ID: 1166445209

View in Genome Browser
Species Human (GRCh38)
Location 19:42852684-42852706
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 5, 1: 3, 2: 4, 3: 29, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166445204_1166445209 1 Left 1166445204 19:42852660-42852682 CCTTGATCCTCTCATGACAGTAA 0: 1
1: 6
2: 5
3: 106
4: 1320
Right 1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG 0: 5
1: 3
2: 4
3: 29
4: 290
1166445203_1166445209 6 Left 1166445203 19:42852655-42852677 CCTCTCCTTGATCCTCTCATGAC 0: 8
1: 2
2: 1
3: 19
4: 222
Right 1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG 0: 5
1: 3
2: 4
3: 29
4: 290
1166445206_1166445209 -6 Left 1166445206 19:42852667-42852689 CCTCTCATGACAGTAACATGGAC 0: 1
1: 4
2: 2
3: 10
4: 77
Right 1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG 0: 5
1: 3
2: 4
3: 29
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903598425 1:24515089-24515111 ATAGACACTTTAAGAAGCACTGG + Intronic
903963008 1:27068988-27069010 ATCAACACTTTAAGAAACACTGG - Intergenic
904268945 1:29336273-29336295 GTGGACAATTTGAGAATCACTGG - Intergenic
904822194 1:33253003-33253025 ATGGACACCTTGGGAACCAAAGG + Intergenic
904905469 1:33894546-33894568 AGGGACACTCTAGGAAACCCAGG - Intronic
905063269 1:35157982-35158004 ATGAGCACTTTGGGAGACCCAGG + Intergenic
906334114 1:44913750-44913772 ATGTCCACTTTGGGAGACAGAGG - Intronic
906627280 1:47335012-47335034 ATTGACACTGTGGGAAAAAAAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907731872 1:57074355-57074377 ATGAAAACATTGGGAACCACTGG + Intronic
910401372 1:86841236-86841258 ATGGGCTCTTTAGGAAAGACAGG + Intergenic
912549177 1:110473590-110473612 AGGGCCACATTGGGAAGCACTGG + Intergenic
912700194 1:111872481-111872503 AGGCACACTTTGGGAAATGCTGG + Intronic
913087718 1:115454451-115454473 ATTGACAATTTTGGAAACAATGG + Intergenic
913492490 1:119394010-119394032 ATGGAACATTTGGGGAACACAGG - Exonic
914237710 1:145827364-145827386 ATGGAGACTTTGGGAGACTGAGG + Intronic
916448590 1:164896737-164896759 CTGTACACTTTGGGAACCAGAGG + Intronic
916724347 1:167509544-167509566 ATGGACACTGTGGGAAGAACTGG + Intronic
917667101 1:177235754-177235776 ATGCACACCTTGGAAATCACTGG - Intronic
918902584 1:190443533-190443555 ATGGACACTCTGGCAAACTGGGG + Intronic
919047506 1:192471835-192471857 ATCCAAAATTTGGGAAACACTGG - Intergenic
919091603 1:192984201-192984223 AAGGACACTGTGGGAAGAACAGG + Intergenic
919376694 1:196803588-196803610 ATGGAGACTTGGGGAGATACAGG - Intergenic
919386402 1:196928480-196928502 ATGGAGACTTGGGGAGATACAGG - Intronic
920101680 1:203520827-203520849 ATGGACACTTTGGAGCAGACAGG + Intergenic
920788994 1:209070847-209070869 ATGAACACTTGGGAAAACATGGG - Intergenic
921488640 1:215746867-215746889 ATGGAAAATTTGGGAAACACAGG + Intronic
921802929 1:219422081-219422103 ATGGAAACCTTGGGAAAAAATGG - Intergenic
922312458 1:224408058-224408080 AAAAACACTCTGGGAAACACTGG + Intronic
923472951 1:234308570-234308592 ATGGATACTCTGGGGAAGACAGG - Intronic
