ID: 1166416898

View in Genome Browser
Species Human (GRCh38)
Location 19:42601851-42601873
Sequence CCTGCACCACGTTCTCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166416885_1166416898 30 Left 1166416885 19:42601798-42601820 CCCACAGAGCCTGTGTCCTCGAC 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416886_1166416898 29 Left 1166416886 19:42601799-42601821 CCACAGAGCCTGTGTCCTCGACT 0: 1
1: 1
2: 5
3: 24
4: 205
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416887_1166416898 21 Left 1166416887 19:42601807-42601829 CCTGTGTCCTCGACTCCTCTCCT 0: 1
1: 0
2: 3
3: 31
4: 363
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416893_1166416898 -3 Left 1166416893 19:42601831-42601853 CCCATTCCTGGGTATTCCTTCCT 0: 1
1: 0
2: 2
3: 61
4: 865
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416894_1166416898 -4 Left 1166416894 19:42601832-42601854 CCATTCCTGGGTATTCCTTCCTG 0: 1
1: 0
2: 3
3: 39
4: 386
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416888_1166416898 14 Left 1166416888 19:42601814-42601836 CCTCGACTCCTCTCCTGCCCATT 0: 1
1: 0
2: 4
3: 38
4: 321
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416891_1166416898 6 Left 1166416891 19:42601822-42601844 CCTCTCCTGCCCATTCCTGGGTA 0: 1
1: 0
2: 5
3: 33
4: 513
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416895_1166416898 -9 Left 1166416895 19:42601837-42601859 CCTGGGTATTCCTTCCTGCACCA 0: 1
1: 0
2: 1
3: 20
4: 180
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1166416892_1166416898 1 Left 1166416892 19:42601827-42601849 CCTGCCCATTCCTGGGTATTCCT 0: 1
1: 0
2: 0
3: 20
4: 274
Right 1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166416898 Original CRISPR CCTGCACCACGTTCTCCGTG TGG Intronic
901235373 1:7664752-7664774 CCTGCACCACGTTGCCCGGGAGG - Exonic
907460935 1:54605117-54605139 CATGCACCACCATCTCCATGTGG - Exonic
912167453 1:107057411-107057433 CCTGCACAACGATCTCCGAGTGG - Exonic
915496303 1:156285043-156285065 TCTGTACCACGTTCTCCCTAAGG + Intronic
916858245 1:168774333-168774355 CTTGCACCACAGTCTCCCTGTGG - Intergenic
920097536 1:203496332-203496354 CCTCCACCTCTTTCTCTGTGAGG + Intronic
924083668 1:240425751-240425773 CATTCACCACGTTCTCCCTCAGG - Intronic
1064397252 10:14991881-14991903 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1064400148 10:15014350-15014372 CCTGCACCTCTCTCTCCTTGCGG + Intergenic
1066390373 10:34973278-34973300 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1070906554 10:80078584-80078606 CCAGCACCATCTTCTCCCTGCGG + Intergenic
1074867815 10:117555097-117555119 CCTGCACCACATCCTCTCTGAGG - Intergenic
1077544743 11:3164518-3164540 CCTGCACCCCGCTCCCCGGGAGG + Intronic
1083633639 11:64108704-64108726 CCTGCACGGCATTCTCAGTGAGG + Intronic
1083772862 11:64878134-64878156 CCGGCACCACGCCCTCAGTGGGG + Exonic
1084261147 11:67979547-67979569 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1084807490 11:71589007-71589029 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1084847433 11:71911470-71911492 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1091000771 11:131909543-131909565 CCTGACCCACATTCTCCTTGGGG - Intronic
1092252220 12:6905859-6905881 CCTTCATCATGTCCTCCGTGAGG - Exonic
1092432408 12:8420103-8420125 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1101029273 12:100644081-100644103 CCTGCACATCTTTCTCCTTGTGG + Intergenic
1102171030 12:110842653-110842675 CCTGCCCCAAGTTCTCCCAGCGG + Intergenic
1102396401 12:112589705-112589727 CCTGCACCATTTGCTCCATGAGG + Intronic
1102453721 12:113058330-113058352 CCTTCAGCACGTTCTCAATGTGG - Exonic
1106001414 13:25726932-25726954 ACTGCACCTCCTTCTCCTTGGGG - Intronic
1106354523 13:28967491-28967513 CCTACAGCACGTTCTCTGTTGGG - Intronic
1106517054 13:30465023-30465045 ACAGCCCCGCGTTCTCCGTGCGG - Intronic
1107544189 13:41421669-41421691 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1109623533 13:64942271-64942293 CATGAACCACTTTCTCCATGAGG - Intergenic
1109802977 13:67401716-67401738 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1110705783 13:78601474-78601496 CCCGCACCACGTTCTTTTTGAGG + Exonic
