ID: 1166439002

View in Genome Browser
Species Human (GRCh38)
Location 19:42794175-42794197
Sequence CTGAGAAAGAATTCGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 6, 2: 8, 3: 34, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166438996_1166439002 28 Left 1166438996 19:42794124-42794146 CCAAATAAAATGGCTCTGTTTGG 0: 3
1: 1
2: 1
3: 19
4: 200
Right 1166439002 19:42794175-42794197 CTGAGAAAGAATTCGGGACATGG 0: 1
1: 6
2: 8
3: 34
4: 185
1166438995_1166439002 29 Left 1166438995 19:42794123-42794145 CCCAAATAAAATGGCTCTGTTTG No data
Right 1166439002 19:42794175-42794197 CTGAGAAAGAATTCGGGACATGG 0: 1
1: 6
2: 8
3: 34
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166439002 Original CRISPR CTGAGAAAGAATTCGGGACA TGG Intronic
901276266 1:7993528-7993550 ATGAAAAAGAGTTCGGGAGATGG - Intergenic
902320092 1:15656227-15656249 CTGAGAAAGAAATTTGGAAAGGG + Intronic
902668769 1:17957595-17957617 CTGGGACAGAAGTCGAGACAGGG + Intergenic
905627055 1:39496028-39496050 CTGAGTGGGAATTCGGGACCTGG + Intronic
905669880 1:39784743-39784765 CTGAGTGGGAATTCGGGACCTGG - Intronic
907321504 1:53605629-53605651 CTGAGAAATCCTTCAGGACAAGG + Intronic
909153219 1:72035312-72035334 TTGAGAAAGAATTCAGGACACGG - Intronic
909402081 1:75244878-75244900 CTGAGAAAGATTTCAGAAGAAGG - Intronic
910199675 1:84686329-84686351 GTAAGAAATAATTCAGGACATGG + Intronic
911070584 1:93828992-93829014 TTGAGAAAGAACTCAGGACATGG + Intronic
912740042 1:112186169-112186191 CAGAGAGAGAATTCTGGAAATGG + Intergenic
916379113 1:164188870-164188892 TTGAATAAGAATTCGGCACAAGG + Intergenic
916621021 1:166497502-166497524 CTGAAAAAGAATTCAGAAAAAGG + Intergenic
917085259 1:171298559-171298581 CCAAGAAAGAATTCAGGACATGG + Intergenic
919483724 1:198120877-198120899 CTGTGAAAAAATTCAGGATATGG - Intergenic
919558131 1:199086787-199086809 CTGAGAAAGAAGTAGGGAAAAGG - Intergenic
919846777 1:201647792-201647814 CTGAGAGAGATGTCGGGAGAGGG - Intronic
922308314 1:224363984-224364006 CTGAGAACAAATTCGGGGAAGGG + Intronic
924331555 1:242945671-242945693 CTGAGAATGAACTGGGGGCACGG + Intergenic
924422940 1:243926094-243926116 CTGAGATAGACGTCGGGATAGGG + Intergenic
1065212760 10:23420561-23420583 ATCAGAAAGAATTCAGGTCATGG + Intergenic
1071062427 10:81588542-81588564 CTTAGAAAAAAATGGGGACAGGG - Intergenic
1071164816 10:82793372-82793394 CTGAGACAGTATTAGGGAGAGGG + Intronic
1071524388 10:86349707-86349729 CTGAGAAAGAACACCGGACAAGG + Intronic
1074837561 10:117312311-117312333 CTGAGAAATAAATAGGGACCAGG + Intronic
1074840618 10:117347081-117347103 TGGAGAAAGAATTCAGGACAGGG - Intronic
1078124871 11:8551428-8551450 CTGATAAAGAATTCAGAATAAGG - Intronic
1080754195 11:35179776-35179798 CTGAGAAAGAAGTGGGGGAATGG + Intronic
1080918106 11:36680611-36680633 TTGAAAAAGAATTCAGGACACGG - Intergenic
1081010496 11:37805603-37805625 CTGAGAAAAAATTCAAGCCAAGG + Intergenic
