ID: 1166420872

View in Genome Browser
Species Human (GRCh38)
Location 19:42635022-42635044
Sequence TAAGTGTGAGTTCAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166420872_1166420879 12 Left 1166420872 19:42635022-42635044 CCCTCCATCTGAACTCACACTTA 0: 1
1: 0
2: 1
3: 14
4: 177
Right 1166420879 19:42635057-42635079 CCCTGATCTCTCAACTCTCTTGG 0: 1
1: 2
2: 2
3: 13
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166420872 Original CRISPR TAAGTGTGAGTTCAGATGGA GGG (reversed) Intronic
902627679 1:17686166-17686188 TAAGTGTGAGTTTAAATGCAGGG + Intronic
903623567 1:24715275-24715297 TAAGTGCGGGGGCAGATGGAGGG + Intergenic
904249183 1:29210464-29210486 TAAGTGTTAGCTGAGATGAATGG - Intronic
906164858 1:43678540-43678562 GAAGTGGGAGTGCAGGTGGAGGG + Intronic
906757248 1:48330225-48330247 TTTGTGTGAATTCAGCTGGAGGG + Intronic
910312481 1:85839925-85839947 TAAGTTTTTGTTCAGATGGTAGG - Intronic
911769889 1:101726972-101726994 TAAGTTTTATTTCAGCTGGAAGG + Intergenic
911834571 1:102600238-102600260 TAACTGGGTGTTCAGATTGAAGG + Intergenic
913393319 1:118338807-118338829 TATTTGTGAGTTGAGATGCAGGG - Intergenic
916292989 1:163187099-163187121 GAAATGTGAGTGCAGATGGCTGG - Intronic
917328185 1:173855001-173855023 CAAGTGTGAGGTAGGATGGAAGG + Intronic
917628282 1:176867802-176867824 TTAGTCAGAGGTCAGATGGATGG + Intronic
919181642 1:194091644-194091666 TAAATGTGACTTTAGATAGAAGG - Intergenic
919499547 1:198319002-198319024 TAATTGTAAGTTTAAATGGAAGG - Intronic
920029121 1:203026232-203026254 CAAGGGCGAGTTCAGAGGGAGGG + Intergenic
922224051 1:223629928-223629950 TCAATGTGTGTTCAGATGGAAGG + Intronic
924501401 1:244642097-244642119 TATGTGTGGGTGTAGATGGATGG + Intergenic
1065414382 10:25468473-25468495 TAAGTGTGACTGCATATGAAAGG + Intronic
1066275316 10:33862967-33862989 TATGTGTGTGTGCTGATGGAAGG - Intergenic
1066534994 10:36381715-36381737 GAAGTGTGAGGACAGAGGGAGGG - Intergenic
1067279896 10:44863308-44863330 TCATTGTGAGTGCAGAGGGACGG + Intergenic
1067320640 10:45217480-45217502 TAAGGGTGAGGTCAAATGAAAGG - Intergenic
1067551856 10:47241962-47241984 GAAGTGTGAGTCAAGAGGGAGGG - Intergenic
1073124027 10:101139000-101139022 TAGGGGTGAGTTGAAATGGAGGG + Intergenic
1073945027 10:108740679-108740701 TCAGTGTGAACTCAGCTGGAGGG - Intergenic
1074758522 10:116646606-116646628 CCAGTGTGAGTTCAGGTGGTTGG - Intergenic
1076136715 10:128050203-128050225 TAAGTGGGAGGGCAGAGGGATGG + Intronic
1076136732 10:128050270-128050292 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076136763 10:128050399-128050421 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076136777 10:128050454-128050476 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076439669 10:130472503-130472525 GAAGTGTGTGTTCAGAGAGAGGG - Intergenic
1080844661 11:36015998-36016020 TAAGTGTGAGCTCACAGGGAGGG + Intronic
