ID: 1166424957

View in Genome Browser
Species Human (GRCh38)
Location 19:42669467-42669489
Sequence TAATGAGGAAGTCATATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 3, 2: 3, 3: 17, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166424957_1166424963 23 Left 1166424957 19:42669467-42669489 CCTTGCATATGACTTCCTCATTA 0: 1
1: 3
2: 3
3: 17
4: 176
Right 1166424963 19:42669513-42669535 ACCTACTCAAGAATCTACAGGGG 0: 1
1: 1
2: 2
3: 24
4: 345
1166424957_1166424961 21 Left 1166424957 19:42669467-42669489 CCTTGCATATGACTTCCTCATTA 0: 1
1: 3
2: 3
3: 17
4: 176
Right 1166424961 19:42669511-42669533 TCACCTACTCAAGAATCTACAGG 0: 1
1: 1
2: 1
3: 21
4: 115
1166424957_1166424962 22 Left 1166424957 19:42669467-42669489 CCTTGCATATGACTTCCTCATTA 0: 1
1: 3
2: 3
3: 17
4: 176
Right 1166424962 19:42669512-42669534 CACCTACTCAAGAATCTACAGGG 0: 1
1: 1
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166424957 Original CRISPR TAATGAGGAAGTCATATGCA AGG (reversed) Intronic
905933180 1:41804035-41804057 TAATAAAGAAATAATATGCAAGG - Intronic
907019419 1:51051939-51051961 TAATGAGGAAGGCATGTCAAAGG - Intergenic
908479057 1:64519004-64519026 TAATGAGGAAGGGAAATTCAAGG - Intronic
911376566 1:97058207-97058229 TAAAGAGGAAGCCATAGACAGGG - Intergenic
911502298 1:98703019-98703041 TAATTAGGAAGTCATATGTTAGG - Intronic
911568097 1:99488554-99488576 TTAGGAGGCAGACATATGCAAGG + Intergenic
916226762 1:162496804-162496826 TGATGAGGGAGCCATAGGCAAGG + Intergenic
916251662 1:162744288-162744310 AAATGAGGAATTCATATTCGAGG - Intronic
916681967 1:167113159-167113181 TAAAGATGAACTCAAATGCACGG - Intronic
918280390 1:182998516-182998538 GAATCATGAAGTCATATACATGG + Intergenic
919765119 1:201122165-201122187 GAATGAGGAAGTACTATCCATGG + Intronic
920203761 1:204276772-204276794 GAATGAGGACGTCATTTGTAGGG - Intronic
921528209 1:216244610-216244632 AAATGAGACAGTCTTATGCATGG + Intronic
924167658 1:241302087-241302109 AAGTGAGGAAGTAATATTCATGG + Intronic
1066208947 10:33217356-33217378 TAATGAGGCAGCTATATGGAAGG - Intronic
1067956826 10:50800840-50800862 TAATGATGAAATCAAATGCAAGG + Exonic
1070393837 10:75994326-75994348 CAATCAGGAAGACATATGAAAGG + Intronic
1074323209 10:112422576-112422598 GTATGAGGAAGTCATAAGCCAGG - Intronic
1078229312 11:9425222-9425244 TAAAGAGCCAATCATATGCAGGG - Exonic
1078402878 11:11043922-11043944 TAATGAGGAAGTCATTTTTCAGG + Intergenic
1079313936 11:19391400-19391422 TGATGATGAAGTCATATGTAAGG - Intronic
1081214435 11:40377800-40377822 TAATGACAAAGTCATTTGAAAGG - Intronic
1082219746 11:49620036-49620058 TTCTGAGGAAGTCATTTGTAAGG - Intergenic
1086629887 11:89004749-89004771 TTCTGAGGAAGTCATTTGCAAGG + Intronic
1087979613 11:104594785-104594807 TAATGAGGAAGAGAACTGCATGG - Intergenic
1092746586 12:11678137-11678159 TAATAAGGATGTTATATGCATGG - Intronic
1095385665 12:41646971-41646993 TAATGAGGCAATCAACTGCATGG + Intergenic
1096534957 12:52265991-52266013 GAATGAGGAAGGCGTAAGCAAGG - Intronic
1098125762 12:67291224-67291246 TAATGAGAAAAGTATATGCAAGG + Intronic