1082002923 11:47403594-47403616 TTGAGAAAGGATTGGGGTCAGGG + Intergenic
1082785722 11:57315307-57315329 ATGAGAAAGAATTAGGGTTAAGG - Intronic
1083650050 11:64197831-64197853 CTGATAAAGAAAGAGGGACAAGG - Intronic
1089096632 11:115925103-115925125 CTGGGAGAGAATTTTGGACAGGG + Intergenic
1091221045 11:133930281-133930303 CGGAGAAAGCATTCGGGCCACGG + Intronic
1091528105 12:1326515-1326537 TTGATAAAGAATGCTGGACAAGG - Intronic
1093303031 12:17477873-17477895 TGAAGAAAGAATTGGGGACAAGG - Intergenic
1098315831 12:69192520-69192542 TTAAGACTGAATTCGGGACATGG - Intergenic
1098958065 12:76708010-76708032 CTGAGAAGGAATACGTGACTTGG + Intergenic
1101480577 12:105092728-105092750 CCGAGAAAGAATTCAAAACATGG - Intergenic
1102138897 12:110598258-110598280 ATGAAAAAGAATTCTGGAGATGG + Intergenic
1102441035 12:112964110-112964132 CTGAGAAGGAAAGAGGGACATGG + Intronic
1102738872 12:115188222-115188244 TTGAGAAAGCATTTGGGAAAAGG + Intergenic
1102890215 12:116552841-116552863 CTGAGGAAGGAGTGGGGACAGGG + Intergenic
1104351156 12:128045036-128045058 CCGAGAAAGAATTCAGGACAAGG + Intergenic
1106725005 13:32475283-32475305 TTGAGAAAGAATTCAGGACATGG + Intronic
1107229470 13:38090869-38090891 CTGAGAAAGAGTTCAGGACATGG + Intergenic
1108397047 13:49999449-49999471 CCAAGAAAGAATTCAGGACATGG - Intronic
1109443759 13:62406811-62406833 CTGGGAGAGAATTCCGGAGAGGG + Intergenic
1109674288 13:65653652-65653674 CTGAGAAAGCATTTAGGAAACGG - Intergenic
1110638399 13:77792107-77792129 CAGATAAAGAATTCGAAACATGG + Intergenic
1110975817 13:81832807-81832829 CCAAGAAAGAATTCAGGACATGG + Intergenic
1111619020 13:90699688-90699710 CTGAGAAAGAAATTGGTACTGGG + Intergenic
1114568533 14:23649605-23649627 CTGAGAAAGACTATGGGAGAAGG - Intergenic
1117620655 14:57582873-57582895 GTGACAAAGAATTAGGCACAGGG + Intronic
1117790873 14:59340689-59340711 ATGAGAAAGATTTCTGAACAGGG - Intronic
1117938207 14:60931405-60931427 GAGAGAAATAATTGGGGACAGGG + Intronic
1118730667 14:68663869-68663891 CTGACAAAGAATTTGTGAGAGGG - Intronic
1119014184 14:71031991-71032013 CCAAGAAAGAATTCAAGACACGG + Intronic
1119137838 14:72236997-72237019 CTGAGAAAAAAATCAGAACATGG - Intronic
1119934589 14:78579830-78579852 CTGAGAAGGAATTGTGAACAGGG + Intronic
1121476816 14:94216551-94216573 GTGAGAAAGACTAGGGGACAAGG + Intronic
1126994566 15:54425975-54425997 CTGACAAAGAATTTGGAAGATGG - Intronic
1129918680 15:79298975-79298997 TTGAGAAAGAATGAGTGACAAGG - Intergenic
1129930468 15:79406399-79406421 CTGTGAGAGAATTTGGGCCAGGG + Intronic
1131907938 15:97164461-97164483 CTGAGAAAGAATTCGGTAGGTGG - Intergenic
1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG + Intergenic
1133679708 16:8109367-8109389 CCAAGAAAGAATTCATGACACGG + Intergenic
1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG + Intronic
