ID: 1166423074

View in Genome Browser
Species Human (GRCh38)
Location 19:42653336-42653358
Sequence GAGGACACCCAAGATGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166423066_1166423074 26 Left 1166423066 19:42653287-42653309 CCATGGGGAAGGTGGGGTGACCA 0: 2
1: 4
2: 10
3: 31
4: 260
Right 1166423074 19:42653336-42653358 GAGGACACCCAAGATGGTCAGGG 0: 1
1: 1
2: 3
3: 17
4: 147
1166423068_1166423074 6 Left 1166423068 19:42653307-42653329 CCACAGGACAATCAGCCATGCAG 0: 1
1: 0
2: 1
3: 31
4: 185
Right 1166423074 19:42653336-42653358 GAGGACACCCAAGATGGTCAGGG 0: 1
1: 1
2: 3
3: 17
4: 147
1166423065_1166423074 30 Left 1166423065 19:42653283-42653305 CCAGCCATGGGGAAGGTGGGGTG 0: 1
1: 2
2: 4
3: 42
4: 388
Right 1166423074 19:42653336-42653358 GAGGACACCCAAGATGGTCAGGG 0: 1
1: 1
2: 3
3: 17
4: 147
1166423071_1166423074 -9 Left 1166423071 19:42653322-42653344 CCATGCAGAGGACAGAGGACACC 0: 1
1: 0
2: 3
3: 32
4: 300
Right 1166423074 19:42653336-42653358 GAGGACACCCAAGATGGTCAGGG 0: 1
1: 1
2: 3
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166423074 Original CRISPR GAGGACACCCAAGATGGTCA GGG Intronic
901005171 1:6168185-6168207 GAAGAAACCCAAGAAGCTCAAGG - Exonic
901215619 1:7553547-7553569 GGGGACACCAAAGAGGGTCAGGG - Intronic
902339212 1:15771824-15771846 GAGGTCACACGAGATGGCCAAGG + Intronic
902787942 1:18745240-18745262 CTGGACACCCAAGGTGTTCAAGG - Intronic
904592661 1:31623666-31623688 GAAGACAGCCAAGATGCTGATGG + Exonic
905001044 1:34669940-34669962 GAGAACACCCAACATTGGCAAGG - Intergenic
910668098 1:89745761-89745783 GAAGATACCCAAGATGCTGATGG + Intronic
910719771 1:90273283-90273305 GAGAACAGCCAAGCTGGTGAGGG - Intergenic
912827935 1:112923542-112923564 CAGGCCACCCAGGATGGTCTTGG - Intronic
913038412 1:114998296-114998318 GAAGACACCCAGAATGTTCAAGG - Intergenic
919097826 1:193059123-193059145 GAGGAGGCCCAAGCTGGGCATGG - Intronic
1067896262 10:50183149-50183171 GAGGGCACCTAATATGGTCTTGG - Exonic
1067952717 10:50758878-50758900 GAGGGCACCTAATATGGTCTTGG + Intronic
1069681669 10:70290061-70290083 CAGGCCACCCAAGATGCCCACGG + Intergenic
1072787622 10:98294913-98294935 GGTGACACCCAAGCTTGTCATGG - Intergenic
1073580535 10:104661453-104661475 TAGGATGCCCATGATGGTCAAGG - Intronic
1074700523 10:116088143-116088165 GAGGACACCCAAGATGAAGAGGG + Intronic
1075240542 10:120774552-120774574 GTGGAGACCCAGGATGGACAAGG + Intergenic
1077100594 11:820635-820657 GAGGACACCCAAGATGACAGGGG + Intronic
1077944064 11:6876019-6876041 GAAGACACACAACATAGTCAGGG - Intergenic
1079239978 11:18715302-18715324 GGGGAGACACAAGTTGGTCATGG + Intronic
1081589497 11:44411333-44411355 GGGGAGCCCCAAGATGGCCATGG + Intergenic
1081622295 11:44625756-44625778 GAGGACAGCAAAGGTGATCAAGG + Intergenic
1081636269 11:44724383-44724405 GAGGACATTCGAGATGTTCAAGG + Intergenic
1081739601 11:45429224-45429246 GATGACACCTAAGTTGCTCAAGG - Intergenic
1090455127 11:126842487-126842509 GATGAACCCCAATATGGTCATGG - Intronic
1091754193 12:3041081-3041103 GTGGTCACGGAAGATGGTCATGG - Intergenic
1094487043 12:30933584-30933606 GAGGACACCCATGAGCTTCAGGG - Intronic
1096594305 12:52684822-52684844 GAGGAAACCAAAGATGAACATGG + Intergenic
1097583846 12:61491608-61491630 AATGACATCCCAGATGGTCAAGG - Intergenic
1098161369 12:67649757-67649779 GAGGAGACAAAAGAGGGTCAGGG - Intronic
1100041268 12:90321019-90321041 GAGGACACTCAAGAAGCCCAAGG - Intergenic