1063340474 10:5258551-5258573 AAGGACATTTTGGGGAAGACTGG - Intergenic
1063694524 10:8320402-8320424 ATGGATACTGTGGGTTACACAGG - Intergenic
1064243193 10:13648883-13648905 AGGACTACTTTGGGAAACACTGG - Intronic
1064389384 10:14928500-14928522 AAGGACACTATGGGAAGAACTGG + Intronic
1064717209 10:18188659-18188681 TTGGAAAATTTGGGAAATACAGG + Intronic
1064826389 10:19407268-19407290 AAGACCACTTTGGGAAACATAGG + Intronic
1066341455 10:34538313-34538335 ATGACCACTCTGGGAGACACTGG + Intronic
1068655447 10:59570494-59570516 ATTGACATCTTGTGAAACACTGG + Intergenic
1069041369 10:63699097-63699119 ATGGAGACTTTGGGAAGAGCAGG - Intergenic
1069085759 10:64137763-64137785 ATAGAAAGTTTGGGAACCACTGG + Intergenic
1071145335 10:82563014-82563036 ATGGGCAGTTTAGGAAACCCAGG + Intronic
1072616356 10:97051441-97051463 ACCGCCACTTTGGAAAACACTGG + Intronic
1072823944 10:98586840-98586862 CTCCACACTTTGGGAAACATTGG + Intronic
1073900351 10:108214256-108214278 ATCAAAACTTTGGGAAACAATGG - Intergenic
1076138502 10:128061561-128061583 ATGGAAAATTTGCAAAACACAGG - Intronic
1076365026 10:129916157-129916179 ATCTCCACTTTGGAAAACACAGG + Intronic
1078825035 11:14921566-14921588 CTTGACACTTTGGAATACACTGG - Intronic
1078963004 11:16301566-16301588 ACTGACAGTTTGAGAAACACTGG + Intronic
1079022317 11:16919264-16919286 TTGCACACTTTGGGAAACTCTGG + Intronic
1079079430 11:17403856-17403878 ATTGGCAGTTTGAGAAACACTGG + Intronic
1083183512 11:61004011-61004033 TTGGACACTGTGGGGGACACAGG + Intronic
1084595927 11:70117044-70117066 GAACACACTTTGGGAAACACTGG + Intronic
1084708214 11:70828477-70828499 ATGAACTCTGTGGGACACACTGG - Intronic
1085926023 11:81022039-81022061 ATGAATAATTTAGGAAACACTGG + Intergenic
1086186786 11:84027081-84027103 ATGGCCACTGTGGGTAACAAAGG + Intronic
1086427780 11:86703873-86703895 ATGGGCACTCTTGTAAACACAGG - Intergenic
1089321228 11:117627963-117627985 ATGGGCTCTGTGGGAAATACAGG - Intronic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1089418233 11:118311348-118311370 ATGGCTGCTGTGGGAAACACAGG + Intronic
1090487107 11:127123242-127123264 AAAAACACTCTGGGAAACACTGG - Intergenic
1090668961 11:128932969-128932991 AAGGACAGTTTGGGATACCCTGG + Intergenic
1092451591 12:8607402-8607424 TTGGACACTTAGGTAAAGACTGG - Intronic
1093882170 12:24417243-24417265 ATGGACTCTTGTGGTAACACTGG - Intergenic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1096343804 12:50827824-50827846 ATGTACAATTTGGGAAGAACTGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097492454 12:60287254-60287276 TTGGACCCTTGGGGAAGCACAGG + Intergenic
1097769792 12:63570504-63570526 GTTGTCACTTTGGGAAAAACTGG + Intronic
1097837134 12:64284335-64284357 AAGGACACTATGGGAAATTCTGG + Intronic
1097986571 12:65788706-65788728 GAAGACACTTTGGGAAACACTGG - Intergenic
1098826103 12:75298870-75298892 ATCGACAATTTGGGAAAAATAGG - Exonic
1100989047 12:100232574-100232596 TGGGCCACTTTGAGAAACACTGG + Intronic
