ID: 1166426421

View in Genome Browser
Species Human (GRCh38)
Location 19:42682885-42682907
Sequence TGGGACCACTTAGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166426421_1166426431 30 Left 1166426421 19:42682885-42682907 CCTGTTTTTCCTAAGTGGTCCCA No data
Right 1166426431 19:42682938-42682960 GTGGCATCAATGGTAGCAAGAGG 0: 1
1: 0
2: 2
3: 9
4: 133
1166426421_1166426427 11 Left 1166426421 19:42682885-42682907 CCTGTTTTTCCTAAGTGGTCCCA No data
Right 1166426427 19:42682919-42682941 ATTCTTTAGGTCCCTTCGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 73
1166426421_1166426428 20 Left 1166426421 19:42682885-42682907 CCTGTTTTTCCTAAGTGGTCCCA No data
Right 1166426428 19:42682928-42682950 GTCCCTTCGTGTGGCATCAATGG 0: 1
1: 0
2: 1
3: 8
4: 55
1166426421_1166426426 -2 Left 1166426421 19:42682885-42682907 CCTGTTTTTCCTAAGTGGTCCCA No data
Right 1166426426 19:42682906-42682928 CAGGCTGTTCAGAATTCTTTAGG 0: 1
1: 0
2: 0
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166426421 Original CRISPR TGGGACCACTTAGGAAAAAC AGG (reversed) Intronic
No off target data available for this crispr