ID: 1166424728

View in Genome Browser
Species Human (GRCh38)
Location 19:42667565-42667587
Sequence CCTACGGGTGGTGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 16, 1: 26, 2: 15, 3: 10, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166424728_1166424739 20 Left 1166424728 19:42667565-42667587 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 15
3: 10
4: 147
Right 1166424739 19:42667608-42667630 ACAAAGGAATGAGCAGAGACAGG 0: 1
1: 23
2: 18
3: 60
4: 477
1166424728_1166424736 -5 Left 1166424728 19:42667565-42667587 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 15
3: 10
4: 147
Right 1166424736 19:42667583-42667605 GTAGGGTACCTGAAGTCTGGTGG 0: 4
1: 4
2: 13
3: 22
4: 112
1166424728_1166424734 -8 Left 1166424728 19:42667565-42667587 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 15
3: 10
4: 147
Right 1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG 0: 2
1: 9
2: 16
3: 13
4: 75
1166424728_1166424738 4 Left 1166424728 19:42667565-42667587 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 15
3: 10
4: 147
Right 1166424738 19:42667592-42667614 CTGAAGTCTGGTGGCGACAAAGG 0: 2
1: 7
2: 7
3: 24
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166424728 Original CRISPR CCTACGGGTGGTGTTGAGGC TGG (reversed) Intronic
900019977 1:181518-181540 CCTACGGGCGGGGTTGGGGGGGG + Intergenic
900619845 1:3581701-3581723 CCTAGGGGTGGTCTCCAGGCCGG - Intronic
901293347 1:8141531-8141553 GCTACTGGTGAGGTTGAGGCGGG + Intergenic
902362395 1:15949342-15949364 ACTCTGGGTGGTGTTGGGGCGGG - Intronic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
903363064 1:22789182-22789204 CCCTGGGGTGGTGTTGGGGCTGG - Intronic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
904653555 1:32025152-32025174 CCTACTGGGGGTGCTGAGGTGGG + Intronic
906129831 1:43449499-43449521 CCTGCGGGTGGTGGGAAGGCTGG + Intronic
909569963 1:77098441-77098463 CTTGAGGGAGGTGTTGAGGCAGG - Intronic
914855288 1:151346247-151346269 CCCCCAGGTGGTGCTGAGGCTGG - Exonic
915409817 1:155691838-155691860 CCTACGGGTGGTGCTGAGACTGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
916364420 1:164008325-164008347 CCTGAGGGTGGTATGGAGGCAGG + Intergenic
918673404 1:187250051-187250073 ACTACGAGGGGGGTTGAGGCAGG + Intergenic
919731494 1:200916208-200916230 CCTTGGGGTGGTGAGGAGGCGGG + Intergenic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
921908883 1:220527284-220527306 CCTACAGGATGTCTTGAGGCAGG + Intergenic
924360616 1:243237791-243237813 GCTACTGGGGGTGGTGAGGCAGG + Intronic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1066795194 10:39112443-39112465 AATACAGGTTGTGTTGAGGCTGG + Intergenic
1072660930 10:97363127-97363149 CCTACGGGTGGTGCCCAGGAAGG + Intronic
1073009760 10:100349948-100349970 CCTACAGGGGGTGCTGAGGCTGG - Intronic
1073188091 10:101629393-101629415 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1078171243 11:8930673-8930695 CCTAGGGGAGTTGTTGAGTCAGG + Intronic
1078527347 11:12110855-12110877 CCGCCGGGTGGGTTTGAGGCGGG - Intronic
1079437639 11:20474094-20474116 CGTACGGGTGCAGTTCAGGCTGG - Intronic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1081537262 11:44005001-44005023 CCCACTGGTGGTGGTGAGGTTGG + Intergenic
1083784920 11:64939039-64939061 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1083920337 11:65778917-65778939 CCTGAAGGTGGTGTTGCGGCAGG - Exonic
1087580690 11:100048017-100048039 GCTACTGGGGGTGCTGAGGCAGG + Intronic
1089638187 11:119829969-119829991 TTCAGGGGTGGTGTTGAGGCAGG - Intergenic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1093963012 12:25296010-25296032 CCTACCTGTGGTGTAGAGGTTGG - Intergenic
