ID: 1166420130

View in Genome Browser
Species Human (GRCh38)
Location 19:42630229-42630251
Sequence GGGTTCATAGGGATAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166420117_1166420130 24 Left 1166420117 19:42630182-42630204 CCCAGGGAGCCTCAGTGTCACAT 0: 1
1: 1
2: 0
3: 16
4: 156
Right 1166420130 19:42630229-42630251 GGGTTCATAGGGATAGAACATGG 0: 1
1: 0
2: 4
3: 8
4: 119
1166420121_1166420130 15 Left 1166420121 19:42630191-42630213 CCTCAGTGTCACATGAGATGGGG 0: 1
1: 1
2: 6
3: 12
4: 162
Right 1166420130 19:42630229-42630251 GGGTTCATAGGGATAGAACATGG 0: 1
1: 0
2: 4
3: 8
4: 119
1166420118_1166420130 23 Left 1166420118 19:42630183-42630205 CCAGGGAGCCTCAGTGTCACATG 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1166420130 19:42630229-42630251 GGGTTCATAGGGATAGAACATGG 0: 1
1: 0
2: 4
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166420130 Original CRISPR GGGTTCATAGGGATAGAACA TGG Intronic
901913548 1:12480097-12480119 GGGTACACAGGGATGGACCAGGG - Intronic
905838259 1:41149832-41149854 GGATTCAAAGGAATAGAACCTGG - Intronic
906331467 1:44888656-44888678 GGGTACCTTAGGATAGAACAGGG + Intronic
907805843 1:57819042-57819064 AGGCTCATGGGGATAGAAGAAGG - Intronic
908568898 1:65388032-65388054 GAGTTCATTGGGTTGGAACAGGG + Intronic
910097694 1:83542449-83542471 GGATTCATAGTGATAGGACCAGG + Intergenic
913223314 1:116676917-116676939 GGGGTCATACGGAAAGTACATGG - Intergenic
913428822 1:118766109-118766131 GGGGAGATAGGTATAGAACAAGG - Intergenic
917789366 1:178489552-178489574 GCATTCACAGGGACAGAACAAGG + Intergenic
919574432 1:199289817-199289839 GGCTCCATAGGTATAGAAAAGGG + Intergenic
919973999 1:202599182-202599204 GGGTTCCTAGGCATGGAGCAGGG - Intronic
921248182 1:213269226-213269248 TGTTTCATAGTGATAGTACAGGG + Intronic
921376143 1:214475880-214475902 TGGTTCATTGGGTAAGAACATGG - Intronic
1065155927 10:22870159-22870181 TGTATCATAGGGATAGACCATGG + Intergenic
1065413287 10:25454679-25454701 GGTTTCATAGGGATTAAAAATGG - Intronic
1068834662 10:61540930-61540952 GGCTTTAAAGGGGTAGAACATGG - Intergenic
1070631140 10:78085665-78085687 GGATTCATGTGGCTAGAACAGGG + Intergenic
1071871925 10:89805531-89805553 TGGTTAACAGGGAGAGAACAAGG - Intergenic
1072765059 10:98088563-98088585 AGCTTCATAGGGATGGATCAGGG + Intergenic
1075488591 10:122847495-122847517 GGGTTCAGAGGGAAAGCCCAGGG - Intronic
1075495520 10:122915748-122915770 GGGTTCAGAGGGAGAGCCCAGGG + Intergenic
1079087277 11:17455600-17455622 GGTTTAAAAGGGATAGAACCTGG + Intronic
1082998532 11:59271750-59271772 GTGTTCATGGAGATTGAACAGGG - Intergenic
1084386442 11:68845630-68845652 GGTTTCATGAGGACAGAACAGGG + Intergenic
1087554544 11:99699017-99699039 AAGTTCATAGGGACATAACATGG + Intronic
1091072967 11:132586306-132586328 AGGTACATGGGGATATAACAGGG - Intronic
1095885805 12:47187263-47187285 GTGTTCATAGGGAGAGACCATGG + Intronic
1096382852 12:51173354-51173376 GGGTTCATAAGGCTAGAAGAAGG - Intergenic
1097271018 12:57774158-57774180 TTGTTCATAGGGACAGAACTAGG + Intronic
1102032913 12:109753343-109753365 GGGTTCATGGGGATGGGGCAGGG - Intronic
1102911365 12:116716874-116716896 GGGTTTCTATTGATAGAACAGGG + Exonic
1107427154 13:40305570-40305592 GGGTACAATAGGATAGAACATGG - Intergenic
1108507973 13:51129784-51129806 GGGTACCTTAGGATAGAACATGG + Intergenic
1108818639 13:54319346-54319368 GGGTTCATAGGCATACCACTTGG + Intergenic
1109609032 13:64739211-64739233 GGGTACCTTAGGATAGAACATGG + Intergenic
