ID: 1166420383

View in Genome Browser
Species Human (GRCh38)
Location 19:42631951-42631973
Sequence TGGCCACAACTGGTACAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 4, 2: 4, 3: 12, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166420383_1166420389 -9 Left 1166420383 19:42631951-42631973 CCCCTTTGTACCAGTTGTGGCCA 0: 1
1: 4
2: 4
3: 12
4: 116
Right 1166420389 19:42631965-42631987 TTGTGGCCAAGTATATCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 125
1166420383_1166420388 -10 Left 1166420383 19:42631951-42631973 CCCCTTTGTACCAGTTGTGGCCA 0: 1
1: 4
2: 4
3: 12
4: 116
Right 1166420388 19:42631964-42631986 GTTGTGGCCAAGTATATCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166420383 Original CRISPR TGGCCACAACTGGTACAAAG GGG (reversed) Intronic
902797441 1:18808672-18808694 TGCCCACAGCTGGTAGAAACAGG + Intergenic
907462690 1:54614666-54614688 TGGACACAGCTGGGACAGAGAGG + Intronic
911239913 1:95453852-95453874 TGCGCACAACAGGTAGAAAGAGG - Intergenic
911793450 1:102047322-102047344 TGGCCACAATTGGTGCAAAGAGG + Intergenic
914248556 1:145903554-145903576 TGTACACTAATGGTACAAAGAGG - Intronic
921739634 1:218669060-218669082 AGGCCAACACTGGTACAATGAGG - Intergenic
922724689 1:227917418-227917440 TGGCCACAGCTCCTACTAAGAGG - Intergenic
1062962471 10:1583010-1583032 TGGTGACAACAAGTACAAAGTGG - Intronic
1067746375 10:48939354-48939376 TGGCCACACCTGTCACACAGGGG - Intronic
1068009278 10:51427557-51427579 AGGCCACAACTGGTTGATAGGGG + Intronic
1073667336 10:105548335-105548357 TGGCCTTAAGTGGTACAATGAGG - Intergenic
1085414473 11:76311032-76311054 TGGCCTCACCTGGTACATGGAGG - Intergenic
1096586238 12:52621904-52621926 TGGTCTCCACTGGTACCAAGTGG - Intergenic
1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG + Intergenic
1100768349 12:97894042-97894064 TGTTCACAATTGCTACAAAGAGG - Intergenic
1104710102 12:130979671-130979693 TGCCCAGAACTGGTCCAAAGAGG - Intronic
1105909792 13:24852502-24852524 TGGCCATATATGGTACAAAGTGG - Intronic
1108780228 13:53821495-53821517 AGGCCCCAACTGTTACAAGGAGG - Intergenic
1108932869 13:55851279-55851301 AGGAAACAACTGGTAGAAAGTGG - Intergenic
1110465849 13:75800478-75800500 TGCCCACAACTGATACAATAAGG - Intronic
1110900045 13:80810775-80810797 TGGCTACCAGAGGTACAAAGAGG - Intergenic
1112846277 13:103647391-103647413 TGACCACAACTGGGACTGAGAGG - Intergenic
1113168298 13:107468465-107468487 TAGCCACAACTGGTTAAGAGGGG + Intronic
1113273425 13:108700717-108700739 TTGCAACAATTGGTACAAACAGG + Intronic
1113394280 13:109931361-109931383 TGGCCAAATTTGGAACAAAGTGG + Intergenic
1115080684 14:29446681-29446703 TGGCCATAGCGGGTACAAAGGGG - Intergenic
1115347661 14:32360686-32360708 TGGCCAAAACTGGAACAATCTGG - Intronic
1117007890 14:51441013-51441035 TTGCCACAACAGGTATCAAGTGG - Intergenic
1119641497 14:76318541-76318563 AGGTCACAACTGTTACAACGTGG - Intronic
1124192305 15:27590997-27591019 TGGCCTCTACTGTAACAAAGGGG + Intergenic
1126336226 15:47588910-47588932 TTGCCACAACTGTCACAATGGGG + Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1131957733 15:97755520-97755542 TGGCCTCCACTGGTATAAAGAGG + Intergenic
1133885118 16:9820095-9820117 TGGCCATAAATTGTACAAATTGG - Intronic
1141520537 16:84575899-84575921 TGAGAACACCTGGTACAAAGCGG + Intronic
1142248736 16:88981425-88981447 TGGGGAAACCTGGTACAAAGTGG + Intergenic
1143125541 17:4639269-4639291 TGGCTGCAGCTGGCACAAAGTGG - Intronic
1143402930 17:6657543-6657565 TGGCTGCAGCTGGCACAAAGTGG + Intergenic
