ID: 1166425330

View in Genome Browser
Species Human (GRCh38)
Location 19:42673019-42673041
Sequence ATATTTTGGTGAGCTCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 2, 1: 1, 2: 8, 3: 14, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166425330_1166425334 15 Left 1166425330 19:42673019-42673041 CCACTCAGAGCTCACCAAAATAT 0: 2
1: 1
2: 8
3: 14
4: 167
Right 1166425334 19:42673057-42673079 GAGGCACTTAACTGCAAACCAGG 0: 2
1: 0
2: 0
3: 6
4: 129
1166425330_1166425332 -4 Left 1166425330 19:42673019-42673041 CCACTCAGAGCTCACCAAAATAT 0: 2
1: 1
2: 8
3: 14
4: 167
Right 1166425332 19:42673038-42673060 ATATTTGACACCATAACTAGAGG 0: 2
1: 0
2: 1
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166425330 Original CRISPR ATATTTTGGTGAGCTCTGAG TGG (reversed) Intronic
908814719 1:68020139-68020161 ATATTCTGGGGTGCTCTGAATGG - Intergenic
909221431 1:72966875-72966897 ACACTTTGGTAAACTCTGAGAGG + Intergenic
909746958 1:79109154-79109176 ACATTTTGGGGAGCTTTAAGAGG + Intergenic
913447170 1:118961781-118961803 ACTCTCTGGTGAGCTCTGAGGGG + Intronic
915090398 1:153420048-153420070 AGATTTTGAGGAGCTCTAAGTGG + Exonic
916317571 1:163467311-163467333 ATATTTTGTAGAGTTCTGACAGG + Intergenic
918002824 1:180513678-180513700 CTGTTTGGGTGAGCTCTGATTGG - Intergenic
919557215 1:199073254-199073276 CTATTTTGCTGAGCGCAGAGTGG - Intergenic
920323896 1:205146309-205146331 GTATTTGGGTGAGAACTGAGAGG - Exonic
920700356 1:208213699-208213721 ATATTTTGGTGGCCTTAGAGGGG - Intronic
920712931 1:208312305-208312327 ATATTTTGGGGTGCTCTGAGAGG - Intergenic
922370145 1:224901722-224901744 ATATTTTGGAGAGCTGGGAGAGG + Intronic
922678426 1:227568619-227568641 ATGTTTTGCTGAGTTCTGTGAGG + Intronic
924118234 1:240769063-240769085 ATATTTTGAAGAGGTATGAGAGG - Intergenic
1063129053 10:3161803-3161825 ATATTTCTGTGAGGTCAGAGTGG + Intronic
1064022678 10:11822715-11822737 TTATTATGGTCAGCTTTGAGAGG - Intergenic
1065699425 10:28410496-28410518 ATATTTTGGTTAACTCTTAAAGG - Intergenic
1070941430 10:80351573-80351595 CTGTTTTGGTGAGATCTGAGTGG - Intronic
1071365411 10:84894608-84894630 TTCTTTTGGTGAGCCCTCAGTGG + Intergenic
1071962027 10:90816294-90816316 AAATTTTGGAGAACTCAGAGAGG - Intronic
1074838572 10:117325245-117325267 ATATTTTTGGGACCTCAGAGAGG + Intronic
1076267494 10:129120080-129120102 ATATTTTGGGGGGCTGGGAGTGG + Intergenic
1078789727 11:14530230-14530252 AGTTTTTGGTGTGCTGTGAGTGG - Intronic
1079664954 11:23093346-23093368 ATATTTTTGTGAGCTCCAGGTGG + Intergenic
1080753928 11:35177274-35177296 TTATTTTTGGGAGCCCTGAGAGG + Intronic
1080868672 11:36217297-36217319 AGATTGTGGTGAGCCCTGAGTGG + Intronic
1086419355 11:86623184-86623206 CTATTTGGGTGAGCCCTCAGTGG - Intronic
1087048746 11:93866135-93866157 AAGTTTTGGTGAGGTCTGGGAGG + Intergenic
1088172035 11:107009201-107009223 ATATTTTGGTAAGGTTTGAGAGG + Intronic