1101233668 12:102766970-102766992 AAACACACTTTGGGAAACACTGG - Intergenic
1101795053 12:107965355-107965377 ATAGACAGTTTGAGAAGCACTGG + Intergenic
1103012073 12:117465434-117465456 GAGGGCCCTTTGGGAAACACAGG + Exonic
1105801931 13:23913255-23913277 ATGAACAGTTTGAGAAAAACCGG + Intergenic
1107032701 13:35869645-35869667 ATGCACACTTTGAGAAGCAGGGG - Intronic
1107964164 13:45584785-45584807 CTGGTCACTTGGAGAAACACAGG - Intronic
1109176128 13:59158675-59158697 ATAGATAATTTGAGAAACACTGG - Intergenic
1112581060 13:100676305-100676327 AGGCAGAGTTTGGGAAACACTGG - Intergenic
1114357202 14:21924248-21924270 ATGGAAACTTTGGGAAGGAGGGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116430463 14:44840106-44840128 ATGGGCAGTTTGAGAAACTCGGG + Intergenic
1119906665 14:78310521-78310543 CTGGTCACTTGGGGAAACAAGGG - Intronic
1120925050 14:89789316-89789338 AAGGACACTGTGGGAAACCTAGG - Intergenic
1121433537 14:93903844-93903866 ATGTGCACTTGGGGGAACACAGG - Intergenic
1121498867 14:94417637-94417659 ATGGACCCTGTGCCAAACACAGG + Intergenic
1122886476 14:104712657-104712679 ATGCACACCTGGGGAAACTCGGG - Intronic
1126238155 15:46409737-46409759 CTGAAGACCTTGGGAAACACAGG - Intergenic
1126519285 15:49572811-49572833 ATGGTCACTCAGTGAAACACAGG + Intronic
1126769670 15:52042894-52042916 ATGGAGCCTTTGAGAAATACTGG + Intronic
1127214434 15:56809841-56809863 GTGGCCACTTTGGAAAACACAGG + Intronic
1134380215 16:13717396-13717418 CTTGAAAGTTTGGGAAACACTGG + Intergenic
1137964931 16:52921385-52921407 TCCCACACTTTGGGAAACACAGG - Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138146657 16:54618810-54618832 GTACACACTTGGGGAAACACTGG + Intergenic
1138572031 16:57880880-57880902 ATGGCCACTTTGGGAAGCTGAGG - Intergenic
1143203743 17:5129397-5129419 ATGGTCACTGTGGGACCCACTGG + Intronic
1145070994 17:19807775-19807797 GTGCACAGTTTGGGAACCACGGG - Intronic
1146093203 17:29902933-29902955 ATGAACACTTTGGGAAGCCGAGG + Intronic
1146248653 17:31315774-31315796 CTGGTCACTGCGGGAAACACAGG + Intronic
1147500811 17:40961805-40961827 AAGTACACTTTGGGAAACACTGG - Intronic
1147892832 17:43729375-43729397 GTGGACACTTGAAGAAACACTGG + Intergenic
1150626798 17:66847186-66847208 AGGGACACTCTGGGAGACAGAGG - Intronic
1152213887 17:79020926-79020948 ATGGAAACTTTGGCAAGCAAGGG - Intergenic
1156769919 18:40707919-40707941 ACTTACACTTTGAGAAACACTGG - Intergenic
1157412400 18:47474225-47474247 ATGGACACTTTGCTAAGCACTGG - Intergenic
1158180015 18:54703685-54703707 AAAGAGACTTTGGGAAACAATGG - Intergenic
1158324412 18:56298563-56298585 GTGGACATGATGGGAAACACAGG + Intergenic
1158655028 18:59323077-59323099 ATGGCCACTTTGGGAGACAAAGG - Intergenic
1158806255 18:60977468-60977490 AGGGACACTTTGGGGAACCCTGG + Intergenic
1159896732 18:74003848-74003870 CTAGACACTCTGGGGAACACAGG - Intergenic
1161780309 19:6287291-6287313 TTGGAGACTATAGGAAACACTGG - Intergenic
1162277824 19:9671682-9671704 ATGGACACGTTGAGTATCACTGG - Intronic
1163992618 19:21013051-21013073 ATGTACACTTTGGGAGACCAAGG + Intergenic
