ID: 1166431350

View in Genome Browser
Species Human (GRCh38)
Location 19:42730442-42730464
Sequence CAGAGAAATCACATCTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 4, 2: 4, 3: 13, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166431350_1166431358 21 Left 1166431350 19:42730442-42730464 CCCCCATAGATGTGATTTCTCTG 0: 1
1: 4
2: 4
3: 13
4: 208
Right 1166431358 19:42730486-42730508 TTCTAGAGATGAGTAATAATGGG 0: 8
1: 3
2: 1
3: 17
4: 230
1166431350_1166431354 -5 Left 1166431350 19:42730442-42730464 CCCCCATAGATGTGATTTCTCTG 0: 1
1: 4
2: 4
3: 13
4: 208
Right 1166431354 19:42730460-42730482 CTCTGCAACTTCCATTTCCAAGG 0: 2
1: 6
2: 61
3: 1078
4: 14432
1166431350_1166431357 20 Left 1166431350 19:42730442-42730464 CCCCCATAGATGTGATTTCTCTG 0: 1
1: 4
2: 4
3: 13
4: 208
Right 1166431357 19:42730485-42730507 ATTCTAGAGATGAGTAATAATGG 0: 7
1: 4
2: 0
3: 26
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166431350 Original CRISPR CAGAGAAATCACATCTATGG GGG (reversed) Intronic
901815843 1:11793127-11793149 GATAGAAATCAGACCTATGGAGG - Intronic
902879019 1:19358723-19358745 GAGAGAAATCTCATCTCTCGTGG + Intronic
902913223 1:19616884-19616906 AAGACAGATCACATTTATGGGGG - Intronic
903063894 1:20687718-20687740 CAGAGAAATCTCAGATTTGGAGG + Exonic
903224282 1:21886039-21886061 CAGAGAAGTCACAGCCATGCAGG + Intronic
903649191 1:24912783-24912805 CTGTGAAAACACATCTATTGTGG + Intronic
904114877 1:28154444-28154466 CAGAGAACTTACATCTCTCGGGG + Intronic
904984077 1:34530197-34530219 TAGATAAATCACATCTGTCGTGG - Intergenic
905127629 1:35726708-35726730 CACAGAAAACAAATCTATTGTGG + Intronic
906047400 1:42842620-42842642 CAACGAAATCAAATCTCTGGGGG - Exonic
906138091 1:43514608-43514630 GATAGAAATGACAACTATGGTGG - Intergenic
907619875 1:55966318-55966340 CAGAGAAACCACAGCTCTGCTGG + Intergenic
909832964 1:80216727-80216749 CAGAAAAATCACCTCTTTGAAGG - Intergenic
909962545 1:81864631-81864653 CAGAAAAATCAAATCCAAGGAGG - Intronic
912092010 1:106089948-106089970 CAGAAATATCACAAATATGGAGG - Intergenic
913072228 1:115310186-115310208 AAGGGAAATCACATGTATGTGGG + Intronic
913075085 1:115335428-115335450 CTGAGAAATCACTTCTGTGGTGG - Intronic
915979973 1:160414366-160414388 CAGAGGAATCACATGTGTGAAGG - Intronic
923241731 1:232092049-232092071 CAGAGAAATCAAATCTTTAAAGG + Intergenic
924352130 1:243125876-243125898 TATATAAATCACATCTATGTTGG + Exonic
924405155 1:243736552-243736574 CAGAAAAATAACAGCTATAGAGG + Intronic
924477576 1:244395304-244395326 CAGGGAGAGCACATCTGTGGGGG + Intergenic
1064291820 10:14041857-14041879 CAGAGAAAACTCAACTATGCTGG + Intronic
1064908409 10:20372615-20372637 CAGAAAAAGCCCATCTTTGGGGG - Intergenic
1068567427 10:58591438-58591460 CAGAGAAGGCACATCTTTGAAGG - Intronic
1068740966 10:60470143-60470165 CAGAAAAATCACAGAAATGGTGG + Intronic
1071374530 10:84989032-84989054 CAGAGAAATGACATTTTCGGAGG + Intergenic