1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136448722 16:30340099-30340121 CTGAGAATGCATTGGGGAGAGGG + Intergenic
1137562890 16:49514396-49514418 CTGAGACAGAACTGGGAACAAGG - Intronic
1138583047 16:57954013-57954035 CTGAGCAAGCATTGGAGACAGGG - Intronic
1139167190 16:64581039-64581061 TTGAGAAAGAATTCAGGACACGG - Intergenic
1141514734 16:84536260-84536282 CGGAGAAAGAATTCAGGACACGG - Intronic
1143048382 17:4101233-4101255 CTGAGAACGAATACAGGAAACGG + Intronic
1144177411 17:12720422-12720444 TCGAGAAAGAATTCAGGACAGGG - Intronic
1144342825 17:14324340-14324362 TGGAGAAAGAAGTGGGGACAAGG - Intronic
1146846405 17:36184031-36184053 CAGAGAAAGAACTGGGGACTGGG - Intronic
1149756807 17:59193388-59193410 CTGAGAAAGCATTCAATACATGG + Intronic
1149849759 17:60027446-60027468 CAGAGAAAGAACTGGGGACTGGG - Intergenic
1149860409 17:60119078-60119100 CAGAGAAAGAACTGGGGACTGGG + Intergenic
1150899831 17:69260563-69260585 CTCAGAAATATTTTGGGACAGGG - Intronic
1151442994 17:74145674-74145696 CTGGGAAAGAACTCTGGAAATGG - Intergenic
1157891082 18:51418576-51418598 TCAAGAAAGAATTCAGGACACGG - Intergenic
1158235109 18:55303546-55303568 CTAACAAAGAATTCTGGAAAAGG - Intronic
1159901043 18:74045812-74045834 CAGAGAATGAAATGGGGACATGG + Intergenic
1162456096 19:10785895-10785917 CTGAGAAAGAACTCGGGAGGTGG - Intronic
1163912414 19:20208686-20208708 CTGAGAAGGAATTCCAGAGAAGG - Intergenic
1163936494 19:20449432-20449454 CTGAGAAGGAATTCTAGAGAAGG + Intergenic
1163970650 19:20790716-20790738 CTGAGAAGGAATTCCAGAGAAGG + Intronic
1164198068 19:22990293-22990315 CTGAGAAAGAATCCTAGAAAAGG - Intronic
1164239916 19:23376863-23376885 CTGAGAAAGAATTTGAGAGGAGG - Intronic
1164317433 19:24104398-24104420 CTGAGAAAGAATTCTAGAGGAGG + Intronic
1166439002 19:42794175-42794197 CTGAGAAAGAATTCGGGACATGG + Intronic
1166474004 19:43104947-43104969 ACTAGAAAGAATTCAGGACATGG + Intronic
1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG + Intronic
1166494782 19:43291891-43291913 CTGAGAAAGAATTCAGGACATGG + Intergenic
1167064032 19:47170808-47170830 CAGAGAAAGAATTCTGAAGAGGG - Intronic
1168105353 19:54162790-54162812 ATCAGAAAGAACTCGGGACCCGG + Intronic
925323265 2:2993570-2993592 CTGAGAAAGAATTCAGGATGCGG - Intergenic
930866956 2:56131198-56131220 CTGAGAAACAGTTCAGGGCAGGG + Intergenic
932018283 2:68055603-68055625 GTGAGAAAGAAATCTGAACATGG + Intronic
932341326 2:70964363-70964385 CTGAGAACAATTTGGGGACAGGG + Intronic
933277603 2:80300685-80300707 AAGAGAAAGACTTAGGGACATGG + Intronic
933770554 2:85741516-85741538 CTGAGAGAGCATGCGGGACCTGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935556355 2:104513598-104513620 CTGAGAAAGAAGTCAGGAGTGGG - Intergenic
935693197 2:105748225-105748247 ATGAGTAAGAACTCAGGACACGG - Intronic
936079574 2:109423174-109423196 CAGAGAAAGACTTAGGGAGATGG + Intronic
936484561 2:112915105-112915127 TTGAGAAAGATTTGGGGTCAAGG + Intronic