1164544761 19:29151125-29151147 ATGGAGACTTTAGGAATCAAAGG + Intergenic
1164600806 19:29562132-29562154 CTGACCACTGTGGGAAACACAGG - Intronic
1166270613 19:41711285-41711307 ACTGACACATCGGGAAACACAGG - Intronic
1166432225 19:42737464-42737486 ATGGACACTTTGGGAAACACAGG + Intronic
1166435340 19:42762653-42762675 ATGGACACTTTGGGAAACACAGG + Intronic
1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG + Intronic
1166448207 19:42876650-42876672 AAGGACACTTTGGGAAACACAGG + Intronic
1166455097 19:42934142-42934164 ATGGGAACTTTGGGAAACACAGG + Intronic
1166471010 19:43079611-43079633 ATGGACACTTTGGGAAACACAGG + Intronic
1166482166 19:43183525-43183547 ATGGGCACTTTGGGAAACACAGG + Intronic
1166484649 19:43202643-43202665 ATGGGCACTTTGGGAAACACAGG + Intronic
1166491769 19:43266523-43266545 ATGGACACTTTGGGAAACACAGG + Intronic
1166495748 19:43301914-43301936 ACTGACTCTTTGGAAAACACAGG + Intergenic
1166856977 19:45787056-45787078 ATGGAAACATGGGGAAACAGAGG + Intronic
925602561 2:5624016-5624038 ATGGAGCCTTGGGGAAACAAGGG + Intergenic
925674213 2:6343085-6343107 TTGCAAACTTTGGGAATCACCGG + Intergenic
927062172 2:19433918-19433940 ATTGACAGGTTTGGAAACACTGG + Intergenic
928420141 2:31132010-31132032 CAGGTCACTTTGGGAAACAAAGG + Intronic
928905085 2:36359078-36359100 ATGGAAACTGAGGGAAACACTGG - Intronic
929271325 2:39975465-39975487 ATGGAGATCTGGGGAAACACGGG - Intergenic
929653005 2:43700898-43700920 GTGGACACTTTGGGAGGCAAAGG - Intronic
931488485 2:62718492-62718514 ATAGTCAGTTTGGGAAGCACTGG - Intronic
931923138 2:67042793-67042815 ATGCACACTTTTTGAAAAACAGG - Intergenic
932185605 2:69693024-69693046 ATGCCCAATTTAGGAAACACTGG + Intronic
932865287 2:75335149-75335171 TTGAAAAATTTGGGAAACACAGG + Intergenic
933025545 2:77253048-77253070 GTGGACACTTGGGAAAACATTGG - Intronic
933648674 2:84831832-84831854 ATGGACACTTTGGGCTGCAGGGG - Intronic
934074954 2:88420320-88420342 CCCAACACTTTGGGAAACACAGG + Intergenic
935697747 2:105784777-105784799 ATGGGAAGTGTGGGAAACACGGG - Intronic
936071932 2:109376866-109376888 ATGGAAACTTAGGGGAACAAAGG - Intronic
937434765 2:121871248-121871270 ATTGACACTTTGGGGACCCCAGG + Intergenic
937619449 2:123968734-123968756 ATCTGCAGTTTGGGAAACACTGG + Intergenic
938913660 2:135911891-135911913 AATCACACTTTGGGAACCACTGG - Intronic
939184905 2:138848977-138848999 ATGGACACTTAGGTCAACAGTGG - Intergenic
940922827 2:159328629-159328651 ATGGGCACTGTGGCAAACAGGGG - Intronic
942357307 2:175131233-175131255 GATGACACTTGGGGAAACACTGG + Intronic
942393723 2:175524240-175524262 CTGCACATTTTGGGAAATACTGG - Intergenic
942875952 2:180797956-180797978 TTAGAGAATTTGGGAAACACAGG - Intergenic
943002879 2:182351241-182351263 ATGACTACTTTGGGAAACACAGG - Intronic
943101418 2:183491623-183491645 AAGAGCACTTTGGGAAACACTGG - Intergenic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
945639386 2:212404368-212404390 AGGGACACTGTGGGAACAACGGG - Intronic
