ID: 1166422969

View in Genome Browser
Species Human (GRCh38)
Location 19:42652826-42652848
Sequence CCTCCTAGGGTGCAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166422969_1166422977 17 Left 1166422969 19:42652826-42652848 CCTGCCCTCTGCACCCTAGGAGG 0: 1
1: 0
2: 4
3: 28
4: 283
Right 1166422977 19:42652866-42652888 GGTCACACACAGGCACCATCTGG 0: 8
1: 2
2: 0
3: 10
4: 126
1166422969_1166422975 -4 Left 1166422969 19:42652826-42652848 CCTGCCCTCTGCACCCTAGGAGG 0: 1
1: 0
2: 4
3: 28
4: 283
Right 1166422975 19:42652845-42652867 GAGGCTCAGAGCACATGTGACGG 0: 1
1: 0
2: 2
3: 39
4: 248
1166422969_1166422978 18 Left 1166422969 19:42652826-42652848 CCTGCCCTCTGCACCCTAGGAGG 0: 1
1: 0
2: 4
3: 28
4: 283
Right 1166422978 19:42652867-42652889 GTCACACACAGGCACCATCTGGG 0: 2
1: 6
2: 2
3: 28
4: 189
1166422969_1166422976 7 Left 1166422969 19:42652826-42652848 CCTGCCCTCTGCACCCTAGGAGG 0: 1
1: 0
2: 4
3: 28
4: 283
Right 1166422976 19:42652856-42652878 CACATGTGACGGTCACACACAGG 0: 1
1: 0
2: 2
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166422969 Original CRISPR CCTCCTAGGGTGCAGAGGGC AGG (reversed) Intronic
900292391 1:1929036-1929058 CCTCCTGGGGGACAGAGGTCAGG - Intronic
900575548 1:3380563-3380585 CCCTCTCGGGTGCAGAGGCCTGG - Intronic
900895591 1:5480842-5480864 CGTCCGGAGGTGCAGAGGGCTGG + Intergenic
900902257 1:5525094-5525116 CCTGTTGGGGTGCAGAGAGCGGG - Intergenic
901061863 1:6475342-6475364 CATCCCAGGGTGCAGAGGTCTGG - Intronic
901532689 1:9863520-9863542 CCTCCTTGGGGGCAGCCGGCTGG - Intronic
901643430 1:10704559-10704581 CCTCCTGGGGGGAAGGGGGCCGG + Intronic
901754831 1:11435147-11435169 CCTGCCAGGCTGCAGCGGGCAGG - Intergenic
902378655 1:16042294-16042316 CCTCCTGGGGCACACAGGGCTGG + Intergenic
902458731 1:16554920-16554942 ACTTCCAGGGTGCACAGGGCAGG + Intergenic
902493426 1:16852996-16853018 ACTTCCAGGGTGCACAGGGCAGG - Intronic
902721927 1:18309630-18309652 TCACCCAGGGTGCAGAGGACTGG - Intronic
903151920 1:21415679-21415701 ACTTCCAGGGTGCACAGGGCAGG + Intergenic
903224596 1:21887510-21887532 CCTCCTGGGGCCCACAGGGCAGG + Exonic
903884259 1:26531794-26531816 CCTGAGAGGGTGCAGAGCGCTGG + Intronic
903957579 1:27035827-27035849 CCTCCTGGGGTTGAGAGGTCCGG + Intergenic
904489087 1:30847253-30847275 CCTCATAGGGTTCTGAGGACTGG + Intergenic
905453686 1:38073326-38073348 CACCCAAGGGTGCTGAGGGCTGG - Intergenic
905646129 1:39626193-39626215 GCTGCTGGTGTGCAGAGGGCAGG + Exonic
906648491 1:47493178-47493200 CCTGTTAGTGTGCAGAGGGAAGG - Intergenic
907145823 1:52230335-52230357 CCTCCCAGTGTGCAGTGCGCAGG + Intronic
908621261 1:65982949-65982971 CCTCCTTGGTTTCAGAGGGCAGG + Intronic
909074983 1:71041918-71041940 CATCTGAGGGTGCAGAGGGGTGG - Intronic
912949647 1:114111868-114111890 CTTCCTAGGGTGCCGAGAGGGGG + Intronic
915313864 1:155017458-155017480 CCTCCCCGGGGCCAGAGGGCAGG + Exonic
915333280 1:155126636-155126658 GCTCCTGGGGTGGAGAGGGCGGG - Intergenic