1081479318 11:43470314-43470336 CAAGTGTCAGTTCAGATAGAAGG + Intronic
1081962634 11:47149471-47149493 TGAGCTTGAGTTCAGAAGGAAGG + Intronic
1083298082 11:61725952-61725974 TATGTGTGAGGTCAGAGGGCTGG - Intronic
1085393860 11:76196400-76196422 TCTGTGTGTGTTTAGATGGAGGG - Intronic
1086144515 11:83537037-83537059 TAAGTGTGAGTGGGGAAGGAAGG - Intronic
1087384573 11:97454131-97454153 TAAATGTGAGTACAGAAGAAAGG + Intergenic
1088842181 11:113636306-113636328 AAGGTGTAAGTCCAGATGGATGG + Intergenic
1090568676 11:128023867-128023889 TAAGAGTGAGTACAGCAGGATGG + Intergenic
1092198860 12:6567560-6567582 CAATTGTGAGTTCAGAGGAAGGG - Intronic
1093393462 12:18651700-18651722 TGAGTCTGACTTCAGATGAATGG - Intergenic
1095632225 12:44391789-44391811 TAAGGGTTAGTTCAGAGTGAAGG - Intergenic
1095818988 12:46456216-46456238 CAAGGGAGAGTTCAGATGGAAGG + Intergenic
1096189046 12:49603054-49603076 GAAGTTTGATTTGAGATGGATGG - Intronic
1097234292 12:57529011-57529033 TAAGTGTGTGTTTGGGTGGATGG + Intronic
1097693141 12:62752966-62752988 TATGTGTGATGTCAGGTGGAGGG + Intronic
1098348872 12:69535985-69536007 TAAAAGTGTGTTCAGATAGAGGG - Intronic
1101189513 12:102316861-102316883 TAACTGTGAGTACAGATAGCTGG - Intergenic
1101716224 12:107315349-107315371 TGAGTGTGTGTTCAGAAGGCTGG + Intergenic
1102463926 12:113117049-113117071 TAAATGTGGGTGCAGAGGGAGGG - Intronic
1102529188 12:113533380-113533402 TAAGTGTGAAAACAGAGGGAAGG - Intergenic
1102924106 12:116813776-116813798 GCAGTGTGAATTCAGTTGGAAGG + Intronic
1104746092 12:131211339-131211361 TGAGTGTGAGTCCAGGTAGAAGG - Intergenic
1105951845 13:25236002-25236024 TAAGTGTGAATACAGATTGCTGG + Intergenic
1106102317 13:26705750-26705772 TCACTGTGACTTCACATGGAGGG + Intergenic
1107726506 13:43304891-43304913 CATAGGTGAGTTCAGATGGATGG - Intronic
1110114213 13:71791714-71791736 TAACTGTGAATTCACTTGGAAGG - Intronic
1110297543 13:73886013-73886035 TAAGGGATAGTTCTGATGGATGG + Intronic
1110430579 13:75418324-75418346 TAAATGAGAATCCAGATGGAGGG + Intronic
1111843569 13:93479780-93479802 TAAGAGAGAGTTCATATAGAAGG + Intronic
1112655137 13:101444335-101444357 AAAGAGTGAGTGGAGATGGAAGG + Intergenic
1113572928 13:111371573-111371595 TGAGTGTGGGTTGAGATTGAGGG + Intergenic
1113658951 13:112090866-112090888 TCAGTGTGAGTTTACATGCATGG - Intergenic
1115560389 14:34577561-34577583 TATGTTTGAGGTGAGATGGAAGG + Intronic
1117783480 14:59258426-59258448 TAGGTGAGACTTAAGATGGAAGG - Intronic
1119562752 14:75604021-75604043 TAACTGAGAGTTCAGGTGGTTGG + Intronic
1120492071 14:85190777-85190799 GAACTGTGAGTTGGGATGGAAGG + Intergenic
1120844801 14:89116287-89116309 TCAGTGTGAGTTCAAATCCAGGG - Intergenic
1120984470 14:90321899-90321921 TAGTTGGGAGTTCAGAGGGAGGG + Intronic
1121401981 14:93688031-93688053 TCAGTGTGAGCTCAGTGGGAAGG - Intronic
1121487608 14:94330779-94330801 TCAGTGTGATTTCAGAGGGGTGG - Intergenic