1095882913 12:47157476-47157498 CCTACTGGGGAGGTTGAGGCAGG + Intronic
1096321291 12:50615628-50615650 CTTAAGGGTGGGGTTGGGGCTGG + Intronic
1096974389 12:55691296-55691318 CCTAGGGCTGGAGTGGAGGCGGG + Intronic
1100424497 12:94471354-94471376 GCTACGGGGGGTGCTGAGGCAGG - Intergenic
1101835305 12:108290998-108291020 CCTGGGGGTGGGGTTGTGGCAGG - Exonic
1103908836 12:124340751-124340773 CCTGCGGGAGGTGTTGGGCCAGG + Exonic
1104410303 12:128552054-128552076 CCTAAGGCTGTTGATGAGGCGGG + Intronic
1104953546 12:132453215-132453237 CCTCCGGGAGGTGTGGTGGCTGG - Intergenic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1112875518 13:104033553-104033575 CCTACTGGTGAGGCTGAGGCAGG - Intergenic
1115054658 14:29108684-29108706 ACTAAGGTGGGTGTTGAGGCTGG + Intergenic
1119390872 14:74290228-74290250 CCTAGGGGTGGGGTGAAGGCGGG - Intronic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1120627800 14:86850595-86850617 GCTACTTGTGGGGTTGAGGCAGG + Intergenic
1120995983 14:90419128-90419150 CCCTCAGGGGGTGTTGAGGCCGG + Intergenic
1132299364 15:100766793-100766815 CCTCTGGGTGGTTTTGAGGTGGG - Intergenic
1133646191 16:7766879-7766901 CCTGCAGGTAGTGTTGAGGAGGG - Intergenic
1133728120 16:8556008-8556030 CCGACAGGTGGTGTTGAAGGAGG - Intergenic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1137625208 16:49903419-49903441 CCTACAGGTGGTGCAGAAGCTGG - Intergenic
1140786620 16:78348567-78348589 GCTACTGGTGGGGCTGAGGCAGG - Intronic
1142578318 17:924346-924368 CCTACGCGGGGGGCTGAGGCAGG - Intronic
1142676795 17:1518459-1518481 CCCACGGATGGTGTTGCTGCTGG - Exonic
1143385477 17:6527483-6527505 CCTACTGGTGGTGGTGGTGCTGG - Intronic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1145110517 17:20157232-20157254 CCTCGGGGTGGGGTGGAGGCGGG + Intronic
1146401290 17:32501921-32501943 TCTAGGGGTGGTGTGGGGGCTGG + Intronic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1148932799 17:51140721-51140743 GCTACTGGGGGTGCTGAGGCAGG + Intergenic
1151126775 17:71853865-71853887 CCTACTGGGGATGCTGAGGCAGG - Intergenic
1153791290 18:8582148-8582170 CCCAAGGGTTGAGTTGAGGCAGG + Intergenic
1155487504 18:26361631-26361653 GCTACGTGGGGGGTTGAGGCAGG + Intronic
1157485475 18:48084110-48084132 CTGAAGGGTGGTGTTGAGGAAGG + Intronic
1159904650 18:74078436-74078458 GCTGCGGCTGGTGCTGAGGCGGG - Intronic
1161178561 19:2863834-2863856 CCTACGGGTGATGTTAAGGCTGG + Intergenic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1162009141 19:7801056-7801078 CCCACGGGTAGTGTTGAGGCTGG - Intergenic
1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG + Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1165111047 19:33502373-33502395 TCAAGGGGTGGTGGTGAGGCAGG + Intronic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1165777349 19:38412641-38412663 CCTAAGGGTGGTGATGGGGTGGG + Intronic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167648576 19:50718396-50718418 CCTCCGAGCGGGGTTGAGGCTGG - Intronic
1167881332 19:52460876-52460898 AAAATGGGTGGTGTTGAGGCTGG - Intronic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
928836974 2:35559085-35559107 CCTACATGTGGTGTTGGGCCAGG + Intergenic
930659098 2:54036204-54036226 GCTACGTGTGGAGCTGAGGCAGG - Intronic
932389121 2:71369209-71369231 CCTACGTGGGAGGTTGAGGCAGG + Intronic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
935524254 2:104146108-104146130 GCTACTGGGGGTGCTGAGGCGGG - Intergenic
942349692 2:175039505-175039527 CCTAGGGGTGCTGTTGACGTTGG - Intergenic
946351301 2:219155811-219155833 GCTACGGGGGGCGCTGAGGCAGG + Intronic
948402016 2:237691769-237691791 CCTGCGGGTGGAGCTGCGGCCGG + Intronic
948422778 2:237870765-237870787 CCTAAGGTTGGAGGTGAGGCTGG + Intronic