1073189316 10:101639544-101639566 CTCAGGAATCACATATATGGAGG - Intronic
1073933042 10:108598731-108598753 CAGAGAAAGTACACCTATGTGGG - Intergenic
1074173274 10:110967336-110967358 CAGAGAATCAAAATCTATGGGGG - Intronic
1074218288 10:111409670-111409692 CAGTGACATCACATCTATGCAGG - Intergenic
1074877634 10:117626345-117626367 CAGAGAAACCACCTCCCTGGAGG - Intergenic
1075550517 10:123389402-123389424 CAGAGAAAGCACAGCTCTGCAGG - Intergenic
1078882729 11:15467903-15467925 TAAAAAAATTACATCTATGGAGG + Intergenic
1081959246 11:47122120-47122142 TAGAAAAATGAGATCTATGGAGG + Intronic
1082965675 11:58964185-58964207 CAGAGAAATTAAATATATTGGGG + Intronic
1086203311 11:84229246-84229268 CAGAGAAAGAAAATCAATGGAGG + Intronic
1086776631 11:90843256-90843278 CAAAGAAATCACATCTGAGGTGG - Intergenic
1087271913 11:96120629-96120651 AAAATAAATCACATCTGTGGAGG + Intronic
1087847588 11:102990928-102990950 CAGAGAAATCACCTGTTTGGTGG - Intergenic
1089574886 11:119435015-119435037 CAGTGAAATCACTCCTGTGGAGG - Intergenic
1089890525 11:121875994-121876016 TAGAGAAAAACCATCTATGGTGG - Intergenic
1090176964 11:124658749-124658771 CAGAGAAGTCACATGGAAGGAGG + Intronic
1090480985 11:127067913-127067935 CAAAGTTATCACATCAATGGTGG - Intergenic
1091369882 11:135049033-135049055 CAGAAAACTTACAACTATGGTGG + Intergenic
1093306795 12:17530134-17530156 TAGCGAAATGACATCTATTGAGG - Intergenic
1095417215 12:41990067-41990089 CAGAAAACTCACCTCTGTGGAGG + Intergenic
1096442935 12:51661254-51661276 CAGAGAAATCATTTCCATGTAGG - Intronic
1096707177 12:53429615-53429637 CAGAGAACTCACTTCCATGATGG - Exonic
1097441451 12:59613148-59613170 CAGAAAACTTACAACTATGGTGG + Intronic
1098756932 12:74375807-74375829 TAGAGAACTCACATTTATGGAGG + Intergenic
1099560217 12:84164124-84164146 CATGGAAATTACATCTTTGGGGG + Intergenic
1100792175 12:98142729-98142751 TAGAGAAATCACATTGATAGAGG - Intergenic
1110128623 13:71979074-71979096 CACAGACATCAGATCTGTGGAGG - Intergenic
1110854605 13:80282540-80282562 CAGTGAAAGCTCATCTATGCTGG + Intergenic
1111629487 13:90831643-90831665 TAGAGAAATCAGTTCTATGATGG - Intergenic
1112298939 13:98213091-98213113 CACAGGAATCACATATAGGGAGG - Intronic
1114362778 14:21993356-21993378 CAGTGAAATCACATTAGTGGAGG - Intergenic
1118453766 14:65927292-65927314 CAGAGAAATGAAATCTAGGATGG - Intergenic
1121925368 14:97922489-97922511 CATAGAAACCACATTGATGGGGG + Intergenic
1125639150 15:41215110-41215132 CAGAGAAAACATCTCTAGGGAGG - Intronic
1125690092 15:41589015-41589037 CAGGGAATCCAAATCTATGGAGG + Intergenic
1127005531 15:54565086-54565108 CAAAGAAGTGACATCTTTGGTGG - Intronic
1128605074 15:69031004-69031026 CAGAAAAATCTCATCTCTGTTGG + Intronic
1129914763 15:79259036-79259058 CAGAAAAACCAAATCTATGCAGG - Intergenic
1129995030 15:79997127-79997149 CAGACAAAACTAATCTATGGTGG + Intergenic
1131083058 15:89553299-89553321 CAGACAAATCTAACCTATGGAGG - Intergenic