1101833935 12:108281870-108281892 GTGGGCAACGAAGATGGTCAGGG + Intergenic
1101904475 12:108814623-108814645 GAGGCCACCCAAGATGAGCAGGG - Intronic
1103941324 12:124502869-124502891 GATGACAGCCACGATTGTCAGGG + Intronic
1104430935 12:128715424-128715446 GAGGGCACCTGAGGTGGTCAGGG + Intergenic
1104452082 12:128877965-128877987 GAGGACACTCAAGAGGGCCATGG - Intronic
1104787280 12:131457777-131457799 GCTGACAGCCAAGATGGTGAGGG + Intergenic
1106865367 13:33958778-33958800 GAGGGCAGCCAGGATGCTCATGG - Intronic
1107691362 13:42956786-42956808 AAGGAAACCCAAGAAGCTCATGG + Intronic
1110963105 13:81656338-81656360 GAGGTCACTCAACATGATCAAGG - Intergenic
1112276878 13:98029321-98029343 GAGAACACTCAAGATAGTGATGG - Intergenic
1114631225 14:24160795-24160817 GTTGACACCCTGGATGGTCAAGG + Exonic
1117661016 14:58005108-58005130 GAGGGCTCCCAAGATGAACAAGG + Exonic
1119915283 14:78394414-78394436 GAGTATACCCCAGTTGGTCATGG + Intronic
1123060813 14:105593485-105593507 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123060820 14:105593518-105593540 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123060841 14:105593617-105593639 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123060974 14:105594277-105594299 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123060987 14:105594343-105594365 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123061013 14:105594475-105594497 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123061026 14:105594541-105594563 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123061060 14:105594706-105594728 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123061067 14:105594739-105594761 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085274 14:105714396-105714418 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085288 14:105714462-105714484 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085295 14:105714495-105714517 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085316 14:105714594-105714616 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085323 14:105714627-105714649 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085348 14:105714759-105714781 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085368 14:105714858-105714880 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085375 14:105714891-105714913 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085400 14:105715023-105715045 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085419 14:105715122-105715144 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085445 14:105715254-105715276 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085471 14:105715386-105715408 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085490 14:105715485-105715507 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1123085522 14:105715650-105715672 GAGGGCACCCTGGATTGTCAAGG - Intergenic
1124374789 15:29123199-29123221 GGGGACACCCAGGATGATCTGGG - Exonic
1126855425 15:52834391-52834413 GAGGATACCCAGGATGGGAAGGG + Intergenic
1129510299 15:76116577-76116599 GAACACACTCATGATGGTCAAGG - Intronic
1132456874 16:28982-29004 GAGGTCACACCAGGTGGTCATGG + Intergenic
1133026928 16:2992587-2992609 GAGGACACCCAAGCTGGTCAAGG + Intergenic
1135543506 16:23350406-23350428 GAGGAGACCCAACCTAGTCAGGG + Intronic