1088435576 11:109809146-109809168 ACATTATGGTGAGTTCTGACTGG + Intergenic
1092590273 12:9946870-9946892 ATAGTTGGGGGAGGTCTGAGAGG + Intergenic
1092946702 12:13462959-13462981 ATGTTGTAGTGACCTCTGAGAGG + Intergenic
1097162804 12:57060941-57060963 TTATTTTGGTGAGCACAGAAAGG - Exonic
1098911612 12:76214848-76214870 ATATTAGGGTGAGCAATGAGAGG - Intergenic
1099046699 12:77729433-77729455 ATATTTTAGTGGGGTTTGAGAGG - Intergenic
1101239746 12:102825860-102825882 TAATTTTGGTGAGATCTGGGAGG - Intergenic
1103834755 12:123809756-123809778 ATATCTTTGTGTGCTCTGTGAGG + Intronic
1107412414 13:40170220-40170242 CTATTTTGGTGGTCTCTAAGTGG - Intergenic
1107650737 13:42542128-42542150 ATATTTTAGAGAGCCCTGGGTGG - Intergenic
1110534716 13:76638073-76638095 ATAGGTTGGTGCCCTCTGAGTGG - Intergenic
1110792910 13:79605110-79605132 AAAGTTTGGTTAGCTGTGAGAGG - Intergenic
1110890276 13:80689811-80689833 TTATCTTGCTGAGCTCTGTGGGG - Intergenic
1113774830 13:112937950-112937972 TTATTCAGGTGATCTCTGAGTGG + Intronic
1113774890 13:112938314-112938336 TGATTCAGGTGAGCTCTGAGTGG + Intronic
1114370138 14:22077405-22077427 CTATTATGCTGAGCTCTGTGTGG + Intergenic
1115554771 14:34536046-34536068 ATATTTTTGTAAGCTCTGTAAGG - Intronic
1116099739 14:40418174-40418196 ATATGAGGCTGAGCTCTGAGAGG + Intergenic
1117198294 14:53362794-53362816 GCATTTTAGTGAGCTCTGATTGG - Intergenic
1119131952 14:72181191-72181213 ATATTTTGGTTAGTTCAGTGTGG + Intronic
1120005047 14:79347072-79347094 ATATTTGAATGGGCTCTGAGAGG + Intronic
1122077082 14:99242915-99242937 CAATTTTTGTTAGCTCTGAGAGG + Intronic
1122438407 14:101713747-101713769 ATACTTGGGTGAGATCTCAGTGG - Intergenic
1125142628 15:36427366-36427388 ACATTTAGGTTAGCTCTCAGTGG + Intergenic
1126280640 15:46944281-46944303 ATATTTTAGTGATCACTTAGAGG - Intergenic
1128878084 15:71218344-71218366 GGATTTGGGTGAGGTCTGAGTGG + Intronic
1130936852 15:88478047-88478069 ATATTCTGGAGAGCTCTGACAGG - Exonic
1133845455 16:9449217-9449239 ATATTTTGATGAGTTCTCATAGG - Intergenic
1135198574 16:20416648-20416670 ATATTTTTGTGACCTCTGATTGG + Intronic
1143030070 17:3963000-3963022 ATATTTAGTTGAGCTGTGGGAGG - Intronic
1144017264 17:11208038-11208060 TTCCTTTGGTGAGGTCTGAGGGG + Intergenic
1149433875 17:56617128-56617150 TTATTTTGGTGGATTCTGAGGGG - Intergenic
1152192678 17:78898040-78898062 TTCTTTTTGTGAGCTCAGAGGGG - Intronic
1153538564 18:6130399-6130421 ATATTTTTGGGTGCTCTTAGTGG - Intronic
1153890206 18:9506806-9506828 ATATTTTTGAGGGCTTTGAGAGG - Intronic
1155914107 18:31539240-31539262 CCATTTTGATGAGCTCTGTGAGG + Intronic
1157998014 18:52583138-52583160 ATATTTTGGTAAGCTGTATGAGG + Intronic
1158844741 18:61429859-61429881 ATAGTTTGTTGAAATCTGAGTGG - Intronic
1159156596 18:64591209-64591231 AAAGTGTTGTGAGCTCTGAGAGG + Intergenic
1159332697 18:67020071-67020093 ATATTTCTGTGAGGTCTGTGAGG - Intergenic
