ID: 1166417339

View in Genome Browser
Species Human (GRCh38)
Location 19:42605656-42605678
Sequence GTGGGCAACAGGTTTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166417339 Original CRISPR GTGGGCAACAGGTTTGAGAT TGG Intronic
901216178 1:7556614-7556636 TGGGGCACAAGGTTTGAGATGGG - Intronic
901839578 1:11945398-11945420 CTGGGCAACGGGAGTGAGATTGG + Intronic
904358534 1:29957358-29957380 GTGGGTACAAGGTTTGAGCTGGG + Intergenic
906581228 1:46936582-46936604 GTGGGACACAGGGTTGAGAGTGG + Intronic
906602496 1:47142295-47142317 GTGGGACACAGGGTTGAGAGTGG - Intronic
907906214 1:58784978-58785000 GTGGGTAACAGGGTCCAGATGGG + Intergenic
908426201 1:64009843-64009865 GTGGGGAACAGGTTTCTGCTAGG + Intronic
913709881 1:121472523-121472545 GAGGGCATGAGGTTTGAGAGGGG - Intergenic
915396693 1:155590527-155590549 GTGCCCAACAGCTTTGGGATGGG - Intergenic
920106424 1:203556501-203556523 ATGGGAAACAGATTTGAGAGGGG + Intergenic
920434050 1:205936777-205936799 TTTGGCAAAAGATTTGAGATGGG + Intronic
920526628 1:206671799-206671821 GTGAGCGACAGGTTAGAAATGGG - Intronic
920684626 1:208099992-208100014 GTAGGTAACAGGTCTGAGGTTGG - Intronic
1067113607 10:43418253-43418275 AAGGCCAACAGGTTTGGGATTGG - Intergenic
1067909022 10:50325476-50325498 ATGAGCAACACGTTTGAGTTTGG + Intronic
1072463637 10:95642846-95642868 GTGGGAAACAGTTTTCACATTGG + Intronic
1073751338 10:106530760-106530782 GTGGGCAATAGGCTTTAGAATGG + Intergenic
1076361396 10:129891958-129891980 GAGAGGAAAAGGTTTGAGATTGG - Intronic
1078095613 11:8294814-8294836 GGTGGGAACAGGTTTGAGACGGG - Intergenic
1080949208 11:37009374-37009396 ATGGCCAACAGGTTTGTGAAAGG - Intergenic
1082632889 11:55561642-55561664 GTGAGAAACTGGTTTGAAATTGG - Intergenic
1084747862 11:71184597-71184619 GTTGGCCACAGGTTTGAGAAGGG - Intronic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1087196081 11:95305490-95305512 GTGGGCAACAGATCTTGGATAGG + Intergenic
1091033870 11:132215783-132215805 CTGCACAACTGGTTTGAGATGGG + Intronic
1091037520 11:132247011-132247033 GTGGGCACCAGGTTTGGGGAGGG - Intronic
1093125993 12:15329363-15329385 GTGGGAATCAGGCTTCAGATAGG - Intronic
1094697207 12:32831820-32831842 GTGGTCAACTGGTTGTAGATGGG + Intronic
1095078121 12:37958961-37958983 CTGAGAAACAGCTTTGAGATGGG + Intergenic
1098398402 12:70046885-70046907 GAGGGCAACAGGTTGGCAATGGG + Intergenic
1101367215 12:104084486-104084508 TTTGGCAACAGATTTGAGCTGGG + Intronic
1101591483 12:106129142-106129164 GTGGGAAATGGGTTTGGGATGGG + Intronic
1107024325 13:35784402-35784424 GTGAGCAACCTGTTTGAGTTGGG + Intronic
1110871404 13:80456577-80456599 GTGGGGAAGGGGGTTGAGATGGG - Intergenic
1114076422 14:19163753-19163775 GTGGGCATCAGGCCTGATATTGG - Intergenic
1114085746 14:19235816-19235838 GTGGGCATCAGGCCTGATATTGG + Intergenic
1116216321 14:42021933-42021955 GTGGGCAAAAGGTAGGAAATTGG + Intergenic
1118571996 14:67203203-67203225 TTGGGCACCAGGTGTCAGATGGG - Exonic
1121185964 14:91969743-91969765 GTGGGCAAAACATCTGAGATGGG + Exonic
1122467877 14:101946715-101946737 GGGGGAGACAGGTTGGAGATAGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1128075485 15:64822933-64822955 GTGAGAAACAGGTTTGTGATAGG - Intronic
1128989160 15:72244306-72244328 GTGTACAACAGGATTGAGTTGGG - Intronic
1129325975 15:74800516-74800538 GTGGGCAAGAGGTCTGGGGTGGG - Intronic
1131977026 15:97957297-97957319 GTGGCCAAAAAGTTTAAGATTGG + Intergenic
1133031928 16:3015285-3015307 GTGCCCAACAGCTTTGGGATGGG - Exonic