946889322 2:224259146-224259168 ATCAACCCTTTGGGAAGCACCGG + Intergenic
947771931 2:232676882-232676904 CTGGACACTTTGGGAAGCTGAGG + Intronic
1168935382 20:1660948-1660970 TTGTACACTTGGGGAAACTCAGG - Intergenic
1169926507 20:10789970-10789992 AGGGAAACTTTGGGCCACACGGG + Intergenic
1170790465 20:19504719-19504741 AGGGACACTTTGAGAAACAAAGG + Intronic
1172042302 20:32053898-32053920 GAGGACACTTTGAGAACCACTGG + Intronic
1172267203 20:33626648-33626670 ATGGAAATTTAGGGAAACCCTGG - Intronic
1173095033 20:40018219-40018241 ATGGACATTTTGCCAAACAAAGG + Intergenic
1174104901 20:48155201-48155223 ATGGACCCTCAGGGAAACAAAGG - Intergenic
1174565339 20:51460794-51460816 AGCCACACTTTGAGAAACACTGG - Intronic
1175538427 20:59732209-59732231 GAAAACACTTTGGGAAACACCGG + Intronic
1175774612 20:61645158-61645180 ATGGAAACTGTTGGCAACACAGG - Intronic
1176311644 21:5153963-5153985 AGGGCCACTGTGGGAAACACAGG + Intronic
1177440211 21:21113076-21113098 ATTGTCACTTTGAGAACCACTGG - Intronic
1178096678 21:29222871-29222893 ATGGCCCCTCTGGGAAACAGTGG + Intronic
1178712690 21:34933318-34933340 ATGTAGACATTTGGAAACACTGG - Intronic
1178796634 21:35751102-35751124 ATCCACACTTTGAGAACCACAGG - Intronic
1178953485 21:37004661-37004683 CTGCACACTTTGGGAAGCAGAGG - Intergenic
1179845406 21:44108072-44108094 AGGGCCACTGTGGGAAACACAGG - Intronic
1180260187 21:46663156-46663178 AGGGACTCTATGGGATACACTGG - Intronic
1182325456 22:29509309-29509331 ATGGGTCCTTTGGGAACCACTGG + Intronic
1185370426 22:50458451-50458473 AGGGACTCTGTGGGAAGCACAGG + Intronic
949348563 3:3100086-3100108 AAATACACTGTGGGAAACACTGG + Intronic
949349499 3:3111128-3111150 ATGGTCACCTTGGGAACCCCAGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950192712 3:10988833-10988855 ATTGACACATGGGGAAACAGAGG - Intergenic
950462333 3:13132810-13132832 CAGGAAACTTTAGGAAACACAGG + Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951867343 3:27323002-27323024 GTGCTCAGTTTGGGAAACACAGG + Intronic
952043857 3:29293678-29293700 AAGGACAATCTGGGAAAGACAGG - Intronic
952476618 3:33717673-33717695 AAACACACTTTGGGAAGCACAGG - Intronic
954596803 3:51831663-51831685 ATGGACAGCTTGGGAGACAATGG - Intergenic
954617289 3:51975689-51975711 ATGCACACTTTGAAAACCACAGG - Intronic
954797076 3:53166999-53167021 ATGGACACCGTGGGGGACACAGG - Intronic
954823407 3:53350408-53350430 AGGGACACTTTGGGAGACCCAGG - Intergenic
959398788 3:105873910-105873932 ATGGCTTCTTAGGGAAACACAGG - Intergenic
960079730 3:113528649-113528671 ATGGCCATGCTGGGAAACACTGG - Intergenic
960655099 3:119994834-119994856 ATGGACATTTTTGGAACAACTGG + Intronic
960864013 3:122182310-122182332 ATGTACACACTGGGACACACTGG + Intergenic
961058656 3:123810268-123810290 AGGGAGACTATGGGAACCACGGG - Intronic
962942198 3:140135339-140135361 GTTGACACTTTGGGAAGCTCTGG + Intronic
963353392 3:144180247-144180269 AGGGCCCTTTTGGGAAACACAGG - Intergenic
964822227 3:160783796-160783818 AAGGAGACTTTGGGAAACTCAGG - Intronic