1163002106 19:14375097-14375119 AAATCTTGGTGATCTCTGGGAGG + Intergenic
1164338158 19:24354026-24354048 ATATTTTGGAGTGCTTTTAGGGG + Intergenic
1166264942 19:41674567-41674589 ACATTTTGGTTAGCTCTGAGTGG + Exonic
1166273151 19:41730811-41730833 ACATACTGGTGAGCTCTGAGTGG - Intronic
1166425215 19:42671378-42671400 ATATTTTGGTGAGCTCTGAGTGG + Intronic
1166425330 19:42673019-42673041 ATATTTTGGTGAGCTCTGAGTGG - Intronic
1166430381 19:42721009-42721031 AACATTTGGTGAGCTCTTAGTGG + Intronic
1166434168 19:42753197-42753219 ACATTTTAGTGAGTTCTGAGTGG + Intronic
1166437310 19:42778524-42778546 ACATTTTAGTGAGTTCTGAGTGG + Intronic
1166447024 19:42866971-42866993 ATATTTTGGTGAGTTCTGAGTGG + Intronic
1166453949 19:42924645-42924667 ACATTTTGGTGAGTTCTGAGTGG + Exonic
1166456422 19:42943923-42943945 ACATTTTGGTGAGTTCTGAGTGG + Intronic
1166466215 19:43033193-43033215 ACATTTTGGTGAGTTCTGAGTGG + Intronic
1166472359 19:43089260-43089282 AAATGTTGGCGAGTTCTGAGTGG + Intronic
1166483491 19:43193209-43193231 ACATTTTGGTGAGTTCTGAGTGG + Exonic
1166485960 19:43212296-43212318 ACATTTTGGTGAGTTCTGAGTGG + Intronic
1166490193 19:43252654-43252676 AACATTTGGTGAGCTCTTAGTGG + Intronic
1166493118 19:43276247-43276269 ACATTTTGGTGAGTTCTGAGTGG + Intergenic
1168170899 19:54588137-54588159 GTATATGGGTGAGCTCTCAGTGG - Intronic
926331568 2:11829958-11829980 AGATCTTTGTGAGCTCTGGGCGG - Intergenic
929702423 2:44175322-44175344 AGATTTTGTTGAGCTTTGGGAGG + Intronic
931957361 2:67442312-67442334 ATATTTTTGTGACCTAAGAGTGG + Intergenic
933119386 2:78517957-78517979 ATAATAAGGTGAGCTCTGGGAGG + Intergenic
938736784 2:134193076-134193098 ATATTTTGATTGGCTCTGTGAGG + Intronic
940323317 2:152399825-152399847 ATATTTGGGTGAGTTCTATGTGG + Intronic
941633950 2:167915163-167915185 CTATTCTGATGACCTCTGAGAGG - Intergenic
942037884 2:172028654-172028676 ATATCTTGGTCATCTCTGAAAGG + Intronic
944511685 2:200471928-200471950 AGATTCTGGTGAACTGTGAGAGG + Intronic
947466654 2:230355744-230355766 ATATTTTCGTGACCTTGGAGTGG + Intronic
1170409846 20:16076853-16076875 GTAGTTTGGTGAACTCTGTGCGG + Intergenic
1172159677 20:32858254-32858276 GTATGTTGGTGTTCTCTGAGTGG + Intergenic
1172589394 20:36106505-36106527 CTATTTTGGGGAGGTTTGAGGGG + Intronic
1173307643 20:41865208-41865230 AGCTCTTGGTGAGGTCTGAGTGG + Intergenic
1174299194 20:49569174-49569196 ATAATGAGGTGAGCTCAGAGAGG - Intergenic
1179215199 21:39361470-39361492 ATATTTTGGTGGGGACTGACAGG + Intergenic
1179399688 21:41072120-41072142 AAATTTTGTTAAGCTCTGTGAGG - Intergenic
1181875083 22:25934390-25934412 ATATTCTGGTGAGTTGGGAGTGG + Intronic
1183112735 22:35662849-35662871 ACAATTTGCTGAGGTCTGAGAGG + Exonic
1183902980 22:41020402-41020424 GAATTTTGATGAGCTCTGAAGGG - Intergenic
949454271 3:4222388-4222410 ATTTTTCTGTGAGCTCTGTGAGG + Intronic
949744627 3:7275410-7275432 ATATGTTGGTAAGGTGTGAGGGG + Intronic