1133545946 16:6807169-6807191 GTGAGAAACAGATTGGAGATTGG + Intronic
1134400747 16:13907656-13907678 CTGGAGAACAGGTTTGGGATGGG - Intergenic
1134619223 16:15675085-15675107 GTGGGAACCAGGTTTGGGAGTGG + Intronic
1140702799 16:77598060-77598082 GTGGGGGTCAGGTTGGAGATGGG - Intergenic
1142890836 17:2941475-2941497 GTGGGGAACTGATTTGAGAGGGG + Intronic
1146915950 17:36678537-36678559 GTGGGGAACAGGTTTATTATGGG - Intergenic
1147419443 17:40314851-40314873 GTGGGCACCAGGCTTGTGGTGGG + Intronic
1147769570 17:42858166-42858188 GTGGGGAACAGGTTGGGGGTAGG + Intergenic
1149051513 17:52310618-52310640 CTGGGTAACAGGTCTGAGGTTGG - Intergenic
1150896164 17:69213392-69213414 GTGGGCGACAGGTTTGCGGGTGG + Intronic
1152327073 17:79647817-79647839 GTGGGAGACAGGTGTGAGTTGGG - Intergenic
1152585189 17:81186146-81186168 CAGGGCAACAGGTTTGACCTGGG + Intergenic
1152862371 17:82703702-82703724 GTGGGGGTCAGGTTTGAGGTGGG - Intergenic
1152862429 17:82703880-82703902 GTGGGGGTCAGGTTTGAGGTGGG - Intergenic
1155388437 18:25307199-25307221 GTGGGGAAAGGATTTGAGATAGG - Intronic
1155585993 18:27365910-27365932 GTGGGAAATAGGTTTCAGATGGG - Intergenic
1158412179 18:57216963-57216985 TTGGGCAAGAGGTTTGATAGGGG - Intergenic
1166417339 19:42605656-42605678 GTGGGCAACAGGTTTGAGATTGG + Intronic
1166917708 19:46206959-46206981 GTGGGTGAGAGGATTGAGATGGG - Intergenic
926363491 2:12112107-12112129 GTGGGGAAAAAGTTGGAGATGGG + Intergenic
927241876 2:20926333-20926355 GTGGAGAACAGGATTGTGATGGG + Intergenic
929610324 2:43266207-43266229 GTGGACATGGGGTTTGAGATGGG - Intronic
931069910 2:58634948-58634970 GTGGGCCAAAGGTTTGTCATGGG + Intergenic
931266178 2:60662236-60662258 GTGGGCAACATGTGTGAGCCAGG - Intergenic
932050411 2:68392652-68392674 GTGGGACACAGGATTTAGATGGG - Intronic
932477452 2:72015278-72015300 GGTGGCATCAGGGTTGAGATGGG - Intergenic
938491018 2:131761268-131761290 GTGGGCATCAGGCCTGATATTGG - Intronic
942986108 2:182144224-182144246 GTGGGTAACAGGTCTGATAGTGG + Intronic
944063678 2:195596452-195596474 GTGGGCAACGGGTTTCAAAGGGG - Intronic
945285997 2:208082312-208082334 GTGGGGAAGGGGCTTGAGATGGG - Intergenic
946918757 2:224555234-224555256 GTGGGAAACTGATTTGAAATGGG - Intronic
1173800824 20:45893301-45893323 CTGGGGAACAGGTATGGGATAGG + Exonic
1180292228 22:10857377-10857399 GTGGGCATCAGGCCTGATATTGG - Intergenic
1180495033 22:15886799-15886821 GTGGGCATCAGGCCTGATATTGG - Intergenic
1182317745 22:29459148-29459170 CTGGGCAACAGGGTGGAGGTGGG + Intergenic
1183248542 22:36712024-36712046 GTGGGCAACAGGATGGGGAGAGG + Intergenic
1183425784 22:37738762-37738784 GGGGGAAGCAGGTTGGAGATGGG + Intronic
1184116840 22:42427156-42427178 GTGGGCAACAGGACCCAGATGGG - Intronic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
952271767 3:31839766-31839788 GAGGTCAACAGGTTAGGGATGGG + Intronic
952690387 3:36198237-36198259 GAGGGCAACAGGTATGGTATAGG - Intergenic
953911694 3:46896506-46896528 GTGGGCAGCAGATTCCAGATGGG + Intronic
954841354 3:53514623-53514645 GTGAGCCAGAGGTTTAAGATGGG + Intronic
960970451 3:123135471-123135493 CTTAGCAACAGGTCTGAGATGGG + Intronic
961383536 3:126510898-126510920 GTGGGCAACAGGCTTCTGAGTGG - Intronic
961536627 3:127574522-127574544 GTGGGGAGCAGGTTTGGGGTGGG - Intronic
963655204 3:148039630-148039652 GTAGGCACCTGGTTTGAGAATGG + Intergenic
963685819 3:148432396-148432418 GTGGGTAAAACGTGTGAGATGGG + Intergenic