964848924 3:161073069-161073091 GAACACACTTTGGGAAACACTGG - Exonic
965173603 3:165300847-165300869 AAGAACACTTTTGGAAACAATGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965612117 3:170555239-170555261 GTGGACAATTTGGGAAATACAGG + Intronic
965669106 3:171128250-171128272 ATTTACACTTTGAGAACCACTGG + Intronic
965737776 3:171839908-171839930 AGGGACATTTTGCAAAACACTGG - Intergenic
965911430 3:173782183-173782205 ATGGTCAATTTGGGAAAGACAGG + Intronic
966126290 3:176580578-176580600 ATGGATACTTTACGAAACAATGG - Intergenic
966719162 3:183044354-183044376 ATGGATAGTTTGAGAAGCACTGG - Intronic
966790015 3:183659054-183659076 ATGCACACTTTGGGAGACCAAGG - Intronic
967608129 3:191472362-191472384 ATGAGTCCTTTGGGAAACACTGG + Intergenic
968403379 4:317489-317511 GTGGGCACTCTGAGAAACACAGG - Intergenic
969360649 4:6661276-6661298 TTGGACACTTTGGGACAAGCAGG + Intergenic
970160936 4:13188513-13188535 ATGGAAACTGAGAGAAACACGGG + Intergenic
970624862 4:17865693-17865715 AAGTACACTTTGAGAACCACTGG - Intronic
971198232 4:24489283-24489305 GGACACACTTTGGGAAACACAGG - Intergenic
971713818 4:30150552-30150574 AAGGACACTTAGGGGAACAAGGG - Intergenic
973151880 4:46898369-46898391 ATGGCCAATTAGGGAAATACTGG - Intronic
974396590 4:61343854-61343876 AAACACACTTTGGGAAATACTGG + Intronic
974401810 4:61417548-61417570 ATAGACAGTTTGTGAAGCACTGG + Intronic
974909293 4:68097063-68097085 ATGGACATTTAGGAAAAGACAGG - Intronic
975594101 4:76031077-76031099 TCCCACACTTTGGGAAACACTGG - Intronic
975667812 4:76750735-76750757 ATCGACAATCTGAGAAACACAGG + Intronic
975868227 4:78748294-78748316 AAACACACTTTGGGAAATACTGG + Intergenic
976183843 4:82425880-82425902 ATAGACACTTTAGGCAAAACAGG + Intronic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
978259122 4:106731715-106731737 ATGGACACATGGGAATACACAGG - Intergenic
978421593 4:108539074-108539096 ATGGATACTGTGGGAAAGTCAGG - Intergenic
978740770 4:112135604-112135626 CTGGGCACTTTGTAAAACACAGG + Intergenic
979208260 4:118068671-118068693 ATGCACATTTGGGGAAACATAGG + Intronic
979290268 4:118972188-118972210 CTGTACACTTTGGGAGACAGAGG + Intronic
979901748 4:126229264-126229286 ATAGACACTCAGGGAAAAACTGG - Intergenic
983183193 4:164672326-164672348 TAACACACTTTGGGAAACACTGG + Intergenic
984066196 4:175050512-175050534 TAGGACACATTTGGAAACACTGG - Intergenic
984567886 4:181352729-181352751 ATGGACTGTGTTGGAAACACTGG - Intergenic
986909855 5:12542600-12542622 ATGGACACTTTGGGAGGCCGAGG + Intergenic
988446298 5:31289702-31289724 ATGGTGACTTGGGGACACACAGG + Intronic
988569605 5:32351174-32351196 ATCAACACTTTGGGAAACTGAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
991595743 5:68303555-68303577 AACCACACTTTGGGAACCACTGG - Intergenic
995625173 5:114068645-114068667 CTGGACCCTCTGGGAAGCACTGG - Intergenic
996334060 5:122364028-122364050 ATGGACAGTCTGGGAAACATAGG - Intronic
996409088 5:123137472-123137494 TACCACACTTTGGGAAACACTGG - Intronic
998462281 5:142318712-142318734 ATGGCCAATTTGGAAGACACTGG + Intronic