1121630740 14:95420235-95420257 TGAGTGTGAGTTCACAGAGAAGG + Intronic
1121745589 14:96288066-96288088 TAAGTGTGGATTGAGATGGTAGG - Intronic
1122966813 14:105134414-105134436 TAAGTGTGAGTACAGAAAAAGGG + Intergenic
1124177965 15:27443759-27443781 TAAGTGTGATATTAGTTGGAGGG + Intronic
1124871681 15:33549770-33549792 TACGTTTTAGTTCAGATGGCAGG + Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1125579806 15:40777056-40777078 TAAATGTGAGTTGAGGTGGGAGG - Intronic
1128557235 15:68640085-68640107 TCACTGTGAGGTCAGATGCATGG - Intronic
1136123262 16:28155908-28155930 TAAGTCTGAGATTAGCTGGAAGG - Intronic
1137369494 16:47891749-47891771 TAATGGTGACTTCAGATGCAGGG - Intergenic
1137790004 16:51166953-51166975 TAAGTGTGTGTTTGGAAGGAAGG + Intergenic
1141396676 16:83711153-83711175 TATCTGTGACTTCAGATGCAGGG + Intronic
1141669909 16:85486202-85486224 TATGTGTGAGTACAGAGAGAAGG - Intergenic
1147337701 17:39737494-39737516 TAAGGGTGACTGCAGATCGAGGG + Intergenic
1148560031 17:48600762-48600784 GAAGTGTGTGTTCAGAGAGATGG + Intronic
1151639561 17:75380609-75380631 CAAGCATGAGTTAAGATGGATGG + Intronic
1153003514 18:477693-477715 TAAGAGAGATGTCAGATGGATGG - Intronic
1154391782 18:13943088-13943110 TGAGGGTGAGTCCAGAAGGAAGG + Intergenic
1157172750 18:45423012-45423034 GGAGTGTGAGTTCTAATGGAGGG - Intronic
1158039668 18:53077406-53077428 TAAGTGTGAGTTAAAGGGGAAGG + Intronic
1162196816 19:8991327-8991349 TAAGTGTGACTGCTGAAGGAGGG - Intergenic
1164311009 19:24046281-24046303 TAAGTGGGAGTAAAGATGGTAGG + Intronic
1164530635 19:29045831-29045853 TGACTGTGAGCTCAGATGCAGGG + Intergenic
1166251026 19:41570875-41570897 AAGGGGTGAGTTCAGGTGGAGGG + Intronic
1166420872 19:42635022-42635044 TAAGTGTGAGTTCAGATGGAGGG - Intronic
925587474 2:5477564-5477586 CAGGTGTGTGTTCAAATGGAAGG - Intergenic
927530756 2:23797372-23797394 TAACTTTGAGTTCAGATCTAAGG - Intronic
929248967 2:39732053-39732075 TGAGTATCAGTTTAGATGGATGG - Intergenic
931986634 2:67748367-67748389 GAAGTGTGAGCTCACATGCAGGG - Intergenic
933544213 2:83689371-83689393 TAAGTGTGTGTTAAGATGCTAGG + Intergenic
938654682 2:133418884-133418906 TTAGTGTGGGTTCAGACCGAGGG + Intronic
938772046 2:134509018-134509040 TAAGTGGGATTTCAGTTGGTTGG - Intronic
941293910 2:163711979-163712001 TACGTGTGTGTTCAGAGGGTGGG - Intronic
942968363 2:181925701-181925723 GAAGGGTGAGGTCAGATGGAAGG - Intronic
947262728 2:228242182-228242204 TAAGTGTGTGTTTAGATGCATGG - Intergenic
1171041980 20:21773004-21773026 TAATTATGAATTCAGCTGGATGG + Intergenic
1174526339 20:51174913-51174935 TGGGTGTGAGGTCAGATGGAAGG + Intergenic
1174866340 20:54139699-54139721 TAAGTTTGAGTTCAAAGGTATGG - Intergenic
1176992072 21:15508940-15508962 TCAATGTGAGTACAGATGCAAGG + Intergenic
1177158769 21:17525084-17525106 TAAGTGTGAGATCAGTGGTATGG + Intronic