964413700 3:156425930-156425952 GAGGGCAAGAGGTTTAAGACAGG + Intronic
966841975 3:184097035-184097057 GTGGGCCAGAAGTTTGAAATGGG - Intergenic
970913911 4:21310377-21310399 CTGGGCAAGTGATTTGAGATGGG - Intronic
975557141 4:75675827-75675849 GTGGGCAAACGGTTTGATAAGGG + Intronic
976890807 4:90045219-90045241 AAGGGCAGAAGGTTTGAGATTGG - Intergenic
981000270 4:139822443-139822465 CTGGGCAACAGGTTTGGTAGAGG + Intronic
982793229 4:159616425-159616447 GTGGCCACCAGATTTGAGAAGGG - Intergenic
986275787 5:6274071-6274093 GAGGGAGACAGGTTTGAGAGAGG + Intergenic
986353770 5:6904302-6904324 GTGGGCAGCGGTTTTGTGATTGG + Intergenic
987699820 5:21382697-21382719 TTGGACAAGAGGTTTGAGAGGGG + Intergenic
988752583 5:34205357-34205379 TTGGACAAGAGGTTTGAGAGGGG - Intergenic
992920334 5:81510264-81510286 ATGGGGAATAGGTTTGAGGTGGG - Intronic
996873284 5:128215540-128215562 GTGGGGATCATGTTTGAGATGGG + Intergenic
997528872 5:134570192-134570214 GTGGGCAGCAGGTATGAGGTGGG - Intronic
999016496 5:148111950-148111972 GTGGGCAAGAGGGGTGACATTGG + Intronic
1000042740 5:157497131-157497153 TTGGGCAACAGGGTTGAGGGTGG - Intronic
1005303638 6:24494317-24494339 GTCGGCAACAGACTTGAGTTTGG + Intronic
1005449638 6:25960336-25960358 ATGGGAAACAGGTGTGAGATGGG + Intergenic
1005550745 6:26912077-26912099 TTGGACAAGAGGTTTGAGAGGGG - Intergenic
1007393883 6:41566252-41566274 CTGGGCAGCAGGCTTGAGATTGG + Intronic
1012349074 6:98229121-98229143 GTGGGCAAGAGGTTTGGGCTGGG + Intergenic
1012723543 6:102780143-102780165 GGTGGCATCAGTTTTGAGATTGG + Intergenic
1013738605 6:113257330-113257352 ATGGTCAACAGTTTTGAAATCGG - Intergenic
1020260354 7:6527321-6527343 CTGGGCAAGAGCTTAGAGATAGG - Intronic
1030303685 7:107999629-107999651 GTGGGCATCAAGATTGAGACAGG - Intronic
1030514933 7:110527389-110527411 TTGGGGAACAGGATAGAGATTGG + Intergenic
1032076242 7:128837477-128837499 AGGGGCACCAGGTTTGAGCTTGG - Exonic
1034308930 7:150070267-150070289 GAGGGCACCAGGTGTGAGTTGGG - Intergenic
1034497043 7:151429235-151429257 GTGGGAATCAGGTTGGAGTTTGG + Intronic
1034729718 7:153376611-153376633 GTGGGAAAGAGGTATGACATTGG + Intergenic
1034797919 7:154030375-154030397 GAGGGCACCAGGTGTGAGTTGGG + Intronic
1035777684 8:2201831-2201853 GTCGCCAACAGGTTTGAATTTGG - Intergenic
1036727291 8:11231368-11231390 GTGGGAAAATGGTATGAGATAGG - Intergenic
1037741658 8:21613436-21613458 GGGGGCTACAGGTGTGAGCTTGG + Intergenic
1038396971 8:27254009-27254031 GTGGGCAAATCGTTTGAGGTCGG - Intronic
1039374813 8:37022794-37022816 GTGGGAAACAGGGTTGACAGTGG + Intergenic
1046984320 8:120370512-120370534 GTGGGCAAGAGGTTTGAAAGTGG - Intronic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1050110839 9:2214129-2214151 GTGAGAAACAGGACTGAGATAGG + Intergenic
1051486275 9:17611890-17611912 GTGGGAAAGAGTGTTGAGATAGG - Intronic
1052930559 9:34052063-34052085 GTGGGAAAGAGGTTTGTGATTGG + Intergenic
1054326135 9:63713540-63713562 GTGGGCATCAGGCCTGATATTGG - Intergenic
1056435949 9:86576344-86576366 GTGGGCGAGAGGGCTGAGATGGG + Intergenic
1057071081 9:92100586-92100608 CTGGTCTGCAGGTTTGAGATGGG - Intronic
1061064854 9:128271307-128271329 GAGGGTAACAGGTATGAGACTGG + Intronic
1190593864 X:52033360-52033382 GTGGGCAACATGATTCAGGTTGG + Intergenic
1193787341 X:85775209-85775231 GTGGGAAAGGGGTGTGAGATTGG - Intergenic
1196675159 X:118412449-118412471 GGGGGCTTCAGGTTTGAGACAGG + Intronic
1199979363 X:152912460-152912482 GTGGCCATCAGGTTTGACAAGGG + Intergenic