ID: 1166420355

View in Genome Browser
Species Human (GRCh38)
Location 19:42631704-42631726
Sequence CTCATGACTTCTGGGTGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166420355_1166420361 -10 Left 1166420355 19:42631704-42631726 CCCCGACACCCAGAAGTCATGAG 0: 1
1: 0
2: 1
3: 13
4: 99
Right 1166420361 19:42631717-42631739 AAGTCATGAGGAATCACTCACGG 0: 1
1: 0
2: 3
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166420355 Original CRISPR CTCATGACTTCTGGGTGTCG GGG (reversed) Intronic
902756987 1:18555582-18555604 CTCATGACTGCTGCTTGTCTTGG - Intergenic
908653924 1:66367525-66367547 CTGATGACTTCTGTTTGTAGAGG + Intronic
915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG + Intergenic
915902926 1:159859003-159859025 CTGCTGACCTCTGGGTGCCGTGG - Intronic
916039671 1:160951215-160951237 GACATGACTTCTGGGGGTGGCGG - Exonic
917844560 1:179009799-179009821 CTCACGACTTCTGGATGGCAAGG + Intergenic
921193529 1:212730592-212730614 CCCCTGACTTCTGGGTGGCCTGG - Intronic
1067281982 10:44879978-44880000 CTCATGCCTGCTGGGTTTCCTGG + Intergenic
1067757968 10:49019537-49019559 CTCATGCCTTCTGAGTGGTGGGG - Exonic
1072681280 10:97508717-97508739 CACATGGCTTCTAGGTGTGGAGG - Intronic
1075544969 10:123348341-123348363 CTCTTGACTTCTGAGTGCCTAGG + Intergenic
1076794407 10:132791638-132791660 CAGATGGCGTCTGGGTGTCGAGG - Intergenic
1077322785 11:1949792-1949814 CTCAGGCCTGCTGGGTCTCGGGG - Intronic
1079922067 11:26445503-26445525 CTCATCACTTTTGTGTGTCTCGG + Intronic
1081640358 11:44749107-44749129 CTCAAGACTGCAGGGTGTGGTGG - Intronic
1081949735 11:47033915-47033937 CTCATGGGTTCTGGGTGGCCAGG + Intronic
1202805803 11_KI270721v1_random:5105-5127 CTCAGGCCTGCTGGGTCTCGGGG - Intergenic
1094658122 12:32440767-32440789 TTCCTGACTTCTGGCTGTGGGGG - Intronic
1112400375 13:99072389-99072411 CTCATGTGTTCTGGGTGGCCAGG + Intronic
1119976427 14:79029414-79029436 CTCTTGACTTTTGGGTGTCGGGG - Intronic
1124600128 15:31127147-31127169 CTCATTCCTTCTGGGTTTCTAGG + Intronic
1128801507 15:70499983-70500005 CTGATGGCTTCTGGGTGACAGGG - Intergenic
1133750232 16:8719590-8719612 CTCATGAAATCTGGATGTTGAGG + Intronic
1136082134 16:27859203-27859225 CTCCTGACTTCTGGCTCTAGGGG + Intronic
1137822753 16:51461528-51461550 CTCTTCACTTCTGGATGTCATGG + Intergenic
1140855603 16:78975316-78975338 CTCCTGATTTCTGGGGGTAGAGG + Intronic
1143169280 17:4917840-4917862 CTCATGTCTTCTGGGATTCTGGG - Intergenic
1143736168 17:8913369-8913391 CCCATGCCTTCTGGCTGTGGAGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1146333996 17:31953656-31953678 CTCAGCACTTCAGGATGTCGAGG - Intronic
1148887010 17:50781234-50781256 CTCCTGGCTTCTGGGTGTCCAGG + Intergenic
1149165346 17:53744865-53744887 CTCATGCATTCTGTGTGTCAGGG + Intergenic
1152102319 17:78309311-78309333 CCCATGACTCCTGGGTCTGGAGG - Intergenic