1101256372 12:102981456-102981478 AAAAGAGGAAGGCATTTGCATGG - Intergenic
1101478464 12:105074019-105074041 CAATGACGAAGACATAAGCATGG + Intronic
1101722996 12:107366801-107366823 TAATCAGTAACTCAGATGCAAGG - Intronic
1103666968 12:122575960-122575982 TAATGAGGAATTTATATTCTAGG + Intronic
1104242823 12:127007520-127007542 GTATGAGGACTTCATATGCAAGG + Intergenic
1105797635 13:23872016-23872038 GAATGATGAAGTGATATGCCTGG - Intronic
1106040281 13:26083816-26083838 TAATGGGGAAGTAAGATGAAGGG - Intergenic
1111083111 13:83337901-83337923 GAATGTGGAAGTCAGATCCATGG - Intergenic
1111554584 13:89863671-89863693 TAATGAGGAGGTCATGGTCATGG - Intergenic
1112764222 13:102723656-102723678 AAATGGGGAAGTCATTGGCAGGG + Intergenic
1117426670 14:55605678-55605700 TAATGAGGCAGTAAAATGGAAGG - Intronic
1117864054 14:60126856-60126878 TAATGTGGAGGTCTTATGCTGGG + Intronic
1122384138 14:101332483-101332505 AAAGGAAGAAGTCATCTGCAAGG + Intergenic
1123916103 15:25028989-25029011 CAAAGAGGAAGCCATATGCATGG + Intergenic
1124172008 15:27382974-27382996 AAATTTGGAAGTCATAAGCAAGG + Intronic
1125154995 15:36576094-36576116 GAATGAGCCAGTCACATGCATGG - Intergenic
1125381498 15:39091852-39091874 TAAAGAGGAAGTCATAACCCTGG + Intergenic
1126937508 15:53727753-53727775 GAATGAGGACTTCATATGAAAGG - Intronic
1127495370 15:59506296-59506318 AGATGAAGAAGTCATAGGCATGG + Intronic
1127604006 15:60567904-60567926 AAATGAAGATGTCATATGTAAGG + Intronic
1127953390 15:63832802-63832824 GAATGAGGAAGTCCCAAGCAAGG + Intronic
1131311973 15:91298422-91298444 TGGTGAGGAATTTATATGCATGG + Exonic
1131753810 15:95538867-95538889 AAATGAGGAAGTCTTATAGATGG - Intergenic
1134189136 16:12107821-12107843 TAATGAAGAATTCCTATGGACGG - Intronic
1134562468 16:15222493-15222515 CAATGAGGAAGTGATAGGAATGG - Intergenic
1135507764 16:23053451-23053473 TAATGAGGAGGCCAGAGGCAGGG - Intergenic
1136302743 16:29347414-29347436 TAAGGAGGAAGTCAGAAGCCAGG + Intergenic
1136405052 16:30040393-30040415 AAATGAGGAAGTTATTTGTAAGG - Intronic
1137386848 16:48049791-48049813 TAGTTAGGAAGACATAAGCAGGG + Intergenic
1138782672 16:59808065-59808087 TATTGAAGAAGTCATGTACAAGG - Intergenic
1141043057 16:80688809-80688831 GAATGTTGCAGTCATATGCAAGG - Intronic
1142633290 17:1240177-1240199 TAATGATGAACACATATGCATGG + Intergenic
1144664710 17:17094345-17094367 TATTGAGAAGTTCATATGCAAGG + Intronic
1145740408 17:27269399-27269421 GAAAGAGGAAGTCATATGGATGG - Intergenic
1146683559 17:34825496-34825518 TAATTAAGGAGACATATGCAGGG - Intergenic
1147565504 17:41533893-41533915 TATTGAGGAAGTCATATAAAAGG + Intergenic
1150496345 17:65610836-65610858 TAATGATAAAGTCAAATGAAAGG + Intronic
1153023150 18:649726-649748 TAATGTGAAACCCATATGCATGG - Exonic
1153139617 18:1955531-1955553 TAATGACTAAATCATATGCCAGG + Intergenic
1153698372 18:7666879-7666901 TTAAGAGGAAGTCAAAAGCAGGG + Intronic
1154968515 18:21383517-21383539 TCATGGGGAATTCATATGCTGGG + Exonic
1156322021 18:36035452-36035474 TAATGAGGAAGAGATAAGCCAGG + Intronic