915737403 1:158093789-158093811 CCTCAGAGGGTGGAGAAGGCAGG - Intronic
917565127 1:176206123-176206145 CTTCCTCGGATGCAGAGGGGTGG - Intronic
918062833 1:181076997-181077019 CTTCCCTGGGGGCAGAGGGCAGG - Intergenic
918344644 1:183595994-183596016 CCTCCTTGAGTGCACATGGCAGG - Intronic
920013686 1:202888699-202888721 CCCCCCCGGGGGCAGAGGGCCGG + Intronic
920331094 1:205208981-205209003 CCTGGGAGGGTGCAGATGGCAGG - Intronic
920586638 1:207170222-207170244 CCACCTGGGTTGCAGATGGCTGG + Intergenic
922096219 1:222445157-222445179 ACTTCTGTGGTGCAGAGGGCTGG - Intergenic
922575426 1:226658235-226658257 TCTCCTAGGCTGCAGAGTGGAGG + Intronic
922696385 1:227733119-227733141 CCCTCTTGGCTGCAGAGGGCTGG - Intronic
922802912 1:228372209-228372231 CCTCCCTGGATGCGGAGGGCTGG + Exonic
922866983 1:228868683-228868705 CTCCCTAGGGTGCAGTGGGCCGG + Intergenic
923154825 1:231269085-231269107 TCCCCTGGGTTGCAGAGGGCAGG + Intronic
1062877634 10:955187-955209 CCCCCTGGGGTGAAGAGGGAGGG - Intergenic
1065837864 10:29675517-29675539 CATCCTAGCCTGGAGAGGGCTGG - Intronic
1067684755 10:48459543-48459565 CCTCCTAGTGGGCAGAGTGTAGG - Intronic
1068128066 10:52865767-52865789 CCTTTTACGGTGCAGAGGGGTGG - Intergenic
1069953630 10:72036258-72036280 CCTCCCTGGATGCACAGGGCAGG - Intergenic
1070809379 10:79289960-79289982 CCTGTGAGGGTGAAGAGGGCTGG - Intronic
1072573779 10:96681121-96681143 CCTGCTTGGTTGCAGATGGCTGG + Intronic
1072611554 10:97020607-97020629 CCTCTGAGCTTGCAGAGGGCAGG + Intronic
1072764110 10:98082159-98082181 CCTGCTAGAGAGGAGAGGGCAGG - Intergenic
1073121219 10:101123498-101123520 GCTCCTTGGGTGCCGAGGGACGG - Intronic
1073447892 10:103592016-103592038 CATCTGAGGGGGCAGAGGGCTGG - Exonic
1074818749 10:117163765-117163787 GCTCCTCGGGCGCAGCGGGCGGG - Intergenic
1075566021 10:123504947-123504969 CCTTCTAGGGGTCAGAGTGCAGG - Intergenic
1075673665 10:124281411-124281433 CCTCCCAGTATGCAGTGGGCTGG + Intergenic
1075715120 10:124551332-124551354 CCACCAAGGATGCAGAGGGAGGG - Intronic
1076199045 10:128543519-128543541 GCTCCTAGCGTGCAGACGGACGG - Intergenic
1076622667 10:131802436-131802458 CCTCCTAAGGTGAAGAGGTTGGG + Intergenic
1076894322 10:133302453-133302475 CCACCTCTGGTGCAGGGGGCAGG - Intronic
1076919667 10:133445086-133445108 CCTCCAAGGCTGCCGGGGGCAGG + Intergenic
1077027636 11:448313-448335 CCCTCCAGGGTGCAGAGGCCGGG - Intronic
1077420450 11:2447526-2447548 CCTCCTAGGGCACTGAGGGTGGG - Intronic
1077470742 11:2759405-2759427 CCTGCATGTGTGCAGAGGGCAGG + Intronic
1077546224 11:3171219-3171241 GCACCCAGGATGCAGAGGGCAGG - Intergenic
1077556761 11:3229778-3229800 CCCCCTACCCTGCAGAGGGCTGG - Intronic
1078586776 11:12598676-12598698 ACTGTTAGGGTTCAGAGGGCTGG - Intergenic
1079427355 11:20356334-20356356 GCTCATAGGGTGCAGAGGTTAGG - Intergenic
1081663437 11:44902636-44902658 CCTCCCAGAGGGCAGTGGGCAGG - Intronic
1081809521 11:45907119-45907141 ACTCCTGGGGCACAGAGGGCAGG - Intronic