1153505221 18:5789936-5789958 TTCATGACTTCTAGGTGAGGGGG - Intergenic
1155480606 18:26283369-26283391 ATCAGAACTTCTGGGTGACGAGG + Intronic
1157032683 18:43931723-43931745 CTCATCATTTCTGGGTATGGTGG + Intergenic
1158348444 18:56539928-56539950 CTCTAGACTTCTGGGTTTTGGGG + Intergenic
1161113690 19:2484819-2484841 GTCAGGAGTTCTGGGTGTCCAGG - Intergenic
1165742969 19:38214458-38214480 GTCATGAATTGTGGTTGTCGTGG - Intronic
1166255492 19:41601542-41601564 CTCATGAGCTCTGGGTGTTGGGG + Intronic
1166266332 19:41686824-41686846 TCCATGACTTCTGGGTGCTGGGG - Intronic
1166270406 19:41710052-41710074 CCCATGACCTCTGGGTGTTGGGG + Intronic
1166276352 19:41756971-41756993 CACATGACCTCTGGGTGTTGGGG + Intronic
1166281609 19:41797960-41797982 CACATGACCTCTGGGTGTTGGGG + Intronic
1166406741 19:42527007-42527029 CCCATGACCTCTGGGTGTTGGGG - Intronic
1166415690 19:42593507-42593529 CCCATGACCTCTGGGTGTTGGGG - Intronic
1166420355 19:42631704-42631726 CTCATGACTTCTGGGTGTCGGGG - Intronic
1166423425 19:42655512-42655534 CTTATGTCCTCTGGGTGTTGGGG + Intronic
1166495926 19:43303140-43303162 TTCATGACCTCTGGGTGTTGGGG - Intergenic
1168403702 19:56100093-56100115 CTCCTGACTTCCGTGTGTCCCGG - Intronic
935431247 2:102978153-102978175 CTCAGGAGTTCTTGGTGTGGCGG + Intergenic
940136904 2:150447549-150447571 CTCTTAACTTGTGGGTGTCTGGG - Intergenic
945691967 2:213047418-213047440 CTCATGCCTTCTGGCTATGGAGG - Intronic
947640660 2:231706236-231706258 CTCATTGCATCTGGGTTTCGTGG + Intergenic
947895785 2:233670769-233670791 CTCATGGGTTCTGGGTGGCTAGG + Intronic
948530983 2:238604620-238604642 ATCATGACTGCTGGGAGTTGGGG + Intergenic
1172231841 20:33341974-33341996 CTCCAGACTTCTGGGTGTCTTGG + Intergenic
1172950315 20:38719386-38719408 TTCATGACTTCTGGGGTTCAAGG - Intergenic
1176081532 20:63275832-63275854 CTCATCAGTGCTGGCTGTCGGGG + Intronic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1178385290 21:32144070-32144092 CACATGACTCCTGGGGGTCTTGG + Intergenic
1178638557 21:34327209-34327231 CTGATGATTTCTGGGGGTTGGGG + Intergenic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1181305803 22:21916596-21916618 CTCAGGACCTCTGGGTGGGGGGG - Intergenic
1184638483 22:45855476-45855498 CACATTATTTCTGGGTGTCTCGG - Intergenic
1184969622 22:48006524-48006546 CACATGACATCTGGCTGCCGTGG + Intergenic
1185398955 22:50606151-50606173 CTCATCACCTCTGGGTCTCTGGG + Intronic
963219052 3:142786043-142786065 GTCTTGCCTTCTGTGTGTCGGGG + Intronic
965333902 3:167411242-167411264 CTCATGAACTCAGGCTGTCGGGG + Intergenic
966531867 3:180989863-180989885 CTCTTTATTTCTGGGTGTAGGGG + Intergenic
967549050 3:190767789-190767811 CTCATGATGACTGGGTGTGGTGG - Intergenic
980309855 4:131112823-131112845 CACATGTCTTCTTGGTGTCTGGG - Intergenic
983627885 4:169820891-169820913 CTTCTAACTTCTGGGTGTGGAGG - Intergenic