950884123 3:16348011-16348033 ATCCTGTGGGGAGCTCTGAGGGG + Intronic
951416768 3:22433446-22433468 AAATGTTGGTGGGATCTGAGTGG - Intergenic
952574292 3:34755989-34756011 ATATTTTGTTGAGACCTGTGAGG - Intergenic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
955389138 3:58506959-58506981 CTATTTTGGTGATCTCTAAAAGG + Intronic
957224782 3:77429480-77429502 CTATTTTGCTGGTCTCTGAGGGG + Intronic
958720304 3:97835740-97835762 AGATTCTGGGGAGCTCTGTGAGG + Intronic
959757936 3:109921711-109921733 ATTTTTTTGAGAGGTCTGAGAGG + Intergenic
960168162 3:114427706-114427728 AGATGTTGGTGAGTGCTGAGGGG - Intronic
960261503 3:115573670-115573692 ATATTTTGGTGTGCAATGACTGG + Intergenic
961211080 3:125126402-125126424 ATATTTTTGAGAGCTATAAGGGG - Intronic
961527782 3:127518031-127518053 AAATTTTGGTGAACTCTCAAAGG - Intergenic
963594073 3:147303442-147303464 GTGCTCTGGTGAGCTCTGAGGGG + Intergenic
964416860 3:156456959-156456981 AGATTTTGCTGAGCTGTGGGTGG + Intronic
965749842 3:171964612-171964634 ATATTCTTGTGAGATCAGAGAGG + Intergenic
966271874 3:178117604-178117626 ATAGGTTGGTTTGCTCTGAGTGG - Intergenic
967032272 3:185618894-185618916 ATATTTTATTTATCTCTGAGTGG - Intronic
968682621 4:1931966-1931988 ATATTTTGCTGAGTGCTTAGTGG + Intronic
968851838 4:3085995-3086017 ATATTTTACTGAGGTCTGTGTGG + Intronic
971730900 4:30378576-30378598 ATAATATGGTGAGCTATGGGGGG - Intergenic
972496183 4:39637172-39637194 ACATTTTGGTGATCTTTGGGTGG + Intronic
973754617 4:54063145-54063167 ATATTTTGGTGAAGAGTGAGTGG - Intronic
974300167 4:60054007-60054029 ATATTTTACTGTGTTCTGAGGGG + Intergenic
974324310 4:60394230-60394252 ATATTCTCATGAGGTCTGAGTGG + Intergenic
974974460 4:68872782-68872804 AAATTTTGGAGAACTCAGAGAGG - Intergenic
978290454 4:107132450-107132472 ATATAGTGGTGACCTGTGAGTGG + Intronic
980118020 4:128699807-128699829 ATCATTTGGTGACCTCTGGGAGG - Intergenic
982201300 4:152963564-152963586 ATTGTTTGGTGAGCGTTGAGGGG + Intronic
982452060 4:155564695-155564717 ATATTTTACTCAGGTCTGAGGGG - Intergenic
983494996 4:168433462-168433484 TTATGTAGGTGAACTCTGAGTGG - Intronic
983808335 4:172023127-172023149 TTATCTTGCTTAGCTCTGAGTGG + Intronic
984978712 4:185256601-185256623 AAATTTAGGTGAGCTCTCTGGGG - Intronic
985813048 5:2104257-2104279 ATATTTTGGTGCAATTTGAGAGG - Intergenic
986576012 5:9213779-9213801 AAAGTTTGCTGAGCTCTGAAAGG + Intronic
988806457 5:34745379-34745401 ATATTTTGGGGACATCTAAGTGG + Intronic
990185830 5:53208111-53208133 ATATTTTGGAGAACTCAGAAAGG + Intergenic
992742379 5:79786723-79786745 AGACTTTGGTGACATCTGAGTGG + Intronic
994686890 5:102966900-102966922 ATATTCTGGAAAGTTCTGAGAGG + Intronic
995091125 5:108178528-108178550 ATATTTTACTGAGTTCTGAGAGG - Intronic
997637878 5:135427950-135427972 AGGTTTTTGTGTGCTCTGAGAGG + Intergenic
998942137 5:147296111-147296133 ATATTTTGGAGAACTGTTAGAGG + Intronic