1081988753 11:47326338-47326360 CCTCCTCCGGCGCAGAGGGCTGG - Intronic
1082840882 11:57688983-57689005 CCTCCCAGAGTGCTGAGTGCTGG + Intronic
1083148223 11:60774043-60774065 CTTCCCAGAGTGCAGAGGGAGGG - Intronic
1083158838 11:60842266-60842288 CCTCCGAGTGTGCAGCGGGCTGG + Exonic
1083267611 11:61554043-61554065 CCTCCCAGGGTCCAGACCGCAGG - Intronic
1083271523 11:61575246-61575268 CTTCCTGGAGTGCAGAAGGCTGG - Intronic
1083894231 11:65612128-65612150 CCTCCTAGAGCCCAGAGTGCAGG - Intronic
1084603526 11:70160154-70160176 CATGCAAGGGTGCAGAGGGCAGG - Intronic
1085287087 11:75370100-75370122 CCTCCTAGGAAGCAGAGGCTGGG - Intergenic
1085301802 11:75463008-75463030 TCTCCCAGGGTAAAGAGGGCAGG - Intronic
1089213568 11:116822146-116822168 CCTCCTTGTCTGCAGAGGGTGGG + Intronic
1089457370 11:118633508-118633530 ACTCCTTGGCTCCAGAGGGCAGG - Intronic
1089681869 11:120123052-120123074 CCACCTAGGAAGCAGAGGGTCGG + Exonic
1089908411 11:122070103-122070125 CCTCCTATGCTGCAGACTGCAGG + Intergenic
1091313993 11:134597819-134597841 CCTCCTGGAGTGCTGTGGGCTGG + Intergenic
1092192496 12:6531114-6531136 ACAGCTAGGGTGCAGAGGGCTGG + Intronic
1093044059 12:14421429-14421451 CCTCTGAGGGTGCTGAGGGAAGG + Intronic
1093711394 12:22333934-22333956 CCTCCCCGAGTGCAGAGGACAGG - Intronic
1096466467 12:51849451-51849473 CCTCCCGGGCTGCAGAGGGCAGG + Intergenic
1097990003 12:65824572-65824594 CCTCCTAGGGTGGCGGGAGCAGG - Exonic
1100839170 12:98594234-98594256 CGTCCTACGGTGCAGCGGGCTGG - Intronic
1101579779 12:106032307-106032329 CCCTCTAGAGTGCAGAGTGCAGG - Intergenic
1101892556 12:108730713-108730735 CGGCCAAGGGAGCAGAGGGCTGG - Intronic
1102155630 12:110725412-110725434 CCTGCTAGAGTACTGAGGGCTGG - Intronic
1102602146 12:114039455-114039477 CCTCCTGGGGGACAGAGGGAGGG + Intergenic
1102612502 12:114124788-114124810 ACTCCTATGGTACAGAGGGAAGG - Intergenic
1102670540 12:114615157-114615179 CATCACAGGGTGGAGAGGGCAGG + Intergenic
1103761095 12:123250924-123250946 CCTGCCAGGGTGCATAGGGAAGG + Intronic
1104424046 12:128660056-128660078 CCTCCAAGGGTTCAGGGAGCTGG + Intronic
1107146125 13:37062117-37062139 CCACCTAGGGTCCAGAAGGCAGG - Intergenic
1108578269 13:51807569-51807591 CCTTGGAGGGTGCACAGGGCTGG - Intergenic
1113582686 13:111440116-111440138 GCCTCTTGGGTGCAGAGGGCAGG + Intergenic
1113769472 13:112898952-112898974 CCTCCCAGGGAGCACCGGGCAGG + Intronic
1113924123 13:113930827-113930849 CCTCCCAGGGAGCTGAGGCCCGG + Intergenic
1113932956 13:113978084-113978106 CCTCCCGGGATGCAGACGGCAGG - Exonic
1114501197 14:23170105-23170127 CTTTCTTAGGTGCAGAGGGCAGG + Intronic
1118319967 14:64747298-64747320 CCTCCTCTGGGGCAGAGAGCAGG - Exonic
1119478123 14:74942792-74942814 CCTCCTATGGAGGAGGGGGCAGG + Intronic
1122651699 14:103230096-103230118 CCTTCTAGAGGGCACAGGGCGGG + Intergenic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1122988957 14:105227561-105227583 TCTCCTAGTGAGCAGAGGTCCGG - Intronic