1136240014 16:28937851-28937873 CAGGTCACCCAAGCTGGGCAAGG - Intronic
1136287640 16:29253780-29253802 GAGGACCCCCAGGATCGTCAGGG + Intergenic
1137518279 16:49169522-49169544 GAGGACATCGAAAATGATCAAGG + Intergenic
1138979350 16:62248271-62248293 GTGGACACCCTAAATGTTCATGG + Intergenic
1140774379 16:78236722-78236744 GTGGACACCAGAGAGGGTCATGG + Intronic
1142093264 16:88226408-88226430 GAGGACCCCCAGGATCGTCAGGG + Intergenic
1146208950 17:30926977-30926999 GAAGACACCAAAGATGGAGAGGG - Intronic
1147383573 17:40069617-40069639 GAGCACCCCCAAGCTGGGCACGG - Intronic
1148567140 17:48640196-48640218 GAGGTCCCCCAGGATAGTCAGGG + Intergenic
1148808945 17:50278454-50278476 AAATACACCCAAGATGCTCATGG - Intronic
1150302667 17:64059479-64059501 GAGGGAACCCAACATGGCCAGGG - Intronic
1152410882 17:80122372-80122394 GTTGACACCCAAGACGTTCAGGG + Intergenic
1152699328 17:81811304-81811326 GAGGCCCCCCAGGATGGCCAAGG - Exonic
1152960923 18:79775-79797 GAGGTCACACCAGGTGGTCATGG + Intergenic
1155534553 18:26803574-26803596 GAGGATAACCAAGAGGGTGACGG - Intergenic
1157417988 18:47521812-47521834 GAGGACCCCCAAGAAGGGAAGGG + Intergenic
1157593741 18:48851381-48851403 GAGGAGACCCTTGATTGTCAGGG + Intronic
1159889872 18:73943387-73943409 CAGGACACCCATGAGGGTCCAGG - Intergenic
1161888663 19:7017758-7017780 CCGGACCCCCAAGATGTTCAAGG - Intergenic
1162459352 19:10805183-10805205 GAGGACATCCAAGGTCGACAGGG - Intronic
1163104563 19:15115930-15115952 GAGGGGACCCAGGATGGTTAGGG + Intronic
1163320389 19:16571551-16571573 GAGGACCACCCAGATGGGCATGG + Exonic
1166234617 19:41446533-41446555 AGGGACAGCCAAGATGGTCAGGG + Intergenic
1166259513 19:41627748-41627770 GAGGCCACCCGGGATGGTAAGGG - Intronic
1166407128 19:42529154-42529176 GAGACCACCCAGGATGGTCAGGG - Intronic
1166411970 19:42561551-42561573 GAGGACACCAGAGAGGGACAGGG - Intergenic
1166423074 19:42653336-42653358 GAGGACACCCAAGATGGTCAGGG + Intronic
1166482723 19:43187227-43187249 GAGGACATCAAAGATGGTCAGGG - Intronic
1166485197 19:43206361-43206383 GAGGACATCAAAGGTGGTCAGGG - Intronic
1166492348 19:43270279-43270301 GAGGACATCAAAGATGGTCAGGG - Intergenic
1167355212 19:48999443-48999465 GAGGACCCCTAAGATGGAGAGGG + Intronic
1168645057 19:58054146-58054168 GAGGAGTCCCAAGGTGGCCAGGG - Exonic
927138798 2:20115807-20115829 CAGGACACCCGAGATTCTCATGG - Intergenic
927647173 2:24885363-24885385 GTGAACACCCAAGCTTGTCATGG + Intronic
938499398 2:131822548-131822570 GAGGACACACAGGGTGGCCAGGG + Intergenic
942228362 2:173836732-173836754 CAGGAGACCCCAGATGGTCGTGG - Intergenic
944695168 2:202194165-202194187 GAGAAAACCCAAGATGGTCAGGG - Intronic
946130450 2:217602348-217602370 GATGACACCCAGGTTGATCAGGG + Intronic
947626438 2:231622012-231622034 GAGGACACCAAAAATGGTGCAGG - Intergenic
1169036831 20:2460431-2460453 GAGGAAAGCCAACATGTTCATGG - Intergenic
1171953304 20:31440513-31440535 GAGGACAGCCAACAAGGTCCAGG - Exonic
1173288601 20:41694585-41694607 GAGTACAGCCGAGATGATCATGG - Intergenic
1173324509 20:42020357-42020379 GATGACAGCCTAGATGGTCGTGG + Intergenic
1174836607 20:53861786-53861808 GAGAACACACAGGATGGTCACGG - Intergenic
1175537226 20:59722993-59723015 GAAGAAAACCAAGATGGTCAGGG - Intronic
1176796660 21:13375023-13375045 GAGGGAGCCAAAGATGGTCAGGG + Intergenic
1179628733 21:42663923-42663945 CAGGACACCCAGGATGCTCCAGG + Intronic