1113669876 13:112169197-112169219 CCTCTATCACGTTCTGCGTGTGG + Intergenic
1113669891 13:112169358-112169380 CCTCTATCACGTTCTGCGTGTGG + Intergenic
1114496437 14:23136298-23136320 CATGCACCAGGTGCTCTGTGGGG + Intronic
1115941751 14:38617964-38617986 CCTGCACCAAGTTCTTCATGTGG - Intergenic
1116932544 14:50704395-50704417 TCAGCACCATGGTCTCCGTGGGG - Intergenic
1117038765 14:51751467-51751489 CCTGCACCTCTCTCTCCATGGGG - Intergenic
1119406348 14:74401984-74402006 CCTGCCCCACCTTCTGAGTGGGG + Intergenic
1120898878 14:89558690-89558712 CCTGCACCACCTTCCCTGAGGGG - Intronic
1121709876 14:96029998-96030020 CCTGAACCAGGTTCTCCGGAAGG - Intergenic
1127329812 15:57927676-57927698 ACTGTACCACGTTCACCTTGAGG - Intergenic
1128714043 15:69893956-69893978 CATGCAGCAAGTTCTCCCTGGGG + Intergenic
1129112146 15:73343630-73343652 CCTCCACCACGATCCCTGTGCGG + Exonic
1129269250 15:74410869-74410891 TCTGCTCCACGTTCTCCTTGTGG + Exonic
1133008512 16:2897644-2897666 CCTGCACCCAGCTCTCCCTGAGG + Intronic
1136913861 16:34163446-34163468 CCCGCACCACGAGCTGCGTGAGG - Intergenic
1141213134 16:81999602-81999624 CCTGCACCAAGTTATCCACGTGG + Exonic
1142126144 16:88411602-88411624 CCTACACCCCGTTCTCCCTGAGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1155912810 18:31524094-31524116 CCTGCACTTCATTCTCAGTGAGG - Intronic
1158292215 18:55954955-55954977 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1158911554 18:62068166-62068188 CCTGTAGCACTTTCTCCATGGGG + Intronic
1158947481 18:62459556-62459578 CCTCCTCCAGGATCTCCGTGGGG + Intergenic
1159011620 18:63063558-63063580 TCAGCACCACGTTCTCACTGAGG + Intergenic
1160220009 18:76968276-76968298 CCTGCACCACCTCCTCCAGGTGG - Exonic
1160822272 19:1064128-1064150 CCGGCACCACGAGCTCCGTGAGG - Intronic
1162284231 19:9726329-9726351 CCTGCACATCTTTCTCCTTGTGG + Intergenic
1166267965 19:41696650-41696672 CCTGCATCACCTTCTCCCTGTGG - Intronic
1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG + Intronic
1166496670 19:43307875-43307897 CTTGCACCACCTTCTCCCTGTGG + Intergenic
1167382932 19:49149066-49149088 CGTGTACCCCGCTCTCCGTGAGG - Exonic
1168241230 19:55089865-55089887 CCTGCACCAGCTTTTCCCTGAGG + Intergenic
925270387 2:2601916-2601938 CCAGCACCACGTGCTCTGCGGGG + Intergenic
932349916 2:71023394-71023416 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
932467460 2:71932918-71932940 CCTGCTCCAGGTTCTCAGTTTGG + Intergenic
935361478 2:102250222-102250244 CCTGGATCACCTTCTCCCTGGGG + Intergenic
937229021 2:120386304-120386326 CCTGTCCCAGGTACTCCGTGTGG + Intergenic
939813971 2:146871238-146871260 CCTGCACCACGTGTGCCCTGCGG + Intergenic
940869494 2:158848171-158848193 CCTGCACCTCTCTCTCCTTGGGG - Intronic
940872168 2:158869169-158869191 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
947594973 2:231405316-231405338 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
948832388 2:240604430-240604452 CCTGCTCCTGGATCTCCGTGAGG + Intronic
1168915005 20:1478401-1478423 CCTGCACCGCTGTCTCCTTGGGG + Exonic
1169746410 20:8947451-8947473 CCTGCACCACTGCCTCTGTGTGG + Intronic
1171810203 20:29741154-29741176 CCTGCACCACGAGCTGCGTGAGG + Intergenic
1171908771 20:30922019-30922041 CCTGCACCACGAGCTGCGTAAGG - Intergenic
1175201978 20:57284274-57284296 ACTGCTCCATGTTCTCTGTGGGG - Intergenic
1176426740 21:6553011-6553033 CCTGGCCCACATTCTCCCTGCGG + Intergenic
1178447691 21:32660580-32660602 CCTGCACATCTTTCTCCATGTGG - Intronic
1178981395 21:37267835-37267857 CCTCCACCGCTTTCTCCCTGGGG + Intronic
1179702231 21:43161333-43161355 CCTGGCCCACATTCTCCCTGCGG + Intronic
1179887412 21:44320135-44320157 CCTGCCTCACCTTCTCCTTGGGG - Exonic
1179984522 21:44913249-44913271 CCAGCTCCACGCTCTCCCTGGGG + Intronic
1180859294 22:19068115-19068137 GCTGCGCCACGTTCACCGCGTGG + Exonic
1184111932 22:42400729-42400751 CCTGCACCACCTGCTTCTTGAGG + Intronic
1184316912 22:43701150-43701172 ACTCCACCACTTTCTCCCTGGGG + Intronic
1185254552 22:49825128-49825150 CCAGCACCATGGTCTCAGTGGGG - Intronic
949884528 3:8682754-8682776 CCTGCACCTCTCTCTCCTTGGGG - Intronic
954584051 3:51719009-51719031 CCTGCACCAAATGCTCAGTGTGG - Intergenic
957044420 3:75362925-75362947 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