1131770046 15:95727444-95727466 CAGAAAACTTACATTTATGGTGG + Intergenic
1133930105 16:10225144-10225166 CATAAATATCATATCTATGGAGG + Intergenic
1135271737 16:21075601-21075623 CAGAGAAGACACATCAAAGGAGG + Intronic
1135848401 16:25940033-25940055 GAGAGGAATCACATCCATGTGGG - Intronic
1138477583 16:57281225-57281247 CAGAAAAATCACTCCTGTGGAGG + Intronic
1139386615 16:66576749-66576771 AAAAAAAATCACATTTATGGAGG + Intronic
1141988848 16:87598413-87598435 CAGAGAAAGCTGGTCTATGGAGG + Intergenic
1142126547 16:88413449-88413471 CACAGAAAACACATCTGTGCTGG - Intergenic
1143771104 17:9169506-9169528 CAGAGAACTCACATCCAGGGAGG - Intronic
1145055531 17:19701419-19701441 GAAAGAAATCATATTTATGGAGG - Intronic
1145860161 17:28203061-28203083 CAGAGAAAAGAAAGCTATGGGGG + Intergenic
1146159624 17:30552886-30552908 CATAGAAACCACATCTCTCGGGG - Intergenic
1146772653 17:35582968-35582990 CAAAGAAAGCACATAGATGGAGG + Intronic
1150174538 17:63037436-63037458 AAGAGAAATCACAGATAAGGGGG + Intronic
1151031677 17:70747472-70747494 TACAGAATTCACATCTATAGTGG + Intergenic
1151449074 17:74186391-74186413 TAAGGAAATCACATATATGGGGG + Intergenic
1153765308 18:8368978-8369000 AAAAGAGCTCACATCTATGGAGG + Intronic
1153910862 18:9705702-9705724 CAAAAAAATTACATCCATGGAGG - Intergenic
1154111625 18:11573573-11573595 AAGAGAAAACACATTTATAGAGG + Intergenic
1157390761 18:47301436-47301458 TAGAAAAATCTCTTCTATGGTGG - Intergenic
1157760157 18:50256756-50256778 CAGCAAAATGACATCTGTGGAGG - Intronic
1158123328 18:54074710-54074732 CAGAGAAATCAATGCTCTGGAGG - Intergenic
1159055150 18:63455884-63455906 CAGAACAAGCAAATCTATGGAGG - Intergenic
1159860166 18:73639260-73639282 AAGAGAAACCACATCCAAGGTGG - Intergenic
1166406137 19:42523168-42523190 CAGAGAAAACACACCTAGTGGGG - Intronic
1166419741 19:42627112-42627134 CAGAGAAAACACACCTAGGAGGG - Intronic
1166431350 19:42730442-42730464 CAGAGAAATCACATCTATGGGGG - Intronic
1166451793 19:42908236-42908258 CAGAGAAATCACATCTAGGGGGG - Intronic
1166454238 19:42927102-42927124 CAGAGAAATCACATCTAGGGGGG - Intronic
1166464032 19:43016431-43016453 CAGAGAAATCACATCTAGGGGGG - Intronic
1166470186 19:43073014-43073036 CAGAGAAATCACATCTAGGGGGG - Intronic
1166483790 19:43195659-43195681 CAGAGAAATCTCATCTAGGGGGG - Intronic
1166490907 19:43259521-43259543 CAGAGAAATCACATATAGGGGGG - Intronic
925586392 2:5468927-5468949 TGGAGAAATCACTTCTTTGGGGG - Intergenic
926386362 2:12339322-12339344 CAGAGAAATCAAAGCTTTGAAGG + Intergenic
927808707 2:26170206-26170228 CAGAGACGCCACATCTACGGTGG - Intergenic
930740612 2:54828997-54829019 GAGAGAAAAGACAACTATGGAGG - Intronic
933389694 2:81654090-81654112 CAGAGAATCCAAATCTAAGGAGG - Intergenic
940680358 2:156777671-156777693 CAGAGAATTCACATCTAATTGGG + Intergenic
943515926 2:188886570-188886592 CAGAGATTTCTCAGCTATGGGGG + Intergenic