998750715 5:145318715-145318737 ATTGAGACTTTGGGAGTCACAGG - Intergenic
998801662 5:145875132-145875154 CTGGGCACTTTGATAAACACTGG - Intergenic
999839343 5:155408375-155408397 ATGGATAGTTTGGGAAGCATTGG + Intergenic
1000313751 5:160069399-160069421 GTGGCCACTTTGGGCAATACCGG - Intronic
1000652395 5:163833313-163833335 ATGTACACTTTGGGAGACCGAGG + Intergenic
1000872888 5:166599332-166599354 AAGTCCACTTTGGGAAGCACAGG - Intergenic
1002308502 5:178298401-178298423 ACACACCCTTTGGGAAACACTGG - Intronic
1003067492 6:2915984-2916006 AAAGAGACTTTGGGAAACAGAGG - Intergenic
1004447886 6:15717563-15717585 ATGGACCCTTTGGAAAAGTCTGG + Intergenic
1004582466 6:16967231-16967253 ATGAACAGATTGGGCAACACAGG - Intergenic
1005092041 6:22067393-22067415 CTTCACACTGTGGGAAACACTGG + Intergenic
1005167869 6:22946355-22946377 ATCCACAGTTTGGGAAATACTGG - Intergenic
1006477549 6:34267233-34267255 ATTGACACTTTGGGAAGCCAAGG + Intergenic
1006806415 6:36792411-36792433 ATGGAAAGTTTGAGAACCACTGG - Intronic
1008639545 6:53447582-53447604 AAGGACATTTTGAAAAACACTGG - Intergenic
1010045415 6:71437188-71437210 ATCAAAACTTTGGGAAACAATGG + Intergenic
1010341593 6:74759861-74759883 GTTCCCACTTTGGGAAACACTGG - Intergenic
1010744857 6:79549072-79549094 ACGGAGACTTTGGGAAACAGAGG - Intergenic
1014116659 6:117675050-117675072 GAGGACACTTTTGGAAACCCTGG + Intergenic
1014681132 6:124431965-124431987 AAGAAGACTTTGGGAAACAAGGG + Intronic
1016624859 6:146155195-146155217 AATGACATTTTGGGAAACAGTGG + Intronic
1016657706 6:146541165-146541187 ATGTACAGTTTGGGAAAAAAAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1021359837 7:19698415-19698437 ATGGTCACTTTGGTAACCACTGG + Exonic
1022072394 7:26929813-26929835 ATGTAAAGTTTGGGAAACATAGG + Intronic
1022295470 7:29047345-29047367 ATCAAAACTTTGGGAAACATTGG + Intronic
1022367110 7:29732276-29732298 ATTGTCACTTTGGGAAAAACTGG - Intergenic
1023567648 7:41539525-41539547 GTCGGCACTTTGGGAAGCACTGG - Intergenic
1023711776 7:43001878-43001900 ATTGACACTTTGGGAAGCCAAGG - Intergenic
1024669167 7:51576653-51576675 ATCAAAACTTTGGGAAACATTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026473304 7:70712496-70712518 ATGGAGACTTTGAGAACCACCGG - Intronic
1027474367 7:78610748-78610770 AAGCATACTTTAGGAAACACTGG + Intronic
1027480071 7:78684487-78684509 AAGGACTCTTTGGGAGCCACTGG + Intronic
1028236282 7:88365984-88366006 GTGGACACTTTGAGAAATAATGG + Intergenic
1028440393 7:90852874-90852896 ACTGACACTTTGGGTAACACAGG + Intronic
1029489101 7:100860730-100860752 ATTGACACTTTGGGGTGCACTGG + Intronic
1029489159 7:100861037-100861059 ATTGACACTTTGGGGTACACTGG + Intronic
1030640275 7:111997035-111997057 AAGGACACTTTAAGAAACAGGGG + Intronic
1033250822 7:139757402-139757424 CTAGACACTTTGGGAGGCACTGG + Intronic
1036950426 8:13133988-13134010 AGGGCCAGTTTGAGAAACACGGG - Intronic
1037474105 8:19239276-19239298 CATGACACTTTGGAAAACACAGG - Intergenic
1037967180 8:23144325-23144347 ATGGAGCCTTTGGGAGACAGGGG - Intronic