1123132014 14:105994934-105994956 CCTGCTAGTGTACATAGGGCAGG + Intergenic
1123582248 15:21726064-21726086 CCTGCTAGTGTACATAGGGCAGG + Intergenic
1123618898 15:22168660-22168682 CCTGCTAGTGTACATAGGGCAGG + Intergenic
1125604335 15:40931483-40931505 CCTCTGAGGGGGCAGAGGGTCGG - Exonic
1126661618 15:51038700-51038722 CCTCCTAGGGTCCTGAGGTCAGG - Intergenic
1127047493 15:55042909-55042931 CCTCCCAGGGGCCAGAGGACAGG - Intergenic
1127706101 15:61548602-61548624 CCTCCAAGTGTGCAGAGCACAGG + Intergenic
1129093248 15:73174363-73174385 CCTGCTGGGGTGCTGTGGGCTGG + Intronic
1129222619 15:74140485-74140507 CCTCCTGTTGTGCAGAGAGCAGG - Intergenic
1129313257 15:74726439-74726461 CCCTCTAGGGGGCAGAGGTCAGG + Intergenic
1131098621 15:89671411-89671433 CCTCTCAGGGAGGAGAGGGCAGG - Intronic
1131438493 15:92441260-92441282 CCTCCTAGGGAGTCCAGGGCAGG + Intronic
1132591280 16:727414-727436 CTTCCTAGGGTGTGGAGAGCGGG + Exonic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132765887 16:1534016-1534038 CATCCCAGGGAGCAGAGGGTGGG - Exonic
1133206705 16:4238389-4238411 CCTGCTTGGGTGTAGTGGGCTGG - Intronic
1133239786 16:4407627-4407649 CCACCCCGGGTGCTGAGGGCAGG + Exonic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1135969774 16:27063758-27063780 CCTCATGGGGAGCATAGGGCTGG + Intergenic
1136369464 16:29826962-29826984 CTTCCTAGAGTCCAGAGGGCTGG - Intronic
1136403616 16:30031129-30031151 CCACCGAGGGGGCAGGGGGCTGG - Exonic
1140572787 16:76128302-76128324 CCTACTTGAGAGCAGAGGGCGGG - Intergenic
1141622078 16:85241710-85241732 CCTCCTAGGGTGGTGTGGGAGGG + Intergenic
1141675213 16:85514075-85514097 CTCCCTTGGGTGCAGAGGTCAGG + Intergenic
1141810127 16:86370582-86370604 CCTCCAAGGGTGAAGAGGATGGG - Intergenic
1142273927 16:89105792-89105814 TCTCCCAGGGAGCTGAGGGCAGG + Intronic
1143115801 17:4581395-4581417 GGACCTGGGGTGCAGAGGGCTGG + Intergenic
1143365442 17:6405491-6405513 CCTCATAGGGTAGGGAGGGCAGG + Intronic
1143377014 17:6472869-6472891 CCTCCTAGGGCCCAGGGAGCAGG - Intronic
1143389580 17:6552353-6552375 CCTGTTGGGGTGCAGAGGGAGGG + Intronic
1144440995 17:15281512-15281534 CCTGCTTTGGTGCAGAGGGTGGG - Intergenic
1144759258 17:17698196-17698218 CCTCTTCTGCTGCAGAGGGCAGG + Intronic
1144789416 17:17849153-17849175 CAGCCTGGGCTGCAGAGGGCGGG + Intronic
1145036039 17:19541300-19541322 TCTCCTAGGGAGCAGGGGTCAGG + Intronic
1147057646 17:37846558-37846580 CCTCCTAAAGTGCTGAGTGCTGG + Intergenic
1147310204 17:39591555-39591577 CTTCCTTGGGTGCAGAGGGCAGG + Intergenic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1149656373 17:58311541-58311563 ACTCCCAGGGTACAGTGGGCAGG + Intronic
1153796970 18:8632568-8632590 CCACCTAGAGTGCTGGGGGCAGG - Intronic
1156123269 18:33871459-33871481 CTTCCTAAGTGGCAGAGGGCTGG + Intronic
1156275929 18:35582273-35582295 CCTCCTCGGGGGCAGCGGGCCGG - Intronic
1157812258 18:50705657-50705679 CCTCCTCGGGGGAAGAGGTCGGG + Intronic