944183268 2:196919689-196919711 CAGAGGAAACACATTTATGTTGG - Intronic
944273627 2:197810109-197810131 CAGCCAAATCACATCTCGGGAGG - Intronic
945178639 2:207068776-207068798 CCCAGAAAAGACATCTATGGTGG - Intergenic
1168823956 20:796333-796355 CAGGGAATCCACATCTAAGGAGG + Intergenic
1169562083 20:6812533-6812555 CAGATAAAAAACATCTATGAGGG - Intergenic
1169859115 20:10132927-10132949 CAGAAAAGTAACATTTATGGAGG - Intergenic
1171112474 20:22496657-22496679 CAGAGAAAACTCATCTATGGTGG + Intergenic
1173057360 20:39628412-39628434 CAGAGCAAACACATCTATCCAGG + Intergenic
1174676292 20:52360074-52360096 CAGACAAAACTCATCTATGATGG - Intergenic
1178937084 21:36872551-36872573 CAGACACATCTAATCTATGGTGG - Intronic
1179125174 21:38583959-38583981 AAAGGAAATCACCTCTATGGAGG + Intronic
1179309746 21:40185214-40185236 CTGAGAATTGAGATCTATGGAGG + Intronic
1179962523 21:44777319-44777341 CAGGTAAATCTCATCTTTGGGGG + Exonic
1181502421 22:23324401-23324423 CAGAGAAATCACATCTGAGGAGG - Intergenic
1181919382 22:26308548-26308570 CAGAGAACTCACTTTTTTGGGGG - Intronic
1183566815 22:38621424-38621446 CAGGGAAATCGTATCTATGAAGG + Intronic
949679206 3:6493372-6493394 TAGAAAAATCACATATAAGGTGG + Intergenic
950356469 3:12414097-12414119 CAGATAAATCACTTACATGGAGG + Intronic
951193935 3:19803572-19803594 AGGAGAAATCACAGCTGTGGCGG - Intergenic
951257339 3:20465248-20465270 CAGAGAAGGCAAAACTATGGGGG - Intergenic
952438807 3:33301278-33301300 CAAAGAATTCACATGTATTGAGG - Intronic
953933042 3:47016010-47016032 CAGAAAAATCAAGTCCATGGGGG + Intergenic
958555311 3:95667212-95667234 AAGAGAAACCACATCTGGGGCGG - Intergenic
958576318 3:95953249-95953271 CCCAGAAATAACATCTATGAGGG + Intergenic
958922436 3:100122104-100122126 CAGAGAAATTAAATGCATGGAGG + Intronic
959551279 3:107661669-107661691 CAGAGAAATCACAGACAGGGAGG - Intronic
961810886 3:129521111-129521133 AGGAGAACTCACATGTATGGGGG + Intergenic
963818032 3:149855645-149855667 TAGAGAAATAACAACTTTGGGGG - Intronic
965564542 3:170099858-170099880 CAGAAAAATCAAATCTACTGTGG + Intronic
966052029 3:175630232-175630254 CAGAGAAATGAAATATATAGAGG + Intronic
968169620 3:196499503-196499525 CAGAAAAAACTCATCTATGGTGG + Intronic
968580719 4:1392583-1392605 CAGTGGAATGACATCTATAGAGG - Exonic
971731265 4:30384791-30384813 CAGGGAAATAACATCTACTGAGG - Intergenic
972696729 4:41453860-41453882 CAGAGAAATGAGATAAATGGAGG - Intronic
973703306 4:53557579-53557601 AAGAGAAGTTACATCTATTGAGG + Intronic
974967749 4:68783787-68783809 CAGGGAATTCACATTGATGGGGG - Intergenic
975664262 4:76719243-76719265 AGGAGAAATCACTTCCATGGTGG - Intronic
976239520 4:82940145-82940167 CAGAGAACTTATATCTAAGGTGG + Intronic
976732342 4:88276722-88276744 CAGGGTAATCACATCTAGCGAGG - Intronic
977563669 4:98559920-98559942 CAGGGAAGTGACATCTCTGGAGG - Intronic
978840136 4:113202274-113202296 GAGGGAAATAACATCTGTGGAGG - Intronic