1145101617 17:20081886-20081908 TGGCCTCAACTGGCACACATGGG - Intronic
1157903272 18:51541686-51541708 TGGCCAATCCTGGTACAATGTGG + Intergenic
1157998797 18:52592370-52592392 TGGTCAAAACTGGCTCAAAGAGG + Intronic
1159166233 18:64704592-64704614 TTGCCACAGCTGGGAGAAAGGGG - Intergenic
1166046822 19:40234867-40234889 TGGCCTCACCAGGTCCAAAGAGG + Intronic
1166255468 19:41601322-41601344 TGGCTACAACTGGTACAAAGGGG + Intronic
1166266363 19:41687075-41687097 TGGCTACAACTGGTACAAAGGGG - Exonic
1166281579 19:41797713-41797735 TGGCTACAGCTGGTACAAAGGGG + Exonic
1166406775 19:42527254-42527276 TGGCTACAGCTGGTACAAAGGGG - Exonic
1166411825 19:42560647-42560669 TGGCTATAACTGGTACAAAGGGG - Intronic
1166415720 19:42593754-42593776 TGGCTACAACTGGTACAAAGGGG - Exonic
1166420383 19:42631951-42631973 TGGCCACAACTGGTACAAAGGGG - Intronic
1166423397 19:42655265-42655287 TGGCTACAACTGGTACAAAGGGG + Intronic
1166491968 19:43268003-43268025 TGGCTACTTCTGGTACAAAGGGG - Exonic
1167770357 19:51510975-51510997 TGCCCACAACTGGTGCAAGGTGG - Intergenic
1168698051 19:58416939-58416961 TGCCCACAACTGGAACCAGGTGG - Exonic
928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG + Intergenic
929549327 2:42879515-42879537 TGGCCAGGACTGGATCAAAGGGG + Intergenic
929716568 2:44316824-44316846 TGGCCACACATGGTAAAATGTGG - Intronic
933256388 2:80085774-80085796 TGAGCACAACTGACACAAAGAGG - Intronic
936611048 2:114002269-114002291 AGGCCAGAAATGGTACAAAATGG - Intergenic
937685043 2:124686529-124686551 TGGGCTCATCTGGAACAAAGGGG - Intronic
941540641 2:166779745-166779767 TGGCCACAACTGGGAGGGAGGGG - Intergenic
942005193 2:171691747-171691769 TGGCCATAACTGGCAAAAATGGG + Intronic
946496609 2:220201880-220201902 CTGCCACCACTGGTGCAAAGAGG - Intergenic
1170279744 20:14633093-14633115 TGGCCACTACTGGCAGGAAGAGG - Intronic
1170453190 20:16507302-16507324 TGGACACATCAGATACAAAGAGG - Intronic
1171566401 20:26194734-26194756 TGGCCAAAACTGGGGCAAAGAGG + Intergenic
1174185357 20:48702499-48702521 TGACCACACCTGGCACAAGGGGG - Intronic
1174481420 20:50833894-50833916 TGGCCAGAGCTGGAACAGAGGGG + Intronic
1174647176 20:52096211-52096233 TGGCCACACCGAGTACCAAGGGG - Intronic
1175371316 20:58495062-58495084 TGGCCCCAACTGGTGCAGATTGG + Intronic
1177038422 21:16073940-16073962 TGACATCAACTGGTACATAGTGG - Intergenic
1181629451 22:24142911-24142933 TGGTCACAACTGGTCCTGAGAGG - Intronic
1183079879 22:35449555-35449577 AGGCCACAGCTGGGACAAAGAGG - Intergenic
949168022 3:963886-963908 TTGCCACAACTGGCTCAAAAAGG - Intergenic
949940722 3:9152227-9152249 TGGCCACAACCTCTAGAAAGGGG + Intronic
957111772 3:75970141-75970163 TGGCCAAAATTGGGGCAAAGAGG - Intronic
957796736 3:85018930-85018952 TGATCACAACAGGCACAAAGTGG - Intronic
958057134 3:88427600-88427622 TGGCCACCACTGGGACACAGAGG - Intergenic
960649779 3:119933953-119933975 TGGCCAAACCTGGGACAATGTGG + Intronic
962420954 3:135228957-135228979 GGTCCACACCTGGTAAAAAGTGG - Intronic
963514391 3:146290480-146290502 AGTCTACCACTGGTACAAAGAGG - Intergenic
963831619 3:150014997-150015019 TTGCCAAAACTGAAACAAAGAGG - Intronic
968006423 3:195246301-195246323 TGGCCACACTTGGCACAGAGAGG - Intronic
968690042 4:1985708-1985730 TGGCCACAATCGGAACAAAAGGG + Intronic
969468497 4:7371869-7371891 TGGCCACAGCTGAGATAAAGAGG + Intronic
970427223 4:15956450-15956472 TGGCCATTACTGGTACGCAGTGG + Intergenic
973084915 4:46046363-46046385 TTGTCACAACTGGTACTAACTGG + Intronic
973085068 4:46048494-46048516 TTGTCACAACTGGTACTAAATGG + Intronic