1157942267 18:51942300-51942322 CCTCCTTGGCTGCAGACGGAGGG + Intergenic
1160190584 18:76711326-76711348 TCTCCTGGGCTGCGGAGGGCTGG - Intergenic
1160710731 19:549840-549862 CCTCCAGGGGTGCAGTGGGGTGG + Exonic
1160879766 19:1314089-1314111 CCTCCTTGGGGGCCGACGGCGGG + Intergenic
1161474119 19:4474867-4474889 GCTCCAAGGATGCAGAGGGTGGG - Intronic
1162020559 19:7866554-7866576 CCACACTGGGTGCAGAGGGCAGG - Intergenic
1162517166 19:11155487-11155509 CGTCCCAGGGGGCATAGGGCAGG + Intronic
1162850217 19:13425363-13425385 CCTCCTAGGGAGCAGGGGTGGGG + Intronic
1165396924 19:35569555-35569577 CCTCCCAGGGTCGAGGGGGCGGG - Intergenic
1166416182 19:42596173-42596195 CCTCCTGGGGTGCAGAGGGAAGG + Intronic
1166422969 19:42652826-42652848 CCTCCTAGGGTGCAGAGGGCAGG - Intronic
1166448870 19:42880933-42880955 GCCCCCAGGGTGCAGCGGGCAGG + Intronic
1166485312 19:43206862-43206884 CCCCCTGGGCTGCAGTGGGCAGG + Intronic
1166492460 19:43270780-43270802 CCCCCTGGGGTGCAGGGGGCAGG + Intergenic
1166496384 19:43305902-43305924 CCTCCTAGCGTGCAATGGGCAGG + Intergenic
1166792995 19:45408930-45408952 CTTCGTAGGGGGCAGAGGGATGG - Exonic
1167015454 19:46838338-46838360 CCTCCTAGGCAGCTGAGGGAAGG + Exonic
1167101052 19:47404509-47404531 CCTCCTTGTGTGTAGGGGGCTGG + Intronic
1167145022 19:47676255-47676277 ACTCCTGGAGAGCAGAGGGCTGG + Intronic
1167661219 19:50797042-50797064 CCTGCTAGTGGGCAGAGGCCTGG + Intergenic
1168579547 19:57543338-57543360 GCTCCTTGGGTGTAGAGGGAGGG - Intronic
925068602 2:950071-950093 CCTCCTGGGGCGCACGGGGCTGG - Intergenic
925201032 2:1967968-1967990 CCTCCTGGGGTGCAGTGAGCAGG - Intronic
926229368 2:10990990-10991012 CCTCCCTGGGGGCAGAAGGCTGG + Intergenic
929760393 2:44801868-44801890 CCTCCAGGGGCGCAGAGGGAAGG + Intergenic
931837155 2:66111149-66111171 CTAATTAGGGTGCAGAGGGCTGG - Intergenic
932196650 2:69789698-69789720 CCTCCTAGGGTCCAGTGGTTTGG + Intronic
933767404 2:85719520-85719542 ACTTCTGGGGTGCAGAGGACGGG - Intergenic
936115884 2:109702675-109702697 CCTCCGATGTTGCAGAGGACAGG - Intergenic
937061589 2:118983948-118983970 CCTCCCAGGATGCAAAGGGCAGG - Intronic
937252442 2:120533451-120533473 CCTCTCGGGGTGCAGAGGGGAGG - Intergenic
937342706 2:121101410-121101432 CCAGCTACGGTGCAGAGGGCTGG + Intergenic
943948907 2:194103918-194103940 TCTCTGAGGGTGCAGATGGCTGG + Intergenic
945307615 2:208273635-208273657 CCTCGAAGGGAGCTGAGGGCTGG - Exonic
946242767 2:218367161-218367183 CCTTCCAGGATGCAGGGGGCTGG + Intronic
947466110 2:230347881-230347903 TCTGCTAGGGTGCTGATGGCAGG + Intronic
1171215128 20:23346818-23346840 CCTCCTGGGCAGCAGAGGGGTGG + Intergenic
1172658358 20:36550135-36550157 CCTCTTGGGGGGCAGAGGTCAGG + Exonic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174046716 20:47739044-47739066 ACTCCTAGGGTCCCCAGGGCTGG + Intronic
1174137365 20:48389473-48389495 CATCCAAGGGTGAAGAAGGCAGG + Intergenic