940565520 2:155355902-155355924 CAGATAAAGAATTCAGGATATGG - Intergenic
941339960 2:164294847-164294869 CTCAGCAAAAATTCTGGACACGG - Intergenic
944145514 2:196503484-196503506 CAGAAAAAGAACTAGGGACAAGG + Intronic
944708317 2:202313007-202313029 CTGAGACAGAATGGGGGATAAGG - Intergenic
945053926 2:205851276-205851298 ATGAGAAAGAATTTGTCACAGGG + Intergenic
945671209 2:212804757-212804779 GTGAGAAAGAATTAGGGTGATGG - Intergenic
1170037202 20:12002235-12002257 ATGAGAAAGATTTCAGGACTTGG + Intergenic
1173215042 20:41073269-41073291 CTGAGAAAGAGAACGGGTCAGGG + Intronic
1174376591 20:50130117-50130139 CTGAGAAAGAACACGTGACCAGG + Intronic
1174387663 20:50197004-50197026 CTGAGAAAGAACTCAGGAGGGGG - Intergenic
1175764355 20:61582409-61582431 CTGAGAAGGACTTGCGGACAGGG - Intronic
1176046092 20:63093481-63093503 CAGGGAGAGAATTCGGGACTAGG + Intergenic
1176109380 20:63404523-63404545 CTGAGACGGAACTGGGGACACGG + Intergenic
1176969506 21:15249418-15249440 CTGAGATAGAATTCAGGGAAAGG + Intergenic
1177174678 21:17690790-17690812 GTAAGAAAGAATCCAGGACAAGG - Intergenic
1177454472 21:21317986-21318008 CTGAGAAAGACTTTTGGATAAGG + Intronic
1177933442 21:27315008-27315030 CAGAGAAAAAATTCAGGACATGG - Intergenic
1181019460 22:20091489-20091511 CTGTGAAAAAATTCAGGACTTGG + Exonic
949774714 3:7619753-7619775 CTGATAAAGAAGTTGGGACAAGG + Intronic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
950749041 3:15114318-15114340 CTGAGAAAGAATTTCAGGCAGGG - Intergenic
952651026 3:35726781-35726803 CTGAAAAAGAGTTGGGGCCAAGG - Intronic
952823934 3:37509215-37509237 CAGAGAGAGGATTAGGGACAGGG - Intronic
954254345 3:49393656-49393678 CAGAGAGAGAATTTGAGACAAGG - Intronic
955548725 3:60059622-60059644 CTGAGAAAGAATTCAGCTGAGGG - Intronic
956859030 3:73304256-73304278 CAGAGAAAGAATTGGTGTCACGG - Intergenic
957340520 3:78890320-78890342 TTGAGAGATAATTGGGGACAGGG + Intronic
959265660 3:104134095-104134117 TGCAGAAAGAATTCAGGACAGGG - Intergenic
960564653 3:119120389-119120411 CTGAGAAAGAATTCAGAACATGG + Intronic
962585265 3:136836381-136836403 CTGAGGAAGAATTGGGGCCAAGG - Intronic
965168373 3:165226630-165226652 CTAAGAAAGAATTGGTAACATGG - Intergenic
966343867 3:178956698-178956720 CCCAGAAAGAATTCTGGAGATGG - Intergenic
966521790 3:180881555-180881577 CTGAGAAAGAATTCAGGACATGG - Intronic
967516351 3:190373285-190373307 CTGAGGATGAATGAGGGACAAGG - Intronic
967761999 3:193236538-193236560 TTGAGAAAGAATCCAGGACTTGG + Intergenic
970397582 4:15684921-15684943 CTGGGAGAGAATTCAGGACCTGG - Intronic
972318474 4:37950067-37950089 GAGAGAAGGAATTTGGGACAGGG - Intronic
973082858 4:46015853-46015875 CTTAGAGAGAATGCTGGACAAGG + Intergenic
973701582 4:53542734-53542756 CTGAGTAAGAATAGGGGTCAAGG + Intronic
976502895 4:85812898-85812920 CTGAGGAAGAAATGGGGTCACGG - Intronic
979937352 4:126714955-126714977 TTGAGAAATAATTCAGGACACGG + Intergenic