974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG + Intergenic
974969575 4:68807485-68807507 TAGCCACAGCTGAGACAAAGGGG - Intergenic
975661782 4:76695996-76696018 TGGACATAATTGGTACACAGTGG - Intronic
976530681 4:86149099-86149121 AGGCCAGAACTGGATCAAAGTGG - Intronic
978871477 4:113583487-113583509 TGGACTCAACTGGTAAAAATGGG + Intronic
984342837 4:178481041-178481063 TGGCCAAACCTGGGACAAATGGG - Intergenic
986273400 5:6253431-6253453 TGGCCACATCTGGTTCCACGGGG + Intergenic
988967813 5:36437659-36437681 TGGTCTCAACTGGTTCAAACTGG + Intergenic
990544663 5:56810877-56810899 TGGCCAAAGCTGCTATAAAGAGG - Intergenic
991029660 5:62069436-62069458 TGGCCAAATCTGGAACAAATTGG + Intergenic
992120336 5:73586022-73586044 TGGCAATAACTGGCATAAAGAGG + Intergenic
992572694 5:78076165-78076187 TGGGCAAAACTGTTACAAAAAGG + Intronic
993736260 5:91479863-91479885 TGGCCCTAACTGGGAGAAAGAGG - Intergenic
995059386 5:107796987-107797009 TGGCTATATCTGGTATAAAGTGG + Intergenic
995986745 5:118185400-118185422 GGGCAAAAACTGGTACATAGAGG + Intergenic
996353747 5:122574483-122574505 TGGCAACAACAGTTACAGAGAGG + Intergenic
996397634 5:123029343-123029365 TGGGCACAACTTTTCCAAAGAGG + Exonic
998094292 5:139388577-139388599 TTGCCACATCTGGAACAAGGAGG + Exonic
1001695890 5:173669500-173669522 TGGCCTCAGCTGGCACATAGTGG + Intergenic
1001974305 5:175984276-175984298 TGGTCTCAACTGGTTCAAACTGG + Intronic
1002243128 5:177859503-177859525 TGGTCTCAACTGGTTCAAACTGG - Intergenic
1004403590 6:15311227-15311249 TGCCCAAGACTGGTACAAGGTGG - Intronic
1005417448 6:25615968-25615990 TGGCAATAATTGGTACAGAGAGG - Intronic
1010428469 6:75751102-75751124 CCGCCACAAATGTTACAAAGTGG + Intronic
1015975757 6:138789274-138789296 TGTCAATAACTGGTTCAAAGGGG - Intronic
1017802042 6:157905673-157905695 AGGCCACAACTGTCCCAAAGGGG - Intronic
1017849214 6:158288935-158288957 TAGCCACAACTAGTTCTAAGAGG - Intronic
1019902948 7:4038155-4038177 TGTCCTCAACTGATTCAAAGGGG - Intronic
1021020191 7:15587979-15588001 TGGCCCAAATTGTTACAAAGAGG + Intergenic
1021022447 7:15620149-15620171 TGACTACAACTGGTAAAATGGGG - Intronic
1031041385 7:116841913-116841935 TGAGAACAACTGGTCCAAAGGGG + Intronic
1032172312 7:129595209-129595231 TGGCCAAAGCTGGAACAATGTGG - Intergenic
1035052440 7:156007132-156007154 TGGCCAAAACAGCTACAATGTGG - Intergenic
1042670823 8:71261694-71261716 TGCCAAGAAGTGGTACAAAGAGG + Intronic
1045302119 8:100920744-100920766 TGTCCACAACTGGTAAAAGAAGG + Exonic
1046126876 8:109920976-109920998 TTGCCACAACTGGAACAAATAGG - Intergenic
1048065765 8:130966739-130966761 AGGACGCAACTGGTACAGAGGGG - Intronic
1049207775 8:141371404-141371426 TGGCCACAGCTGGCACAAGGTGG + Intergenic
1053094110 9:35309187-35309209 TGGCCCAAACTTGTTCAAAGGGG + Intronic
1053094354 9:35311470-35311492 TGGCCCAAACTTGTTCAAAGGGG + Intronic
1058153501 9:101486837-101486859 TGGCCACAGCTGGCACAAGCAGG - Intronic
1058771373 9:108235852-108235874 TGTCCACAAATGGTACACAAGGG - Intergenic
1059384542 9:113954052-113954074 TAGCAACAACTAGGACAAAGAGG + Intronic
1059564150 9:115366118-115366140 TGGAAACAACTGGGCCAAAGTGG + Intronic
1061751058 9:132777274-132777296 TGGGCACAACTGGCACCAATAGG - Intronic
1187242712 X:17528156-17528178 TTGCCACAACTGGAGAAAAGGGG + Intronic
1187749615 X:22447426-22447448 TGTCCTCATCTTGTACAAAGAGG + Intergenic
1192972576 X:76249726-76249748 TGGCCACGACTGGCACTAAGCGG - Intergenic
1196703830 X:118699276-118699298 TTGTCACAACTGGGGCAAAGAGG + Intergenic