978973558 4:114840410-114840432 CAAAGAAATCAGATCTAGTGTGG + Intronic
979249810 4:118554651-118554673 TATATAAATCACATCTATGTTGG - Intergenic
980637681 4:135529854-135529876 GAGCTAAATCACATTTATGGGGG + Intergenic
984057128 4:174943451-174943473 CAGGAAAATGACAACTATGGTGG + Intronic
985241478 4:187935258-187935280 CTGAGAAATGTCATTTATGGTGG - Intergenic
986080162 5:4383256-4383278 CTGAGAAATAACATTTATAGTGG - Intergenic
986441775 5:7789403-7789425 CAGGGAAATCAGCTATATGGAGG - Intronic
986548760 5:8929101-8929123 CAGAAGAATCAAATCTAGGGTGG - Intergenic
987138970 5:14926404-14926426 CAGAAAAATGACATATTTGGAGG - Intergenic
987546727 5:19320121-19320143 CAGATTAAGCACATTTATGGTGG - Intergenic
987913709 5:24184619-24184641 TACTGAAAACACATCTATGGAGG - Intergenic
990207963 5:53450626-53450648 CACAGAAATCACTGCTATGCTGG - Intergenic
992393421 5:76350182-76350204 GAGGAAAATCACATGTATGGAGG - Intronic
993036664 5:82766393-82766415 CACAGAAATCACAACTATATGGG - Intergenic
993780573 5:92061374-92061396 AAGCAATATCACATCTATGGAGG + Intergenic
993839394 5:92858363-92858385 CAGATAAATCAGAACTAGGGAGG + Intergenic
994346066 5:98687921-98687943 CAGACAAATCACAAGTAAGGAGG + Intergenic
996471631 5:123867722-123867744 CAGAAAAAACATAGCTATGGTGG + Intergenic
998908542 5:146932921-146932943 CAGAGATATTACAGCTGTGGAGG + Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1000654739 5:163862849-163862871 CAGAGAAAGCACATCTAGTTCGG + Intergenic
1001944734 5:175769827-175769849 CAGATAAATCGCATATATGCTGG - Intergenic
1001962826 5:175890528-175890550 CAGAGTAATCACCTCCATGGCGG + Intergenic
1003276721 6:4660290-4660312 CAGTGAAATCATAGCTATTGAGG - Intergenic
1003374949 6:5568275-5568297 CAGAGAAATCACTCCCATTGTGG - Intronic
1003870106 6:10395652-10395674 CAGAGAATTCATAACAATGGTGG - Intronic
1004254786 6:14053009-14053031 CAAAGAAGTCACACCAATGGAGG - Intergenic
1005368129 6:25100233-25100255 CAGAGAAGTCAGATAGATGGTGG + Intergenic
1006386599 6:33734511-33734533 CAGAGAAATAACCTCTTTAGAGG - Intronic
1008265212 6:49416752-49416774 AAGAAAAATCTCACCTATGGAGG - Intergenic
1008594741 6:53030218-53030240 CAGAGAAAACATTTCTACGGGGG - Intronic
1008680834 6:53870228-53870250 CCGAGAAATCACATGAATGGTGG - Intronic
1012456349 6:99410790-99410812 CAGAACAATCACAACTTTGGTGG - Exonic
1012498741 6:99864802-99864824 CAGACAAATGACAACTTTGGGGG + Intergenic
1013218581 6:108055178-108055200 CAGAGAAATACCATTTATGTAGG - Intronic
1015964810 6:138687770-138687792 CAGAAAAGTCAAATCTATAGAGG + Intronic
1016391447 6:143579597-143579619 CAGAGAAGGCACTTCTTTGGGGG + Intronic
1016561198 6:145396813-145396835 CAAACAAGTCACAGCTATGGTGG + Intergenic
1017298240 6:152825197-152825219 CAGAGCAAGAACTTCTATGGAGG - Intergenic
1018030873 6:159840505-159840527 CAGAGAATACACTTCTAGGGGGG - Intergenic
1018918343 6:168152554-168152576 CAGAGAATTTACAGCTATGTGGG + Intergenic
1020553900 7:9644751-9644773 CAGATCAATCAAATCTATGCTGG - Intergenic