1174317365 20:49713392-49713414 CCTGTTGGGGTGCGGAGGGCAGG + Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174481071 20:50831833-50831855 CCTCCCAAGCTGCAGAGGGAGGG + Intronic
1175644012 20:60656159-60656181 CCTTCTAGGGTGCACTGGGAAGG - Intergenic
1175737620 20:61398348-61398370 CCTCTAAGGGTGGAGAGAGCAGG + Intronic
1176423404 21:6533401-6533423 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1177780029 21:25612282-25612304 CCTGTTAGGGTGTAGGGGGCTGG - Intergenic
1178275803 21:31235964-31235986 CCTCCTGAGGTGCAGAGCCCTGG - Intronic
1179698898 21:43141717-43141739 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1179716020 21:43288965-43288987 CCACATGGGGTGGAGAGGGCAGG + Intergenic
1180127696 21:45803476-45803498 CATCCTTGGGTGGAGAGGCCTGG - Intronic
1181809177 22:25393031-25393053 TCTCCTGAGGTGCAGGGGGCAGG + Intronic
1181880286 22:25973788-25973810 CTCCCTAGGGTGGAGGGGGCTGG + Intronic
1183118018 22:35706706-35706728 CTCCCTGGTGTGCAGAGGGCAGG + Intergenic
1183187601 22:36300825-36300847 CCTCCCCGGGTGCAGCGGGCAGG + Intronic
1183231419 22:36584458-36584480 TATCTCAGGGTGCAGAGGGCAGG + Intronic
1183384777 22:37508679-37508701 CCTCCTGGGGATCACAGGGCAGG + Exonic
1183715774 22:39532673-39532695 CGTCCGAGGGTGAGGAGGGCTGG - Exonic
1183849915 22:40576964-40576986 CCTCCCAAAGTGCAAAGGGCTGG - Intronic
1183890555 22:40924441-40924463 CATCCCAGGCTGCAGAGGGAGGG - Exonic
1184247394 22:43242546-43242568 CCTGGTAGGGGGCAGAGGCCGGG - Intronic
1185006276 22:48278695-48278717 CCTCCTGGGGTGCACAGATCAGG + Intergenic
950095918 3:10330367-10330389 CCTCACAGGGTGCAGAGGGACGG + Intronic
950436733 3:12984664-12984686 TCTCCTAGGGGGCTGAGGGGTGG - Intronic
953018776 3:39100746-39100768 CAGCCTGGGGTGGAGAGGGCAGG - Exonic
953046604 3:39298494-39298516 CCTCCTGGGAGGCAGAAGGCAGG + Intergenic
953439473 3:42905920-42905942 CCACCTAGGGTGCAGCGAGCTGG + Intronic
954144703 3:48628817-48628839 CAGCCTGGGGAGCAGAGGGCTGG - Intronic
954713592 3:52516548-52516570 CTTCCTAGGGCACTGAGGGCTGG - Exonic
955404814 3:58619432-58619454 CCTACGAGGCTGAAGAGGGCTGG + Intronic
956619398 3:71205723-71205745 CCTCCTGCGTTCCAGAGGGCAGG - Intronic
960673978 3:120177227-120177249 TCTCTGAGGGAGCAGAGGGCTGG + Intronic
961646373 3:128394887-128394909 CAACCAAGGGTGCAGAGGCCGGG - Intronic
961674759 3:128557949-128557971 GCACCAAGGGAGCAGAGGGCTGG + Intergenic
962256215 3:133871915-133871937 CCTCCTGGGGTCCACAGAGCTGG + Intronic
962432470 3:135332549-135332571 CCTACTATGGTGCAGAGAGGTGG - Intergenic
965806599 3:172548522-172548544 CTTCCTAGCTTGCAGACGGCCGG - Intergenic
965993232 3:174845800-174845822 CTTCCTAGGTTGCAGAAGGTAGG + Intronic
966875852 3:184321267-184321289 CTTCCTATGGTGCAGATGACCGG + Exonic
967234940 3:187374884-187374906 CCTCCCAGAGGGCAGAGGGTGGG - Intergenic
969480775 4:7445762-7445784 CCTCCTGGGTTGCTGGGGGCTGG + Intronic
969593399 4:8134357-8134379 CCTCCTTGGGGACAGAAGGCAGG - Intronic