1179830562 21:43993656-43993678 GAGGACACTGGAGATGTTCATGG - Intergenic
1183638809 22:39081105-39081127 GCGGGCAACAAAGATGGTCAGGG - Exonic
953964575 3:47293800-47293822 GAGGAAACAAAAGATGGGCAAGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
960871596 3:122255117-122255139 GAGGACAACCAGGATGATGACGG - Intronic
961442401 3:126960762-126960784 GAGGAGAGCAAAGGTGGTCAAGG + Intergenic
965382210 3:168003854-168003876 AAGGTCAGCCAAGATGGTAAAGG + Intergenic
966242620 3:177771515-177771537 GAGGACCCACAGGCTGGTCAGGG - Intergenic
966840414 3:184083081-184083103 GAGGACACCAAAGAAGGATAGGG + Intergenic
968923761 4:3536301-3536323 GAGGAGACACAAAATGGTCCTGG - Intergenic
971330372 4:25676749-25676771 GGGGACGCCCCAGATTGTCAGGG + Exonic
978527618 4:109681461-109681483 CAGAACTCCCAAGATGGTCGTGG + Intronic
980980826 4:139653398-139653420 CAGGTCACCAAAGATGGTCAAGG - Intergenic
987173599 5:15284535-15284557 CAGGGCACCCAGGATGGTCATGG - Intergenic
991356650 5:65775729-65775751 GAGGAAACCCACAATGGCCAGGG - Intronic
992598302 5:78368673-78368695 GAGGACAGTCAGAATGGTCATGG + Intronic
997352441 5:133240583-133240605 GAGGACACCCAAGTCAGCCAGGG - Intronic
997840620 5:137236161-137236183 GAGGACAGGCCAGATAGTCATGG - Intronic
998467006 5:142354605-142354627 GATGACACAAAATATGGTCAAGG - Intergenic
1006740027 6:36301446-36301468 GAGGACACACCAGGTGGTCGGGG - Intronic
1011597299 6:89028157-89028179 GAGGACACCAAAGATGATTAAGG + Intergenic
1015440652 6:133242181-133242203 GATGACCCCCTAGATGGTCCAGG + Intronic
1018434406 6:163748110-163748132 GAACACACCTAAGGTGGTCAGGG - Intergenic
1018812013 6:167305207-167305229 GAGGACACCCACTATGGCCTGGG - Intronic
1022048238 7:26640470-26640492 GAGGTCACCCCAAATAGTCAAGG + Intronic
1023864521 7:44232466-44232488 GAGGACAGCCAGGAGGGCCAAGG + Intronic
1030880605 7:114873874-114873896 GAGGAAAAACAAGATGGTCATGG - Intergenic
1038099038 8:24351271-24351293 GAGGAAACCCCAGATGGTAAAGG + Exonic
1040815486 8:51503960-51503982 GAGGACAGCCAGTATGGTGAAGG - Intronic
1042699668 8:71598455-71598477 GAGGACACAAAAGATGATGATGG + Intergenic
1047531596 8:125681829-125681851 GAGGACACCCATGAGGGGCAGGG + Intergenic
1052363809 9:27589317-27589339 CTGGCCACCCAAGATGGGCATGG + Intergenic
1053799473 9:41755324-41755346 GAGGAGACACAAAATGGTCCTGG - Intergenic
1054145742 9:61559673-61559695 GAGGAGACACAAAATGGTCCTGG + Intergenic
1054187882 9:61967385-61967407 GAGGAGACACAAAATGGTCCTGG - Intergenic
1054465484 9:65490777-65490799 GAGGAGACACAAAATGGTCCTGG + Intergenic
1054650632 9:67621196-67621218 GAGGAGACACAAAATGGTCCTGG + Intergenic
1058114315 9:101067731-101067753 GAGAACAGCAAAGATGGACAGGG + Intronic
1060275694 9:122180702-122180724 GAGGACAGAAGAGATGGTCAGGG - Intronic
1062737242 9:138144216-138144238 GAGGTCACACCAGGTGGTCATGG - Intergenic
1185631458 X:1518634-1518656 GGGGACAAACAAGATGATCAGGG - Intronic
1188225786 X:27595426-27595448 GAGAACATTCGAGATGGTCAGGG - Intronic
1190254722 X:48753954-48753976 GTGGTCACCCAGGATAGTCATGG - Intergenic
1199868499 X:151875594-151875616 GAGGTCACCAGACATGGTCAAGG - Intergenic
1199984064 X:152937825-152937847 CAGGGAACCCAAGTTGGTCAGGG + Intronic
1200127867 X:153825291-153825313 GAGCACGCCGGAGATGGTCAGGG - Intronic
1200399486 X:156010741-156010763 GAGGTCACACCAGGTGGTCATGG - Intronic
1201555840 Y:15264055-15264077 CAGGACTCCCCAGATGGTAACGG - Intergenic