1114711618 14:24784227-24784249 GTCTTCATAAGGATAGAAAATGG + Intergenic
1119208630 14:72812921-72812943 GGGCTCATAGGGATAGGAATGGG + Intronic
1125802358 15:42461079-42461101 GGCTACATAGAGAAAGAACAGGG - Intronic
1127717618 15:61664975-61664997 GAGTTAATAGGGATAGAACATGG + Intergenic
1133346781 16:5076415-5076437 AGGTGCATAGAGATTGAACAGGG - Intronic
1134212610 16:12290328-12290350 GGGTTCATAAAAAAAGAACAGGG - Intronic
1138126033 16:54439328-54439350 GGGGTGATAGAGATAGATCATGG + Intergenic
1142656616 17:1399188-1399210 GGGTTCTGATGGATAGAACCAGG - Intronic
1144426432 17:15146796-15146818 GGGTGCCTTAGGATAGAACACGG + Intergenic
1146553625 17:33804035-33804057 GACTTCAAAGGGAGAGAACATGG - Intronic
1147744956 17:42689282-42689304 GGGATGATAGGGGTAGAATAAGG + Intronic
1149224614 17:54454669-54454691 GGGTACCTTTGGATAGAACATGG + Intergenic
1154957212 18:21270527-21270549 GAGTTCATAGGGATAGGAGAGGG + Intronic
1162061828 19:8100865-8100887 GGGTGCCCAGGGATAGAGCAGGG + Intronic
1166276618 19:41758474-41758496 GGGTTCAGAGGGATGGAACATGG - Intronic
1166420130 19:42630229-42630251 GGGTTCATAGGGATAGAACATGG + Intronic
1166423627 19:42656951-42656973 GGGTTCAGAGGGATGGAACATGG - Intronic
1166900364 19:46056900-46056922 GGGTGTATAGGGAGAGAAGAGGG - Intronic
1167887756 19:52516126-52516148 GGGTACATAGGGTAAGAGCAGGG - Intergenic
1167904535 19:52647893-52647915 GGGTACAGAGGGGTATAACAGGG - Intronic
1167918542 19:52762080-52762102 GGGTACATAGGGTAAGAGCAGGG + Intergenic
927645639 2:24875270-24875292 GGGACCATAGGGATGGAACAGGG - Intronic
931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG + Intergenic
932706494 2:74029740-74029762 GAGGTCATAGGCATAGAATAAGG - Intronic
937422341 2:121768566-121768588 GAGCTCATAGGCAAAGAACAAGG + Intergenic
942774000 2:179558876-179558898 GTTTCCATAGGGATGGAACAGGG - Intronic
943041872 2:182813523-182813545 TGGTTCTTATGGAAAGAACATGG - Intergenic
945294445 2:208156957-208156979 GGGGTCATATGGATAGAACTTGG - Intergenic
948484985 2:238274791-238274813 GGGTTGATACAGACAGAACAAGG - Intronic
1169136231 20:3199474-3199496 GGGTACATAGGGTTAGAGCCAGG - Intronic
1169249300 20:4047905-4047927 GGTTACATATGGACAGAACAGGG + Intergenic
1170470552 20:16664135-16664157 GGGTTAATAGGGATTGCAGAGGG + Intergenic
1173479872 20:43390245-43390267 GGGTTCATGGGGCCAGGACAAGG + Intergenic
1175569716 20:60009646-60009668 GGGCTCACAAGGAAAGAACAGGG - Intronic
1184897812 22:47422134-47422156 GGCTTCAAAGAGAGAGAACAGGG + Intergenic
949274886 3:2268002-2268024 TGGTTCATAGGAATTGATCATGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951712415 3:25597679-25597701 TGCTTCATAGTGATTGAACAAGG - Exonic
956527769 3:70183746-70183768 TAGTTCATAAGGATAGAAGAGGG - Intergenic
956740529 3:72272241-72272263 GGTCTCAGAGGGATAGAAGAAGG - Intergenic
957438247 3:80208295-80208317 GTGATCATAGAGATAGAACTTGG - Intergenic
959625599 3:108446132-108446154 GGGTTCATGGGGATAGGTCTGGG - Intronic
963979258 3:151517929-151517951 GGGTTCGTAAGGTGAGAACAAGG - Intergenic
964092808 3:152895932-152895954 GGGTTCATAGGCAAGCAACAAGG + Intergenic
966536451 3:181040311-181040333 GGGTACCTTAGGATAGAACATGG - Intergenic
967107025 3:186262319-186262341 AGTTTCATAGGGAGAGAAGATGG - Intronic
971483677 4:27138370-27138392 GTGATCATAGAGATAAAACAAGG - Intergenic
973976159 4:56264521-56264543 GGGGTCAGAGGCAGAGAACATGG - Intronic
974922572 4:68260448-68260470 GGGTACCTTAGGATAGAACACGG + Intergenic