1178389396 21:32185810-32185832 GAACTGTGAGTTCAGAGGGAGGG - Intergenic
1179506028 21:41841500-41841522 TAAGAGTGATTTTAGATTGAGGG + Intronic
1182024538 22:27107749-27107771 TAAGTGTGTGGACAGATGGGTGG - Intergenic
949690424 3:6630854-6630876 TCAGTATCAGTTCAGTTGGAGGG - Intergenic
950796747 3:15516433-15516455 GTAGAGTGAGATCAGATGGAAGG - Intronic
951472936 3:23075503-23075525 GGAATGTGAGTTGAGATGGAGGG - Intergenic
953296903 3:41728108-41728130 TGAGTGTGAGTTCAGAGAAAAGG + Intronic
953792577 3:45959412-45959434 TAAGCGGGAGTTCAGCTGGATGG - Exonic
955029001 3:55198498-55198520 TCAGTGTCAGCTCAGGTGGACGG + Intergenic
956216686 3:66856861-66856883 TAAGTGAGAAATGAGATGGATGG + Intergenic
957001923 3:74897119-74897141 TACATGTGAGATCAGATGGTTGG + Intergenic
957756116 3:84490552-84490574 CAAGAGGGAGTTCAGATAGAGGG - Intergenic
959231603 3:103660993-103661015 AATGTGTGAGGTCAGATGCAGGG + Intergenic
959592811 3:108098269-108098291 ATAGTGGGAGTTCAGAGGGAGGG - Intergenic
962977761 3:140460693-140460715 TATGTGTGTGTGCAGATGGGTGG - Intronic
965188734 3:165501309-165501331 TGACAGTGAGTTCAGAAGGAAGG + Intergenic
965463425 3:168997665-168997687 TAAGTGAAAGTTCAGAATGAAGG - Intergenic
969991441 4:11267882-11267904 AGAGTGTCAGATCAGATGGATGG - Intergenic
975746683 4:77481836-77481858 TAAGTGTGAGTCCACATTGTTGG - Intergenic
975944584 4:79689980-79690002 TAAGTGGGAGTTAAGCTGTAAGG - Intergenic
976081904 4:81365191-81365213 TAAATGTGAGGTCACTTGGAAGG - Intergenic
976818545 4:89178155-89178177 TAAATGTGATTTCAGGTAGATGG + Intergenic
979157637 4:117417555-117417577 TAAGTAAGAGTATAGATGGATGG - Intergenic
979719024 4:123876966-123876988 TAAGTGGGAGAGAAGATGGATGG + Intergenic
982381678 4:154755666-154755688 TCAGTGTGAGTGGAGATGGAGGG + Intergenic
982869623 4:160561523-160561545 TCAGTGTGACTTCAGATGAGAGG + Intergenic
986573765 5:9191838-9191860 CAAGTGTGAGTTTAGGTGAAGGG + Intronic
986573773 5:9191879-9191901 CAAGTGTGAGTTTAGGTGAAGGG + Intronic
987292767 5:16524037-16524059 TAAGGCTGAGCTCAGATGGAAGG - Intronic
989415057 5:41164449-41164471 TGAGTTTGAGTTGAAATGGAAGG + Intronic
991327089 5:65446031-65446053 GAAGTGTGAATTCAGATTGTGGG - Intronic
993331146 5:86601846-86601868 TAAGTGTCACATCAGATGAATGG + Intergenic
995470950 5:112501452-112501474 TAAGTGTGAGATTACCTGGATGG - Intergenic
996703798 5:126476374-126476396 TGAGTGTGAGTTCCTAGGGAAGG + Intronic
997644684 5:135473789-135473811 TAAGTGTGAGCAAAGATGAATGG + Intergenic
998603077 5:143604738-143604760 TAAGTGTGATGGAAGATGGAGGG + Intergenic
998826964 5:146112111-146112133 TAGGTGTGAGTTGAGATTCATGG - Intergenic
1001547242 5:172578213-172578235 TAAGTGTCAGTGCAAGTGGAGGG - Intergenic
1001711163 5:173779344-173779366 TTAGTGTGCGTGAAGATGGAGGG - Intergenic
1003779944 6:9413439-9413461 TAGCTGTGATTTCAGATGGTGGG + Intergenic
1004999324 6:21224923-21224945 TAAATGGCAGTTCATATGGAAGG + Intronic