1020901904 7:14014258-14014280 GAGAGAATTAACATCTCTGGTGG - Intergenic
1021485401 7:21162283-21162305 CACAGAAACCACAAATATGGAGG + Intergenic
1022577885 7:31516732-31516754 CAGAGAAGTCACTACTTTGGAGG - Intronic
1023144213 7:37133288-37133310 GAGGGAAATCAGATCTCTGGTGG - Intronic
1023323018 7:39020375-39020397 GAAAGAAATCACATCAGTGGTGG - Intronic
1024413519 7:49076281-49076303 GACAGAAAACACAGCTATGGAGG - Intergenic
1028443555 7:90892575-90892597 CAGAGAAATCAAATCAATATGGG + Intronic
1029989160 7:104947173-104947195 TAGAGAAGTCACATCAATAGAGG - Intergenic
1031578247 7:123441504-123441526 CAGAGAAATTTCAACTCTGGAGG - Intergenic
1034234611 7:149557012-149557034 TTGAGAAATTACATCTATAGGGG - Intergenic
1034239392 7:149598245-149598267 TTGAGAAATTACATCTATAGGGG - Intergenic
1034397368 7:150837344-150837366 CAGAGATAGCACAACTATTGGGG + Intronic
1035615971 8:1002149-1002171 CTGAGAACTCACAGCTAAGGAGG + Intergenic
1039199129 8:35068228-35068250 CAGAAAAATCTAATCTATGGTGG + Intergenic
1039208459 8:35184028-35184050 CTGAGAATTCAAATCTATGTTGG - Intergenic
1039660175 8:39452784-39452806 CAGAGAAGTAACACCCATGGAGG - Intergenic
1039703511 8:39984764-39984786 CAGAGAAATGACATCAATGCAGG + Intronic
1043467926 8:80531626-80531648 GAGAACAATGACATCTATGGTGG - Intergenic
1045831487 8:106466757-106466779 CAGAAAAATGACATCTGTTGAGG - Intronic
1047187461 8:122646864-122646886 CAGAAAAATCAGACCTACGGAGG + Intergenic
1051261100 9:15265578-15265600 TTAAGAAATCACTTCTATGGTGG - Intronic
1052887609 9:33665454-33665476 AAAAAAAATCAAATCTATGGAGG - Intergenic
1053005367 9:34600656-34600678 AAGAGAAACTAGATCTATGGAGG - Intergenic
1054733158 9:68722008-68722030 CTGAGAAATCACTTCTAGGGAGG - Intronic
1055361672 9:75497545-75497567 CAGAAAAAGCAAATTTATGGTGG - Intergenic
1057237714 9:93378443-93378465 CAAAGCAACCACATATATGGGGG - Intergenic
1059867312 9:118529997-118530019 CAGATAAATGAAAGCTATGGAGG - Intergenic
1060311606 9:122467346-122467368 CAAAAAAATCACATCCAAGGTGG - Intergenic
1061139799 9:128758814-128758836 CAGGGGAATCTCATCTGTGGTGG + Intronic
1186019559 X:5238936-5238958 CAGACAAAACACATTTATGATGG + Intergenic
1189579722 X:42393555-42393577 CACAGACATAACAACTATGGAGG - Intergenic
1192005396 X:67206645-67206667 AAGAGTAAATACATCTATGGTGG - Intergenic
1194533635 X:95079524-95079546 CAGAGAAATCCCGTGTGTGGTGG + Intergenic
1194966241 X:100291694-100291716 CAGAGAAAACACATTTAAAGGGG + Exonic
1196566547 X:117211704-117211726 CACAAAAATGAAATCTATGGAGG + Intergenic
1197331435 X:125158020-125158042 CAGAGACATCAAATTTATGGCGG + Intergenic
1200946839 Y:8850286-8850308 CAGTGAAATCTCATCTCTGCTGG - Intergenic
1202266528 Y:23024540-23024562 CAGTGAAATAACATCTCTAGTGG + Intergenic
1202419521 Y:24658283-24658305 CAGTGAAATAACATCTCTAGTGG + Intergenic
1202451265 Y:25011801-25011823 CAGTGAAATAACATCTCTAGTGG - Intergenic