1159912606 18:74160758-74160780 TAATGAAGAAATTATATGCAAGG + Intergenic
1159985971 18:74841293-74841315 GAGTGAGGAACTAATATGCAGGG - Intronic
1164815527 19:31198792-31198814 TAAAGAGGTATTCATATTCATGG + Intergenic
1166265147 19:41676988-41677010 TAATGAAGTAGTCATATGCTAGG + Intronic
1166414367 19:42582833-42582855 TAATGAGACAATCATATGCAAGG + Intronic
1166418978 19:42619791-42619813 TAATGAGACAGTCATATGCAAGG + Intronic
1166424957 19:42669467-42669489 TAATGAGGAAGTCATATGCAAGG - Intronic
1166430610 19:42723537-42723559 TAATGAGGCAGTCATATGCAAGG + Intronic
1166443629 19:42838895-42838917 TAATGAGGCAGTCATATGCAAGG + Intronic
1166463325 19:43009559-43009581 TAATGAGGCAGTTATATGCAAGG + Intronic
1166466383 19:43035451-43035473 TAATAAGGCAGTCATACACAAGG + Intronic
1166469467 19:43066117-43066139 TAATGAGGCAATCATATGCAAGG + Intronic
1166472535 19:43091524-43091546 TAATGAGGCAGTCATACACAAGG + Intronic
1166480597 19:43169655-43169677 TAATGAGGCAGTCATATGCAAGG + Intronic
1166493295 19:43278512-43278534 TAATAAGGCAGTCATACACAAGG + Intergenic
1167790001 19:51669612-51669634 TACTGGGGAAGCCACATGCAGGG - Intergenic
925829462 2:7879951-7879973 TAATGAGGAAGTAATGTAAATGG + Intergenic
926384417 2:12322269-12322291 CAAAGAGAAAGTCATGTGCAAGG + Intergenic
928829798 2:35466541-35466563 TTATGAGTAAGTCATTTCCATGG - Intergenic
931656758 2:64516514-64516536 TAATGACCAAGTGAAATGCATGG - Intergenic
932882994 2:75521506-75521528 TAAAAAGGAAGGCATAAGCATGG + Intronic
933588163 2:84202199-84202221 AAAAGAGGCAGTCATATGGAAGG - Intergenic
933818368 2:86087402-86087424 AATTGAGGAAGTTACATGCATGG - Intronic
934731530 2:96661613-96661635 TAATGGGGAGGTCACAGGCAAGG - Intergenic
935959102 2:108406864-108406886 TAATGAGAAAGTTAAATGCAAGG + Intergenic
942879855 2:180846030-180846052 TAATGGGGAAGGCATATGATGGG + Intergenic
944560722 2:200934680-200934702 AAATGAGGAAATCAACTGCAAGG + Intronic
945400113 2:209371240-209371262 AAATGAGGAAGTTATATATAAGG + Intergenic
945826524 2:214726900-214726922 CAATCAGGAATTCAGATGCAAGG + Exonic
1169653904 20:7900808-7900830 TAGTGAGGAAGGCATGTGAAAGG + Intronic
1177701747 21:24647437-24647459 TAATAAGCAATGCATATGCAAGG - Intergenic
1178191620 21:30288456-30288478 TAATTTAGAAGACATATGCAGGG + Intergenic
1178462235 21:32813368-32813390 TAAAGAGGAATTCATATGCCTGG + Intronic
1179009812 21:37547499-37547521 TAAAGAGGAAGGCATTTACAAGG - Intergenic
1179512424 21:41882426-41882448 CACTGAGGAAGTCAGAGGCAGGG - Intergenic
1180620143 22:17156172-17156194 TTAGGGGGCAGTCATATGCATGG - Intronic
1183757898 22:39787415-39787437 TAGTGAGGAAGGCATATTGAAGG + Intronic
1184948886 22:47825513-47825535 TCATGAGGAAGGCTTATGGAAGG + Intergenic
952130211 3:30353243-30353265 TATTGAGGAAGTCCAAGGCAGGG + Intergenic
952541473 3:34372109-34372131 TGATGAGGAAGTAAAAAGCAAGG - Intergenic
953640621 3:44703789-44703811 TTCTGAGGCAGTCATAGGCAAGG + Intergenic
953813299 3:46132735-46132757 AAATGTGGAAGTGATATGCTCGG + Intergenic
957817661 3:85323014-85323036 AAATGAGTAAGACATATCCATGG - Intronic