1005399824 6:25420182-25420204 TGAGTGTGAGTGCAGAAGGAAGG - Intronic
1011989109 6:93490310-93490332 TAAGTGTCAGTTCATATGGAGGG + Intergenic
1012671468 6:102053534-102053556 TGATTGAGAATTCAGATGGATGG + Intronic
1012779703 6:103542153-103542175 TAAATTTGAGTGCAGCTGGAAGG - Intergenic
1014812072 6:125898211-125898233 TGAGTAAGATTTCAGATGGATGG - Intronic
1018601083 6:165541814-165541836 TAAGTGTGGATTGAGAGGGAGGG - Intronic
1019869723 7:3748990-3749012 TAAGTGTGAGTTGGGTTGGTTGG - Intronic
1023766023 7:43511506-43511528 AAAGTGTGATTCCACATGGAGGG - Intronic
1027375642 7:77546517-77546539 TTTGTGTGATTTCAGAAGGAAGG - Intronic
1027709568 7:81582619-81582641 TAAGATTGAGTTAAGATAGAAGG - Intergenic
1031112973 7:117633609-117633631 TAAGTATGATTTTAGCTGGAGGG + Intronic
1031446627 7:121862944-121862966 TAAGTATGAGTTCACATCCAAGG + Intergenic
1033918841 7:146362591-146362613 GTGGTATGAGTTCAGATGGAGGG + Intronic
1035615448 8:996786-996808 TAAGTGTGAGTTAATATGCGTGG + Intergenic
1038119182 8:24592637-24592659 TAAATGTGAGTTGATTTGGATGG - Intergenic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1041220741 8:55648672-55648694 TCTGTGTGAATTCAGCTGGAGGG - Intergenic
1044429972 8:92096650-92096672 CAAGAGTGAGTTCAGAATGAAGG + Intronic
1046205513 8:110990357-110990379 TCAGTGTGAACTCAGGTGGAGGG - Intergenic
1046557936 8:115799230-115799252 TAAGTATGATTTTAGATGCAGGG - Intronic
1046794551 8:118356842-118356864 TAAGAGTGAGTGCAGGTGGTTGG - Intronic
1047411025 8:124624715-124624737 TAAATGTCTGTTCAGATGAATGG + Intronic
1048427222 8:134333897-134333919 GAAGTGTGAGTTGAGAAGGGTGG - Intergenic
1048817747 8:138349686-138349708 TATGTGTGAGGATAGATGGATGG + Intronic
1049048893 8:140175893-140175915 TAAGTGTATGTTCAGTAGGATGG - Intronic
1052642338 9:31184965-31184987 TGAGAGTAAGTTCTGATGGAAGG + Intergenic
1053303997 9:36971039-36971061 AATGTGTGAGGTCAAATGGAGGG - Intronic
1055238063 9:74148347-74148369 TAAGAGCGTGTTCAGATGGTTGG + Intergenic
1056690102 9:88800885-88800907 AAAGTGAGAGTTCAGAAAGAGGG + Intergenic
1056958905 9:91104634-91104656 CAGGTGTGAGTACAGATGGAAGG + Intergenic
1057150511 9:92792265-92792287 TAAGTGTGAGCACACATGCATGG - Intergenic
1058445072 9:105047853-105047875 TCAGAGTGAGTTCAGATGTGTGG - Intergenic
1061546923 9:131309773-131309795 GAAGTCTGAGCCCAGATGGAGGG + Intergenic
1186856969 X:13636013-13636035 TAAGCATGAATTAAGATGGAGGG - Intergenic
1187356951 X:18584557-18584579 CCAGTTTGAGTTCAGCTGGATGG + Intronic
1187430987 X:19224876-19224898 AAGGTGTGATCTCAGATGGAAGG - Intergenic
1196607661 X:117674415-117674437 TAAGTGTATCTTCAGAAGGAAGG + Intergenic
1196905350 X:120426183-120426205 TATGTGTGATTTTAGATTGATGG - Intergenic
1196978183 X:121183034-121183056 TTAGTATGTGTTCAAATGGAGGG + Intergenic
1201280893 Y:12341025-12341047 TGGGTGTGAATGCAGATGGATGG - Intergenic