969673371 4:8601796-8601818 CCGCCCAGGGTGCAGTGAGCAGG + Intronic
969843603 4:9901813-9901835 CCGCCTAGAGGTCAGAGGGCAGG - Intronic
969863391 4:10055380-10055402 CATCCTAGAGTGCATAGGACAGG - Intergenic
969882661 4:10188021-10188043 CATCCTACGGTGCACAGGACAGG - Intergenic
971974602 4:33667423-33667445 CCTCCCAGAGTGTAGGGGGCTGG + Intergenic
976889712 4:90031881-90031903 CCTCATAGGGTGGAGAGGTAAGG - Intergenic
981051808 4:140316673-140316695 CCTTCTGGGGTGCAGTGGGGTGG - Intronic
981837830 4:149076222-149076244 CCTGCTAGGTTGCTGAGGGTTGG - Intergenic
983029551 4:162782786-162782808 CCTCCTTGGGTGAGGGGGGCGGG + Intergenic
984811572 4:183799944-183799966 CCTCTGAGGGTGCAGAGGTAAGG - Intergenic
985649923 5:1102693-1102715 CCTCCTCGAGTGCAGGGAGCCGG - Intronic
993356778 5:86922782-86922804 CCTGCGGGGGTGCAGAGGGAGGG - Intergenic
998145413 5:139725029-139725051 CCCCTAAGGGTGCAGAGGGAGGG + Intergenic
998228514 5:140344884-140344906 CCTCCTAGGCTGGGCAGGGCTGG - Intronic
999238785 5:150115542-150115564 CCTCCCTGGAGGCAGAGGGCTGG + Exonic
1000126934 5:158254588-158254610 CCACCTAGGCTCCAGAGGCCTGG + Intergenic
1002313374 5:178328110-178328132 CCTGCCTGGGTGCGGAGGGCAGG + Intronic
1002566405 5:180114649-180114671 GACCCCAGGGTGCAGAGGGCAGG + Intronic
1003504171 6:6725968-6725990 GCACGTAGTGTGCAGAGGGCAGG - Intergenic
1004488147 6:16087429-16087451 CATGGTAGAGTGCAGAGGGCTGG - Intergenic
1006133618 6:31883006-31883028 CATCCTAGGGTGCGGAGGGGAGG + Exonic
1006358747 6:33575792-33575814 CCTGCTAGGTTGCAGAGGTAAGG + Exonic
1006793837 6:36720141-36720163 AATCCTAGGGTGGGGAGGGCAGG - Intronic
1009935997 6:70235035-70235057 CCTGTTAGGATGCAGAGTGCAGG - Intronic
1010005253 6:70988720-70988742 CTTCCTAGGTTTCAGAAGGCAGG + Intergenic
1012349584 6:98233885-98233907 CCTGTTGGGGTGTAGAGGGCTGG - Intergenic
1013976697 6:116087406-116087428 TACTCTAGGGTGCAGAGGGCAGG - Intergenic
1014308742 6:119772204-119772226 CTTCCTAGGGAGCAGAGGACAGG + Intergenic
1014591450 6:123276887-123276909 CCTCCTGTGGTGGAGAAGGCAGG + Intronic
1014918240 6:127180426-127180448 CTTCTTATAGTGCAGAGGGCTGG - Intronic
1015074814 6:129143096-129143118 CCTCCAAAGGTGTAGAAGGCTGG - Intronic
1017543733 6:155428900-155428922 CCTCCTGGGGGGCAGAGGTAAGG + Exonic
1017900426 6:158714650-158714672 CCTCCTAAGATGCCCAGGGCTGG + Intronic
1018520054 6:164639124-164639146 CCTCCTTGAGGGCAGAGGGTAGG - Intergenic
1018987429 6:168648492-168648514 CCTCCCAGGGAGCCGAGGCCGGG + Intronic
1019854680 7:3592926-3592948 CCTGCAAGCCTGCAGAGGGCAGG - Intronic
1023299467 7:38753912-38753934 CCTCCTAGGGTGCAATGAGATGG + Intronic
1024565956 7:50681227-50681249 CCTGGCAGGGTGCAGAAGGCTGG + Intronic
1027754136 7:82189010-82189032 CCTACTTGAGTGTAGAGGGCGGG + Intronic
1028696901 7:93724127-93724149 CCTTCAAGGGTACAGAGGGAAGG + Intronic
1029174662 7:98656075-98656097 TCACCCAGGGAGCAGAGGGCAGG + Intergenic
1029438414 7:100574829-100574851 CCTCACGGGGTACAGAGGGCAGG + Exonic
