408 CTGTAGCAGTAGAACCAGCTTGG + Intergenic
1190223942 X:48531324-48531346 CTGTCTCAGGAGAAAAAACAGGG + Intergenic
1193563784 X:83052789-83052811 TTATCTCAATAGAAACAGAGAGG - Intergenic
1197781237 X:130162584-130162606 TTGTCTCAGCAGAAACAACGGGG + Intronic
1199373800 X:147083610-147083632 GTGTCTCAGTGGAAACTGTGTGG - Intergenic
1201423232 Y:13821758-13821780 CAGTCCCAGTAGGAACAGCTTGG + Intergenic