948537905 2:238659747-238659769 CCTGTGGGAGATGTTGAGGCTGG + Intergenic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
948954178 2:241273782-241273804 GCCACGGGTGCTGTTGAGGATGG + Intronic
1170571542 20:17635509-17635531 CCTTGGGGAGGTGCTGAGGCAGG + Intronic
1170770104 20:19325332-19325354 GCTACTGGTGGGGCTGAGGCAGG + Intronic
1175176217 20:57114035-57114057 AGTACTGGTGGTGTTGATGCTGG + Intergenic
1175409132 20:58754502-58754524 CCTACAGGAGGGGTGGAGGCTGG - Intergenic
1176195607 20:63835326-63835348 CCTGCGGGTGGACTGGAGGCCGG + Intergenic
1179775414 21:43658894-43658916 CCCCCGGGTGGAGTTGAGACTGG - Intronic
1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG + Intergenic
1179787720 21:43739386-43739408 ACCATGGGTGGTGTTGAGGCTGG + Intronic
1179997754 21:44981777-44981799 CCTGCGTGTGGTGTTCAGGGGGG + Intergenic
1179997772 21:44981834-44981856 CCTGCGTGTGGTGTTCAGGGGGG + Intergenic
1179997789 21:44981891-44981913 CCTGCGTGTGGTGTTCAGGGGGG + Intergenic
1179997869 21:44982177-44982199 CCTGCGTGTGGTGTTCAGGGGGG + Intergenic
1180005537 21:45018944-45018966 CCCACGGGTGGGGGTGGGGCGGG - Intergenic
1181710845 22:24687085-24687107 CTTATGGTTGGTGATGAGGCAGG + Intergenic
1182344938 22:29656048-29656070 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1183108580 22:35631782-35631804 CCAAGTGGTGGTGGTGAGGCTGG - Intronic
1183229252 22:36570649-36570671 GCTACTGGGGGTGCTGAGGCAGG + Intronic
1183565210 22:38609579-38609601 CAAACGGTTGTTGTTGAGGCTGG - Intronic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
949412217 3:3778378-3778400 CCTAGGGATGGTGTTGATGATGG - Intronic
950298717 3:11855352-11855374 CCTACGGGGGAGGCTGAGGCAGG - Intergenic
954670005 3:52285697-52285719 GCTACTGGTGGGGCTGAGGCAGG - Intronic
955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG + Intronic
955435921 3:58899097-58899119 CCTACAGGTGCAGTTCAGGCTGG - Intronic
956334321 3:68146263-68146285 CCCAGGGGTTCTGTTGAGGCTGG + Intronic
958262343 3:91396130-91396152 GCTACTTGGGGTGTTGAGGCGGG + Intergenic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
962283419 3:134068489-134068511 ACTGGGGGTGGTGTTGAGTCTGG - Intronic
965765708 3:172128089-172128111 CCTACGGGTTGTGTTGAGCAAGG + Intronic
967851251 3:194084150-194084172 CATACAGGTGGTGTTGATTCAGG + Intergenic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
968698444 4:2043594-2043616 CCTGCGGGTGGTGTGGGAGCTGG + Intronic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969709176 4:8832918-8832940 CCTAGGGGGGGTGTTGATGGTGG + Intergenic
973620681 4:52722505-52722527 CCTAGGGGTGGGCTTGAGGCCGG - Intergenic
973888998 4:55350872-55350894 GCTACTGGGGGTGCTGAGGCAGG - Intronic
973914025 4:55614958-55614980 CCTACGGAATGGGTTGAGGCAGG + Intronic
975624826 4:76335689-76335711 GCTACTGGGGGTGCTGAGGCAGG - Intronic
977666923 4:99653317-99653339 CGTCCGGGTGGTGTTGGTGCTGG + Exonic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
984244357 4:177257446-177257468 GCTACTGGGGGTGCTGAGGCAGG - Intergenic
986672326 5:10153308-10153330 GCTACTGGGGGTGCTGAGGCAGG + Intergenic
988615425 5:32770316-32770338 GCTACTTGTGGGGTTGAGGCAGG + Intronic
990308803 5:54518582-54518604 CCGACGGGTGGTGCTGCGGGGGG - Exonic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
993536112 5:89088167-89088189 ACTACGGGTGATGGTGATGCAGG + Intergenic
993713479 5:91251026-91251048 GCTACTGGTGAGGTTGAGGCGGG + Intergenic
994331102 5:98507568-98507590 CCTATTGGTGGTGTTGGGGGAGG + Intergenic
995910055 5:117176293-117176315 GCCACAGCTGGTGTTGAGGCAGG + Intergenic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1004138215 6:12989585-12989607 CCTACAGGCAGTGTTGAGACTGG - Intronic