1031645555 7:124221434-124221456 CTTCCTAGGCTGCACAGAGCAGG - Intergenic
1031839152 7:126716494-126716516 TCTCCTTGGGTGCTGAGGGTGGG + Intronic
1036585858 8:10122684-10122706 CCTCCTTGAGTGTAGAGGGCAGG - Intronic
1037393228 8:18416392-18416414 CCTCCTTGGTTCCATAGGGCAGG - Intergenic
1038004242 8:23416517-23416539 CCTCCTGGAGTGCAGGGGGCTGG - Intronic
1038566309 8:28622636-28622658 CCTCCCAGGGGGCAGTGGGTGGG + Intronic
1039992036 8:42496765-42496787 GCTCCTAGGGTGTAGTGGGTAGG + Intronic
1041242436 8:55859467-55859489 CCTCCTTGTGAGCAGAGGGAGGG + Intergenic
1042421598 8:68596769-68596791 CTTGCTAAGGTGCAGAAGGCAGG - Intronic
1044727965 8:95208339-95208361 CCACCAAGGGTGGAGAGGCCTGG - Intergenic
1045154535 8:99452404-99452426 CCTACTAGGGTGAAAAGAGCAGG + Intronic
1048469604 8:134695409-134695431 CCTCCTTGGTTGGAGATGGCCGG - Intronic
1048716101 8:137272027-137272049 CCTGCTTGGGGGCAGAGGGTGGG + Intergenic
1049218884 8:141419966-141419988 CCACCCAGGGTGTGGAGGGCAGG + Intronic
1049519360 8:143080338-143080360 CCTCAAAGGGCGCGGAGGGCGGG - Intergenic
1051691065 9:19712816-19712838 CACCCTATGCTGCAGAGGGCAGG - Intronic
1052788758 9:32854494-32854516 CCTCAGAGTATGCAGAGGGCAGG - Intergenic
1052864040 9:33454193-33454215 CCTCAAAGGCTGCTGAGGGCAGG - Intergenic
1055127821 9:72739167-72739189 TCTCCCAGGTTGCAGATGGCTGG + Intronic
1056456779 9:86767995-86768017 CCTCGTAGGGTGCAGAGGCCAGG + Intergenic
1057939124 9:99265415-99265437 CCTCCTACCTTGCATAGGGCAGG - Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1060172036 9:121469799-121469821 CCTCCTGGGGTGTGCAGGGCAGG - Intergenic
1060912847 9:127364346-127364368 CATCAGAGGCTGCAGAGGGCAGG + Intronic
1062000076 9:134211475-134211497 CCTCCAAGGCTGCAGGGGGTGGG + Intergenic
1062049442 9:134439473-134439495 GCTTCCAGGGTGCGGAGGGCCGG - Intronic
1062174040 9:135151112-135151134 CCTCCTGGAGCTCAGAGGGCCGG + Intergenic
1062174575 9:135153821-135153843 CCTGCTGGGGTGCAGAGGGGTGG - Intergenic
1062378259 9:136274692-136274714 CCTCCCAGGGTCCCGAGGACAGG - Intergenic
1062574262 9:137199254-137199276 CCTGGCAGGGTGCAGAGGCCTGG + Exonic
1185493494 X:537100-537122 CGTCCCAGGGTGCAGAGGGCTGG + Intergenic
1185628062 X:1496446-1496468 CCTCTGAGAGGGCAGAGGGCAGG - Intronic
1186973278 X:14873053-14873075 CCTCCCAGGATGCAGCGCGCTGG - Exonic
1191901590 X:66046307-66046329 CCTCATAGGGTGAAGAAGGTAGG + Intergenic
1195351053 X:103997317-103997339 CCTCCTCGGTTTCAGAGGGATGG + Intergenic
1195352645 X:104009467-104009489 CCTCCTCGGTTTCAGAGGGATGG + Intergenic
1195356449 X:104044095-104044117 CCTCCTCGGTTTCAGAGGGATGG - Intergenic
1197680848 X:129382837-129382859 CCTCCCAGAGAGCAGAGGGTGGG + Intergenic
1197684722 X:129427335-129427357 CCTCCTAGGGGCCTGAGGACAGG - Intergenic
1197872589 X:131073504-131073526 CCTCCAAGGGGCCAGAGTGCAGG - Intronic
1198520932 X:137451585-137451607 CCTCCTCGGTTTCAGAGGGTGGG - Intergenic