1003504839 6:6731971-6731993 ATATTTGGGTGAGGTCTGTCTGG - Intergenic
1003746178 6:9005022-9005044 ATATTTTAAAGAGCTCTGGGAGG - Intergenic
1004297862 6:14430600-14430622 ATATTTTGATGAGCTCAGGCTGG + Intergenic
1004746688 6:18516058-18516080 TTATTTTGATGGGCACTGAGGGG - Intergenic
1005468376 6:26137696-26137718 ATATTTGGGTGTGCAGTGAGGGG - Intronic
1008534097 6:52493735-52493757 ATTCTCTGGTGAGCTCTGACTGG + Exonic
1010176141 6:73030449-73030471 ATCCTTTGGTGAGCTTTGAGAGG - Intronic
1015370585 6:132447355-132447377 ATGTTTTGGGGACCTCTGATAGG - Exonic
1015945800 6:138499664-138499686 CTATTTTTGTGGGCTCAGAGAGG - Intronic
1016410866 6:143782722-143782744 ATATTTTGGTTGGATTTGAGTGG + Intronic
1017957882 6:159193959-159193981 ATATTTTGCTGGGGACTGAGTGG - Intronic
1018294015 6:162325975-162325997 ATGTTTTACTGAGCTCTGATTGG - Intronic
1020684906 7:11282549-11282571 ATATTTGAGTGAGTTCTGGGAGG - Intergenic
1022177797 7:27888838-27888860 ATATTTTGGCGCACTCTGGGGGG - Intronic
1023142003 7:37110903-37110925 ATTTTTTGGTAAGCTCTTTGGGG + Intronic
1026829019 7:73600348-73600370 AGATATGGGTGGGCTCTGAGTGG + Intronic
1027590137 7:80109184-80109206 ATATATTGATGTGCTCTCAGGGG - Intergenic
1028280976 7:88927369-88927391 ATATTGTGGTTTGATCTGAGAGG + Intronic
1030826981 7:114170160-114170182 CTATTATGGTGAGCTGTGATCGG + Intronic
1034005320 7:147465994-147466016 ATTTTTCAGTGAGCTTTGAGAGG - Intronic
1038957141 8:32480040-32480062 ATATTTTGGTAGGCTTTGAAAGG + Intronic
1041539657 8:58968884-58968906 GTATTTAGGTGACCACTGAGTGG + Intronic
1041646251 8:60255442-60255464 ATAAATTGGTGAGTTCTCAGAGG - Intronic
1042035850 8:64533160-64533182 CTATTTTTATGAGCTCTTAGGGG - Intergenic
1046588526 8:116177096-116177118 ATGCTTTGGTGAACTCTGATTGG + Intergenic
1046593958 8:116238650-116238672 ATATTTTGGTTACCTGTGACAGG + Intergenic
1046644070 8:116766081-116766103 ATATATTGGATAGCTATGAGTGG - Intronic
1050428138 9:5533708-5533730 ACATTTTGGTAAACTCTGAGTGG + Intronic
1053223144 9:36327987-36328009 ATATCCTGGTGAGCCCTGATGGG + Intergenic
1187930595 X:24290465-24290487 ATATCTTAGGGAGCTCTAAGTGG - Intergenic
1189001839 X:36956442-36956464 ATAATTTTGTGAGTTCTGAAGGG - Intergenic
1192792477 X:74396511-74396533 ATATTTTGAAGAGGTGTGAGAGG - Intergenic
1193401884 X:81055129-81055151 ATTTGTTGGTGCTCTCTGAGGGG - Intergenic
1193716723 X:84942554-84942576 AAATTTTGGAGAGCTCAGAAAGG + Intergenic
1194871565 X:99138995-99139017 ATATTTCTGTGAGCTCTGACTGG - Intergenic
1195464191 X:105161767-105161789 ATATTTTAGTGAGATTCGAGTGG - Intronic
1197749725 X:129956404-129956426 ATATTTTGCTGAGCTCACACAGG - Intergenic
1198163587 X:134031499-134031521 ATATTCTGATGAGCTCTGGCAGG - Intergenic
1199447646 X:147944417-147944439 ATATTTTGGTCATTTCTGAGAGG - Intronic
1199950908 X:152705387-152705409 TAATTGTGGTGACCTCTGAGGGG - Intergenic
1199958774 X:152763074-152763096 TAATTGTGGTGACCTCTGAGGGG + Intergenic