1038166341 8:25088260-25088282 ATGGAGACTTTGGGAAAACACGG + Intergenic
1038467257 8:27775293-27775315 ATGGACTATTAGGGAAATACAGG + Intronic
1040468347 8:47715913-47715935 GTAGCCACTTTGGAAAACACTGG - Intronic
1041203156 8:55471350-55471372 AGTCACACTTTGGGAAACACAGG - Intronic
1041585485 8:59512493-59512515 CTGGAAAATTTGGGGAACACAGG - Intergenic
1043694179 8:83199839-83199861 ATGGAAAATTTGAGAAACAAGGG + Intergenic
1045050138 8:98316871-98316893 ATGGACACTTTGAGAATCACTGG + Intergenic
1047411882 8:124630568-124630590 CTGGACAGTTTGAGAAGCACTGG + Intronic
1048452763 8:134548600-134548622 AAACAGACTTTGGGAAACACTGG - Intronic
1048977195 8:139679755-139679777 AGGGAAACCTGGGGAAACACAGG + Intronic
1050725309 9:8642753-8642775 ATTGACACTTTCGCAAACATGGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053044155 9:34900086-34900108 ATGGACACCGTGGGGAACTCAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056045524 9:82711581-82711603 ATGGACCCTTGTGGAAGCACTGG + Intergenic
1056116267 9:83444291-83444313 ATGGCCACTTTGGGAAAGGGCGG - Intronic
1056774456 9:89500685-89500707 TTGGTCACTTTGGGAGACATAGG - Intergenic
1057396157 9:94682379-94682401 GAGGACACTTTGAGAACCACTGG + Intergenic
1058134164 9:101288790-101288812 ATGGAAAGTTTGAGAACCACTGG + Intronic
1058625174 9:106927174-106927196 TTGGACATTTTGGGAGACATTGG - Exonic
1059168687 9:112103937-112103959 ATGTGCAGTTTGGGAACCACTGG - Intronic
1060195618 9:121621471-121621493 AGGGGAACTTTGAGAAACACAGG - Intronic
1060305180 9:122405211-122405233 AGTGGCACTTTGGGAAACAGAGG - Intergenic
1060859756 9:126944773-126944795 AGGGACACTGTGGGGAAAACTGG - Intronic
1062716281 9:138011832-138011854 AAGGACATTTTAGGGAACACTGG + Intronic
1185865979 X:3624357-3624379 AGGGGCACTGTGGGGAACACTGG + Intronic
1186863452 X:13695754-13695776 ATGTAGACTTTAGGAATCACTGG + Intronic
1187160697 X:16762826-16762848 ATTTACAGTTTGGGAAGCACTGG + Exonic
1191101969 X:56739516-56739538 ATTGACACTTGGGTAAATACAGG + Intergenic
1192200204 X:69061779-69061801 TTGGACACTTGGGGAGACAGAGG - Intergenic
1193127635 X:77886303-77886325 AACCACACTTTGAGAAACACAGG - Intronic
1193849232 X:86515617-86515639 AAAGACACTTTGGAAACCACTGG - Intronic
1194473176 X:94322920-94322942 ATGGACAGTTTGGTGAACAGGGG - Intergenic
1194582440 X:95692671-95692693 ATGACTCCTTTGGGAAACACAGG - Intergenic
1194592858 X:95821343-95821365 AATGACACTTTGAGAAATACAGG + Intergenic
1195830080 X:109047356-109047378 CAGCACACTTTGGGACACACTGG + Intergenic
1197713191 X:129686944-129686966 ATGGTCTCTTAGGGAAACAATGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199160378 X:144603058-144603080 TAGGACACTTTTGGAGACACTGG - Intergenic
1200743982 Y:6886420-6886442 CTGAACACTTTGAGAAACTCTGG + Intergenic
1200937308 Y:8749437-8749459 AGGGGCACTTTGGGAAAGGCAGG + Intergenic
1201470673 Y:14331227-14331249 AACCACACTTTGAGAAACACTGG + Intergenic
1201678525 Y:16616095-16616117 ATGGATACTTTGGTAGACTCTGG - Intergenic