982302380 4:153892846-153892868 ATGAGAATGAATTAGGGTCAAGG + Intergenic
983270584 4:165557135-165557157 CCGAGAAAGAATTTAGGACATGG + Intergenic
984192999 4:176626386-176626408 CCAAGAAAGAATTCAGAACATGG - Intergenic
985218301 4:187675996-187676018 CTGGGTAAGTATTTGGGACAGGG + Intergenic
986012143 5:3725890-3725912 CTGTGTAAGAATTGGGGGCAAGG - Intergenic
986918904 5:12661387-12661409 TAGAGAAAGAATTCAGGACATGG + Intergenic
988196495 5:28012208-28012230 TTGAGAAAGAATCCAGGACATGG - Intergenic
988196859 5:28015337-28015359 TCGAGAAAGAATTCAGGACATGG - Intergenic
988618984 5:32803155-32803177 CTGAGAAAGAATTCAGGACATGG - Intergenic
989176457 5:38532256-38532278 CTGAGAAAGAGCTCTGGACCAGG + Intronic
989591236 5:43114917-43114939 CTGGGAAAGAAGGCAGGACAGGG - Intronic
991641207 5:68755208-68755230 CTGAAAAAAATTTAGGGACAGGG + Intergenic
994229699 5:97299012-97299034 CTGAGAAAGAATTCAGGACACGG + Intergenic
997401231 5:133604371-133604393 CTGAGAAAGCATTTGGGGCTAGG + Intronic
1000353988 5:160375618-160375640 CTGAGAAATAATTTGGTCCAAGG + Intergenic
1001559282 5:172658846-172658868 CTGAAAAAGAATTGGGGGTAGGG - Intronic
1002157553 5:177294969-177294991 CTGAGAAAGAAGTCTGGCCTGGG - Exonic
1002628378 5:180550003-180550025 GTCTGAAGGAATTCGGGACAGGG - Exonic
1003499012 6:6688785-6688807 CTGAGGAAGAATTTGTGTCATGG - Intergenic
1006061410 6:31422961-31422983 CAGAGAAAGAATAGGAGACATGG + Intergenic
1007152845 6:39711646-39711668 CTTAGAAAAAATTCAGGACTGGG - Intronic
1007572213 6:42901099-42901121 CTGGGAAAAAATTCAGGACCTGG - Intergenic
1008258823 6:49339600-49339622 TTGAGAAATAATTCAGGACATGG - Intergenic
1008688775 6:53953928-53953950 CTGTGAAAGAATTCGGCCTATGG + Intronic
1009657864 6:66569111-66569133 CCGAGAAAGAATTCAGGACTTGG + Intergenic
1009875892 6:69504929-69504951 CTGGGAAAGAATGTGGAACACGG + Intergenic
1012450770 6:99350501-99350523 CTGAAAAAGGATTCGGGCCGTGG + Intergenic
1016104492 6:140145616-140145638 CCAAAAAAGAATTCAGGACATGG + Intergenic
1016310104 6:142725023-142725045 CTGAGGAAGAATTGAGGAGAAGG + Intergenic
1016526534 6:145007616-145007638 CAGAGAAGGAAGTCAGGACAGGG - Intergenic
1017782136 6:157723795-157723817 CTCAGACTGAATTAGGGACAAGG + Intronic
1019095259 6:169574706-169574728 GTGAGAAAGGGTTGGGGACAGGG - Intronic
1019888834 7:3928997-3929019 CTGAGAAAGAATAAGGAACAGGG - Intronic
1020580663 7:9995859-9995881 ATGAGAAAGAATGCAGGAGAAGG + Intergenic
1020993377 7:15230641-15230663 CTGAAAAAGACTTCTGCACAAGG - Intronic
1021210612 7:17847916-17847938 CTGAGATATTATTAGGGACAGGG + Intronic
1023343563 7:39248333-39248355 TTGAGAAAGAATTCTGATCAGGG + Intronic
1023891187 7:44393088-44393110 GTGAGGAAGAAGTGGGGACAGGG - Intronic
1026809507 7:73451043-73451065 CTGAGAGAGAACTAGGAACAGGG + Intronic
1028423599 7:90661414-90661436 CTAACAAACAATTCGGCACAAGG - Intronic
1029455864 7:100672056-100672078 CTCAGTAAGAATCCGGGACTTGG + Intergenic