959682483 3:109111630-109111652 AAAGGAGGAAGGCATAGGCAAGG + Intronic
959890625 3:111551317-111551339 TATTGGAGAAGTCATCTGCATGG + Intronic
960346977 3:116545147-116545169 TAATGAACAAGTGAAATGCAAGG + Intronic
964061535 3:152530331-152530353 TAGTGAGGAAGGCATATTGAAGG - Intergenic
964113656 3:153112965-153112987 TAATGAAGAATACATAGGCAGGG + Intergenic
964147977 3:153489141-153489163 CCAAGAGGAAGTCATATACATGG - Intronic
964495778 3:157287994-157288016 TAAAGAGGAACTCATTGGCATGG - Intronic
964639619 3:158894649-158894671 TCATAAGGAAGCCATAGGCATGG + Intergenic
967710771 3:192705205-192705227 TAGTGAGGAAGGCATATTGAAGG - Intronic
968678014 4:1895962-1895984 TGATGAGGAAGTCCTCTGCCTGG + Intronic
971921309 4:32943212-32943234 TAATGAGGAAGGCATGTCAAAGG + Intergenic
973632253 4:52830435-52830457 CATTCAGGAAGTCATATGTATGG - Intergenic
976281503 4:83331445-83331467 TAATGTGGGCCTCATATGCAAGG - Intronic
976405944 4:84660408-84660430 TTATGAGGAAGTCAGAGGGAGGG + Intergenic
976596583 4:86900776-86900798 CAGTGAGGGAGTCAGATGCATGG + Intronic
976738231 4:88332544-88332566 TAAGGAGGAAGTCATACAGATGG + Intergenic
979214502 4:118146898-118146920 TAATGAGGAAGTCATCAGTTGGG - Intronic
980416782 4:132499108-132499130 TAAAGAGGAAGTCAGATCCCAGG - Intergenic
981080285 4:140633340-140633362 CAAAAAGGCAGTCATATGCAGGG + Intronic
981853143 4:149255568-149255590 TCATGAGAATGTCAGATGCAGGG + Intergenic
983116334 4:163821144-163821166 GAAAGAGGAAATCATGTGCAAGG - Intronic
983122711 4:163907859-163907881 TAATGGGGGAGTCATGTGCCAGG - Intronic
983524040 4:168742106-168742128 TTCTGAGGAAGCCATATGGATGG + Intronic
984216872 4:176923983-176924005 TAATGAGAAATCGATATGCATGG - Intergenic
984756184 4:183327762-183327784 TAATGAGGAAGGGATATGTTTGG + Intergenic
986373973 5:7111517-7111539 TAATGAGTAATTCAAATCCATGG + Intergenic
986685701 5:10273748-10273770 TAGTCAGGAAGACATAAGCAGGG - Intergenic
986728969 5:10620848-10620870 TAATTAGTAAGTAATCTGCAAGG + Intronic
988436836 5:31185800-31185822 TAATGAGCAAGTCATATTTGGGG - Intergenic
989325938 5:40194668-40194690 GAATTAGGAAGTCAAATCCATGG - Intergenic
990853538 5:60236449-60236471 TACTGAAGAAGACATATGGATGG + Intronic
991304140 5:65158860-65158882 TAATAAGGAAATCAGAAGCAGGG - Intronic
992376357 5:76191701-76191723 TAATGAGGAAGTCATACTTGAGG + Intronic
993532501 5:89041715-89041737 TAATCATTAAGTCAAATGCAAGG - Intergenic
993886254 5:93418950-93418972 TAATGAGGAACTCATAGGTTGGG - Intergenic
994680792 5:102884532-102884554 TAATGTGGAAAAGATATGCATGG - Intronic
995164577 5:109024359-109024381 TTATGAAGAAGAGATATGCAAGG - Intronic
995445932 5:112244038-112244060 TAGTGAGGAAGTCATCTTAAAGG - Intronic
995639054 5:114232486-114232508 TAAAGAGGAAGTTATAAGCCTGG - Intergenic
997325493 5:133017140-133017162 TAGTGGGGAAGTCCAATGCAGGG - Intronic
998653768 5:144151712-144151734 TAAGGAGGAAGCCAAAAGCAGGG + Intergenic
1004746111 6:18510842-18510864 TACTGAGAAAGTCATATGGGAGG + Intergenic
1007853936 6:44834770-44834792 TAATGGGGAAAACAGATGCAGGG + Intronic