986049988 5:4081151-4081173 CTCATAACTGCTGGGCGTCGAGG + Intergenic
988400953 5:30759636-30759658 CTCATGAGGTCTGGGTGGCCAGG - Intergenic
991942364 5:71865033-71865055 CTTAGGAGTTCTGGGTGTCCTGG + Intergenic
992431650 5:76716217-76716239 CTCCTGACTTCTGCGGGTCGGGG - Exonic
993538738 5:89121801-89121823 CTTGTGACTTCTGGGTGTGCTGG + Intergenic
1001733712 5:173981270-173981292 CTCAAGACTTCTGGTTATCCAGG + Intronic
1002388879 5:178893651-178893673 CTCATGGGTTCTGGGTGACCAGG + Intergenic
1003722653 6:8721610-8721632 CTCATGACTTGTGGGTGTGTTGG - Intergenic
1003802854 6:9690923-9690945 CTTATGACTTCTGTGTCTCTTGG + Intronic
1003819613 6:9882048-9882070 CTAATGTCATCTGGGTGTGGTGG + Intronic
1008449503 6:51634282-51634304 CTCTTGACTTCTGGCTGACTTGG + Intronic
1011754067 6:90481544-90481566 CGCATGACTTCTATGTGTGGAGG + Intergenic
1012767540 6:103387513-103387535 CCCATGACTTCTGGGAATTGTGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1014278551 6:119416278-119416300 CTCATGACCTCTGGTTGGCCAGG + Intergenic
1014420953 6:121245104-121245126 CTCAGGACTTCTGGGTAGCCAGG - Intronic
1021582036 7:22166212-22166234 CTAATGATGGCTGGGTGTCGTGG - Intronic
1028164854 7:87526626-87526648 CTCATGGGTTCTGGGTGGCCAGG + Intronic
1032578616 7:133082054-133082076 CTCCTTGCTTCTGGGGGTCGTGG - Exonic
1033252026 7:139768696-139768718 CTCCTGAGTTCTGGTTCTCGTGG - Intronic
1034163381 7:149008109-149008131 CTCATGCCTGCGGGGTGTCCAGG + Intronic
1035578216 8:722355-722377 CTCATTTCTGCTGGGTGTTGCGG - Intronic
1037597783 8:20368953-20368975 CTCATCACTTCTGGAGGTAGGGG + Intergenic
1044187383 8:89270612-89270634 CTCATTTTTTCTGGGTGTCATGG + Intergenic
1051367034 9:16328637-16328659 CTCATCTCTTTTGGGTGGCGGGG - Intergenic
1056893472 9:90517843-90517865 CTCATGACGGCTGAGTGTCCAGG - Intergenic
1058554728 9:106154870-106154892 CTCATGACTTCTGGGTCTGATGG - Intergenic
1060522325 9:124300814-124300836 CTCAGGACTTCTGGCTCTCCAGG + Intronic
1060872383 9:127053179-127053201 CTCATGACATCGTGGTGTCCAGG - Intronic
1061839367 9:133348624-133348646 CTCATGACTCCTCTGAGTCGCGG - Intronic
1062038329 9:134392593-134392615 CTCCTGACTTCTGGGTCCCTGGG + Intronic
1062166704 9:135111459-135111481 CTCAGGCCTCCTGGGGGTCGTGG - Intronic
1187864322 X:23710176-23710198 CTCATGAGAGCTGGGTGTGGTGG - Intronic
1192445915 X:71211103-71211125 CTCATTACTTCAGGGAGTTGTGG - Intergenic
1193886696 X:86991142-86991164 CTCAAGAATACTGGGTGTGGTGG - Intergenic
1195684928 X:107576932-107576954 CTCATTATTTCTGGGTGCTGGGG - Intronic
1200308799 X:155056628-155056650 CTCCTGACATCTGGGTCTCTGGG + Exonic
1201687920 Y:16727854-16727876 CTCATGACTTCTACGTCTCCTGG + Intergenic
1202244398 Y:22803946-22803968 CTTATGACAGCTGGGTGTGGTGG - Intergenic
1202397386 Y:24437692-24437714 CTTATGACAGCTGGGTGTGGTGG - Intergenic
1202473395 Y:25232396-25232418 CTTATGACAGCTGGGTGTGGTGG + Intergenic