977499829 4:97824519-97824541 GGGTACCTTAGGATAGAACAGGG + Intronic
977568173 4:98603083-98603105 GAGTTCAAAGGTATAGAAGAAGG - Intronic
979170476 4:117595645-117595667 GGGTGCCTTAGGATAGAACACGG - Intergenic
986579503 5:9250198-9250220 GGGACAATAGGGATAGAAGAAGG + Intronic
988109552 5:26800503-26800525 GGGTTGATAGTGACAGAACTGGG - Intergenic
989742345 5:44788301-44788323 GGGTACCTCAGGATAGAACATGG - Intergenic
990081888 5:51927205-51927227 GGGTACCTTAGGATAGAACATGG + Intergenic
993300308 5:86200753-86200775 GGGATTATAGGCATAGAACCTGG + Intergenic
995631929 5:114143514-114143536 CTGTTCATAGGGATAAGACAGGG - Intergenic
995632568 5:114149915-114149937 CTGTTCATAGGGATAAGACAGGG - Intergenic
1000061104 5:157655900-157655922 GGGTACCTTAGGATAGAACATGG + Intronic
1000066386 5:157696193-157696215 GGGTACCTTAGGATAGAACATGG + Intergenic
1000272823 5:159702758-159702780 GGGAGGATAGGGAAAGAACAAGG + Intergenic
1005821422 6:29602696-29602718 GGGTACACAGGGAAAGTACATGG + Exonic
1006192061 6:32215486-32215508 GGGTTCATAGGGAGTGAGTAAGG - Intronic
1006596042 6:35193007-35193029 GAGTCCAGAGGCATAGAACAAGG - Intergenic
1007736281 6:43984309-43984331 GGGTTCTAGGGGTTAGAACATGG + Intergenic
1010368230 6:75077526-75077548 GGTATCAAAGGGAAAGAACATGG + Intergenic
1014163211 6:118194559-118194581 GGGTACCTTAGGATAGAACACGG - Intronic
1016848256 6:148590677-148590699 AGGTTCAGAGGGAAAGAATAGGG + Intergenic
1017406231 6:154122445-154122467 GGATACATAGTCATAGAACAGGG + Intronic
1018357492 6:163033899-163033921 GGGTCCCTAGGGATAGAACATGG - Intronic
1020646890 7:10825468-10825490 GGGTACCTTAGGATAGAACATGG + Intergenic
1023756830 7:43426453-43426475 GGGATCATATGGATAGCACTTGG + Intronic
1024867260 7:53918284-53918306 AGGTTCATAGGGAGGGAAAAAGG + Intergenic
1038173319 8:25158883-25158905 GGGTTCCTAGGACTAGGACATGG - Intergenic
1039845106 8:41320532-41320554 GGGTAGAAAGGGAGAGAACAAGG - Intergenic
1040797459 8:51301368-51301390 GGGTACACATGGATATAACAGGG - Intergenic
1041566906 8:59288966-59288988 GGGTTGATGGGGATAGATCCTGG - Intergenic
1043715867 8:83485494-83485516 GGATACATAGGGATAGAAATAGG + Intergenic
1044772885 8:95655793-95655815 GGGTTAATCGGGATAGAACCAGG - Intergenic
1044773537 8:95663026-95663048 GGGTTAATAGGAATAGATCCAGG - Intergenic
1048691556 8:136970571-136970593 CCTTTCATAGGGATACAACATGG + Intergenic
1050685024 9:8158727-8158749 GGGTACACAGGAATAGCACAAGG - Intergenic
1051342467 9:16124358-16124380 GGCTTCTTAAGGACAGAACACGG - Intergenic
1051754433 9:20382228-20382250 GGGGTGAGAGGGATGGAACAAGG - Intronic
1052302752 9:26972519-26972541 GGGAAGATAGGGCTAGAACAGGG + Intronic
1052493349 9:29194115-29194137 GGCTGCATAAGGATTGAACAAGG + Intergenic
1054846928 9:69807976-69807998 GGGTTCATAAGTATAGGTCATGG + Intergenic
1056494943 9:87147458-87147480 GGGTTCAGAGGGATAGAAATTGG - Intergenic
1059068615 9:111110803-111110825 GGTTTCATAGGACTAGAAGAAGG + Intergenic
1202630367 M:11542-11564 TGCCTCATAGGGATAGTACAAGG - Intergenic
1185551425 X:985240-985262 GGTTTCATAGGGCCAGAACCAGG - Intergenic
1189467790 X:41290496-41290518 AGGTTCATAGAGACAGAAAATGG - Intergenic
1191823213 X:65336039-65336061 GGGTCCCTTAGGATAGAACATGG - Intergenic
1194138489 X:90178010-90178032 GGGGTACTTGGGATAGAACATGG - Intergenic
1200484286 Y:3748247-3748269 GGGGTACTTGGGATAGAACATGG - Intergenic
1200804290 Y:7416310-7416332 AGGTTTATAGAGATAGAAGAAGG + Intergenic