1031634342 7:124083468-124083490 CTATGAAGGAATTTGGGACAAGG - Intergenic
1032992379 7:137408023-137408045 CTCAGGCAGAATTCGGAACAAGG + Intronic
1035703707 8:1657878-1657900 CCGAGAAAGAATTTACGACATGG + Intronic
1035818038 8:2562007-2562029 CAGAAAAAGAATTCAGGACACGG + Intergenic
1040801752 8:51350062-51350084 CCGAGAAAAAATTCAGGACACGG + Intronic
1043424830 8:80138249-80138271 CTGAGAAATAATTAGAGACAGGG - Intronic
1043528224 8:81119835-81119857 CTGACAAAAAATTCAGGACATGG + Intergenic
1044136440 8:88591947-88591969 TCGAGAAAGAATTCAGGACAGGG + Intergenic
1045458747 8:102408572-102408594 TTGAGGAATAATTCAGGACAAGG + Intronic
1045809165 8:106201433-106201455 CTGAGAAAGACTTGGGGAGATGG - Intergenic
1047354673 8:124109060-124109082 CTGAGAAAAAATTCAGGATATGG + Intronic
1049601295 8:143508919-143508941 CTGGAAAAGAATTTGGGAAATGG - Intronic
1049870172 8:144968760-144968782 CTGAGAAAGAATTTGTGCGAGGG + Intergenic
1050320430 9:4446804-4446826 ATGAGAAAGAATTTGGGACCAGG - Intergenic
1050856227 9:10360547-10360569 GTGAGAAAGAAGTCACGACATGG + Intronic
1052301234 9:26954975-26954997 ATGAAAAAGAAATGGGGACAGGG + Intronic
1054742822 9:68826017-68826039 CTGAGAATGGATTCAGGAAATGG - Intronic
1055920676 9:81457455-81457477 CTGTGAAAGGATTAGGAACACGG + Intergenic
1056618616 9:88191151-88191173 CTGAGAAAGCTTTCAGGCCATGG - Intergenic
1057711363 9:97448395-97448417 CTGAGAAAGAGATAGGGAAATGG - Intronic
1057988533 9:99742860-99742882 CTGATACAGATTTGGGGACAAGG + Intergenic
1185552163 X:991801-991823 CTGAGAAATAATTGAGGACAGGG - Intergenic
1186692926 X:11998347-11998369 CTTAGAAAGAATTGGGAACTTGG + Intergenic
1187358117 X:18597889-18597911 CTAAGAAATAATTCGGGGCCAGG - Intronic
1188722119 X:33535254-33535276 CTGAGAAATCATAGGGGACATGG - Intergenic
1188763122 X:34056871-34056893 CTCAGAAAGAACACGGGAGATGG + Intergenic
1190637367 X:52449319-52449341 CAGAGACAGAATTTGGGCCATGG - Intergenic
1190648663 X:52546940-52546962 CAGAGACAGAATTTGGGCCATGG + Intergenic
1190679690 X:52814480-52814502 CAGAGACAGAATTTGGGCCATGG + Intronic
1192005732 X:67210067-67210089 CTGAGAAAGAACTGGGGAAGTGG - Intergenic
1192305821 X:69958479-69958501 CTGAGAAAGAGCTCAGAACAAGG + Intronic
1192559290 X:72115135-72115157 CAGGGAAAGAAGTTGGGACATGG - Intergenic
1192626296 X:72732278-72732300 GTGAGAAAAACTTTGGGACAAGG - Intergenic
1192840753 X:74853095-74853117 TTGAGAAAGAATTCAAGACATGG + Intronic
1195476609 X:105293503-105293525 CTGACAAAGATTTGGGGAAACGG - Intronic
1196287421 X:113898543-113898565 CTGAGAAAAAATTCGGGACATGG + Intergenic
1196665139 X:118308079-118308101 CAGAGAAGGAATGAGGGACATGG + Intergenic
1199676437 X:150193785-150193807 CTGAGAAAGCTTTCTGGAAAAGG - Intergenic
1201294239 Y:12450122-12450144 CTGAGAAAGAATTCAGGACACGG - Intergenic
1202133995 Y:21641332-21641354 CTAAGAAAAAATTCTGGACCTGG - Intergenic