1007866898 6:44981275-44981297 TAATGAAGAAGTCATATACCTGG + Intronic
1009361764 6:62823760-62823782 TAAAGAGGGAATCATATACAGGG - Intergenic
1010052020 6:71516377-71516399 TAGTAAGGGAGGCATATGCAGGG + Intergenic
1011906286 6:92372610-92372632 GTATAAGGAAGTCATCTGCACGG + Intergenic
1012352465 6:98269532-98269554 GAAGGAGGAAGCCATAGGCAAGG + Intergenic
1013056832 6:106591067-106591089 TAGTGAGCAAGTCAAATGAATGG - Intronic
1014151821 6:118065871-118065893 TAATTATAAAATCATATGCAAGG - Intronic
1017202179 6:151767210-151767232 AAATGTGGAAATTATATGCAAGG - Intronic
1019033226 6:169031553-169031575 TGCTGAGGAAGTCAGAGGCAGGG - Intergenic
1019332590 7:467736-467758 TTATGAGGAAGTGATACTCATGG - Intergenic
1019332600 7:467819-467841 TCATGAGGAAGTGATAGTCATGG - Intergenic
1019332611 7:467895-467917 TCATGAGGAAGTGATAGTCATGG - Intergenic
1020856324 7:13429321-13429343 TAAAAAGGAAGGTATATGCATGG + Intergenic
1021212227 7:17868406-17868428 TAATCAGTATGTCATATGGATGG - Exonic
1021664189 7:22958386-22958408 TAAAAAGTAAGTCACATGCATGG - Intronic
1024685757 7:51743330-51743352 TAAAGAGAAAGTTATATGCAAGG + Intergenic
1024822265 7:53346298-53346320 TAACAAAGAAGACATATGCATGG - Intergenic
1028425834 7:90687609-90687631 AAATGGGGAAGTGATATGCTAGG + Intronic
1036068633 8:5414090-5414112 TAAGGAGGAAGCAATATGGAGGG + Intergenic
1044901145 8:96946097-96946119 TAACCAGGAAGACATAAGCAGGG - Intronic
1047488479 8:125354387-125354409 TAATTTGGAAGTAATATGTAGGG - Intronic
1051039909 9:12795504-12795526 TAATAAGGTAGTGATAAGCATGG + Intronic
1052647997 9:31262395-31262417 TAAATATGAAGTTATATGCAGGG - Intergenic
1052826499 9:33179912-33179934 TACTGAGGAAGTTATAGACATGG - Intergenic
1052830647 9:33212469-33212491 TAAAGATGAAGACATAGGCAGGG - Intergenic
1053172472 9:35899230-35899252 TAGTGAGGAAGGCATATCGAAGG - Intergenic
1053189115 9:36046366-36046388 TGATAACGAAGTCATATGAATGG + Intronic
1058394033 9:104529020-104529042 TAATGAGGCAGGCATATAGAAGG + Intergenic
1059815149 9:117903863-117903885 CAATGAGGAAGTGATATCCTTGG - Intergenic
1061631236 9:131873608-131873630 TAATGAAGGAGCCATTTGCATGG + Intronic
1061917864 9:133765263-133765285 TAATTAGCAAGTAATTTGCAGGG - Intronic
1186320146 X:8415355-8415377 TCAGCAGGAAGTCATATGAAAGG - Intergenic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1188556309 X:31416152-31416174 TAATTAGGAATTCATATTCTAGG + Intronic
1196067608 X:111482157-111482179 GAATGAGTAAGTCAAAGGCAAGG + Intergenic
1196144442 X:112301504-112301526 TAACAATGAAGTCATGTGCAAGG + Intergenic
1196424179 X:115553079-115553101 TAATGAGGATATGATATGAAAGG - Intergenic
1196864208 X:120056213-120056235 AAATGAGGAAGTCTTCTTCATGG - Intergenic
1196878891 X:120180117-120180139 AAATGAGGAAGTCTTCTTCATGG + Intergenic
1197841486 X:130752225-130752247 AAAAGAGGGAGTCACATGCAGGG - Intronic
1198069068 X:133130047-133130069 TAAATAGAAAGTCAGATGCATGG - Intergenic
1201546418 Y:15168350-15168372 TAATGATAAAGTGAGATGCAAGG - Intergenic
1201674021 Y:16558914-16558936 TATTGTGGAATGCATATGCAAGG + Intergenic