957406257 3:79777368-79777390 CCTGCACATCTTTCTCCTTGTGG - Intergenic
961278004 3:125742701-125742723 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
961599813 3:128052123-128052145 CCTGCCTCAGTTTCTCCGTGAGG + Intronic
961876412 3:130026959-130026981 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
962895439 3:139709793-139709815 CTTGCACCATGTTCTCCCTGTGG - Intergenic
964522421 3:157583404-157583426 CCTGCACATCTTTCTCCTTGTGG + Intronic
967953259 3:194857200-194857222 CCTGCCCCCCGTTCTCCTTGTGG + Intergenic
968472085 4:786886-786908 CCTGGCCCCCATTCTCCGTGGGG - Intronic
968585231 4:1413252-1413274 CCTGCAGCACGTTCTCATGGAGG - Intergenic
968988684 4:3894165-3894187 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969019663 4:4131408-4131430 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969024367 4:4161808-4161830 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969025272 4:4167754-4167776 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969793776 4:9510064-9510086 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
976230720 4:82840272-82840294 CCTGCACCACTTTTTAAGTGGGG + Intronic
980780124 4:137482850-137482872 CCTGCACATCTTTCTCCTTGTGG - Intergenic
985493366 5:191817-191839 CCTGCAGCACGTGGTCCGCGAGG - Exonic
987089198 5:14496382-14496404 CCTGCACCACGTGCTCTCCGGGG - Intronic
999268131 5:150280285-150280307 CCTCCACTCTGTTCTCCGTGGGG + Intronic
1006852631 6:37109996-37110018 CCTGCTCCACCTACTTCGTGGGG + Intergenic
1007473157 6:42103824-42103846 CCATCAACACGTTCACCGTGAGG - Exonic
1018838725 6:167504117-167504139 CCTGCAGAAAGTTCACCGTGGGG + Intergenic
1018940906 6:168308439-168308461 CCTGCACCATGGTCTCCCTGAGG + Exonic
1020311528 7:6872279-6872301 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1024394304 7:48848220-48848242 CCTGCACCACCTCCTCCTTCCGG - Intergenic
1027495182 7:78879077-78879099 TCTGCCCCAAGTTCTCTGTGGGG - Intronic
1029975216 7:104827196-104827218 CCTGCAGCCAGTTCTCCATGTGG + Intronic
1034893485 7:154860188-154860210 CCTGCCCCACCTTCTCCCTGAGG + Intronic
1035105777 7:156440681-156440703 CCTGCACCCCGGCCTCCTTGAGG + Intergenic
1035975572 8:4307021-4307043 CCTGCACCATGTCCACTGTGGGG + Intronic
1036239805 8:7072124-7072146 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1036262072 8:7249030-7249052 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036304518 8:7590528-7590550 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036314111 8:7707569-7707591 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036355371 8:8038520-8038542 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036816637 8:11907493-11907515 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036903527 8:12689441-12689463 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1038325749 8:26571501-26571523 CCTGCACCTCATTCTCTGGGTGG - Intronic
1041729641 8:61051463-61051485 TCTGCACCAGGTTCCCCTTGGGG + Intergenic
1044307100 8:90650397-90650419 CTTCCACCACTTTCTCTGTGTGG - Intronic
1044806314 8:96011880-96011902 CCTGCACCAAGCTCTGTGTGTGG - Intergenic
1049361574 8:142214574-142214596 CCTGCACCCCACTCTCGGTGAGG + Intronic
1049659222 8:143812265-143812287 CCATCAGCAGGTTCTCCGTGAGG + Exonic
1050526967 9:6554687-6554709 CCAGGACCACCTCCTCCGTGGGG + Exonic
1056764996 9:89439615-89439637 GCTGCACCACATTGTTCGTGTGG - Intronic
1059283031 9:113150946-113150968 CCCGGACCACGTGATCCGTGCGG + Exonic
1203775290 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG + Intergenic
1185909941 X:3971983-3972005 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1189852526 X:45191750-45191772 CCTGCACCAGGTCCGGCGTGAGG + Exonic
1190425865 X:50334150-50334172 CCTGCACATCTTTCTCCTTGTGG + Intronic
1199326164 X:146501257-146501279 CCTGCAGCACGTTCTCTTTAAGG - Intergenic
1200108239 X:153726022-153726044 CCCGCAGCACGTTGGCCGTGAGG - Exonic
1200394098 X:155973118-155973140 CCTGCACATCTTTCTCCATGTGG + Intergenic
1201555084 Y:15258830-15258852 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1202177667 Y:22112657-22112679 TCTGCACCACCTTCTCATTGTGG - Intergenic
1202213694 Y:22473738-22473760 TCTGCACCACCTTCTCATTGTGG + Intergenic