1004482362 6:16033000-16033022 AGTTGGGGTGGTGTTGAGGCAGG - Intergenic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006223246 6:32513354-32513376 TCCACGGGTGGTGTTGAGGCTGG + Intergenic
1006427326 6:33974635-33974657 GCTGCGGGGGGTGGTGAGGCCGG - Intergenic
1007407443 6:41643135-41643157 CTGCGGGGTGGTGTTGAGGCTGG - Intronic
1009424716 6:63501248-63501270 GCTACTGGGGATGTTGAGGCAGG + Intergenic
1009593841 6:65709140-65709162 GCTACTGGGGGTGCTGAGGCAGG - Intergenic
1012178444 6:96120380-96120402 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1014588355 6:123229795-123229817 CCTACCATTGGTGCTGAGGCTGG - Intronic
1017279386 6:152607094-152607116 CCTACTGGGGGGGCTGAGGCAGG - Intronic
1025769610 7:64491725-64491747 GCTACTGGGGGGGTTGAGGCAGG + Intergenic
1031540724 7:122991634-122991656 CTTAGGCGTGGTGTAGAGGCTGG + Intergenic
1034367165 7:150561082-150561104 CCCGCAGGTAGTGTTGAGGCTGG - Intergenic
1034905043 7:154936784-154936806 CCCGTGGGTGGCGTTGAGGCTGG - Intronic
1035556975 8:574626-574648 CCCATGGGTGGTGCAGAGGCAGG + Intergenic
1037340431 8:17838988-17839010 CCTACGAGGGGCGCTGAGGCAGG - Intergenic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1040296164 8:46150235-46150257 CCTCAGGGGGATGTTGAGGCAGG - Intergenic
1040299132 8:46178959-46178981 ACTCAGGGTGCTGTTGAGGCAGG - Intergenic
1040300404 8:46185020-46185042 ACTCAGGGTGATGTTGAGGCAGG - Intergenic
1040304780 8:46206359-46206381 ACTCAGGGTGATGTTGAGGCAGG + Intergenic
1040307189 8:46218177-46218199 ACTCAGGGTGATGTTGAGGCAGG - Intergenic
1040311084 8:46237199-46237221 CCTCAGGGGGCTGTTGAGGCAGG + Intergenic
1040333250 8:46403109-46403131 ACTAAGGGTGATGTTGAGGCAGG + Intergenic
1040338249 8:46427029-46427051 ACTAAGGGGGATGTTGAGGCAGG + Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1040419026 8:47221928-47221950 GCTAGGGGTGGTGATGATGCCGG - Intergenic
1042927419 8:73980198-73980220 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1043370333 8:79583865-79583887 CTTACATGTGGTGTTGAGCCTGG + Intergenic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1052824350 9:33164246-33164268 CTTGCGGGTGGTTTTGAGGTTGG - Intronic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1055156079 9:73065116-73065138 CTTAAGGGTGGGGTTCAGGCAGG - Intronic
1056143418 9:83707137-83707159 CCTCCGGGCGGGGTGGAGGCTGG - Intronic
1056593403 9:87984155-87984177 CCTACGGGTGGTGTTGGGGTTGG - Intergenic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1057208472 9:93186793-93186815 CCAAGGGGTGGTGGAGAGGCAGG - Intronic
1057528747 9:95825416-95825438 CCCCTGGGTGGTGTTGGGGCAGG + Intergenic
1058031322 9:100201169-100201191 CATAAGGGTGGTATGGAGGCAGG + Intronic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1061073544 9:128326858-128326880 GCTACGTGGGGGGTTGAGGCAGG - Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1061926210 9:133807290-133807312 CCTGCGGCTGGTGCTGAGCCCGG - Exonic
1062257238 9:135632777-135632799 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1062269392 9:135701704-135701726 CCTGCGGGGGGTGTGGGGGCGGG + Intergenic
1187458925 X:19467715-19467737 CCTACGTGGGAGGTTGAGGCAGG + Intronic
1190186621 X:48240221-48240243 GCTACTAGTGGTGCTGAGGCAGG - Intronic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1190732492 X:53234736-53234758 CCCACAGGTGGGGCTGAGGCGGG + Exonic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1195807044 X:108785737-108785759 CCTACGGTTGGTGGGAAGGCAGG - Intergenic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1201346827 Y:12993881-12993903 CCTACATGTGATGTTGAGGCTGG - Intergenic
1201377090 Y:13334271-13334293 CCCACGGGTGGTGATGAGGCTGG + Intronic
1201485950 Y:14494883-14494905 GCTACTGGTGAGGTTGAGGCAGG + Intergenic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic