ID: 1166446832

View in Genome Browser
Species Human (GRCh38)
Location 19:42865429-42865451
Sequence CAGGTCCACCTGCAGTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 12, 3: 28, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166446832_1166446837 9 Left 1166446832 19:42865429-42865451 CCAAATAACTGCAGGTGGACCTG 0: 1
1: 0
2: 12
3: 28
4: 150
Right 1166446837 19:42865461-42865483 AGGCCCTCTACAAGAGGTGGAGG 0: 5
1: 179
2: 118
3: 51
4: 150
1166446832_1166446835 3 Left 1166446832 19:42865429-42865451 CCAAATAACTGCAGGTGGACCTG 0: 1
1: 0
2: 12
3: 28
4: 150
Right 1166446835 19:42865455-42865477 AATGTCAGGCCCTCTACAAGAGG 0: 4
1: 38
2: 154
3: 100
4: 168
1166446832_1166446836 6 Left 1166446832 19:42865429-42865451 CCAAATAACTGCAGGTGGACCTG 0: 1
1: 0
2: 12
3: 28
4: 150
Right 1166446836 19:42865458-42865480 GTCAGGCCCTCTACAAGAGGTGG 0: 5
1: 178
2: 122
3: 55
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166446832 Original CRISPR CAGGTCCACCTGCAGTTATT TGG (reversed) Intronic
901899315 1:12344932-12344954 CAGAACCACATGCAGTTGTTTGG - Intronic
905708993 1:40085074-40085096 CAGGCCCGCCTGCAGTTATCCGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
910127244 1:83856627-83856649 CAGGTACTCCTGCTGTTATATGG + Intergenic
916528698 1:165635268-165635290 CAGGTTCCCCTGCAGGTATAAGG - Intronic
921074732 1:211691117-211691139 CAAGTGCCCCTCCAGTTATTCGG - Intergenic
921277001 1:213530645-213530667 CAGGTCCACCTCCTGCTATAAGG - Intergenic
922717034 1:227883183-227883205 CAGGTCAGCCTGCAGTTCCTGGG + Intergenic
924567183 1:245208666-245208688 CAGCTCCACCTGGAGATGTTGGG - Intronic
1063787533 10:9402441-9402463 CAGGCCTGCCTGCAGTTATCTGG + Intergenic
1063985240 10:11494912-11494934 CAGGCTCGCCTGCAGTTATCCGG - Intronic
1064018804 10:11793142-11793164 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1065623330 10:27606071-27606093 CAGGGTCACCCGAAGTTATTCGG - Intergenic
1074188975 10:111119444-111119466 CAAGTCCACATGCAGTTTTCTGG - Intergenic
1075476700 10:122741610-122741632 GATGTCCAAGTGCAGTTATTTGG - Intergenic
1076419632 10:130321746-130321768 CAGGCTCACCCGCAGTTATCCGG + Intergenic
1076894786 10:133305090-133305112 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1076927155 10:133497360-133497382 CAGGCCCACCCACAGTTATTCGG - Intergenic
1077305230 11:1865933-1865955 CTTGTCCACCTGCAGGTGTTGGG + Intronic
1077388335 11:2286367-2286389 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1077929108 11:6711931-6711953 CAGGCCCGCCCGCAGTTATCTGG + Intergenic
1080015243 11:27499415-27499437 CAATTCCACCTGGAATTATTCGG + Exonic
1082954145 11:58850816-58850838 CAGGCCCACCCACAGTTATCTGG + Intronic
1083349422 11:62016798-62016820 CAGGACTGCCTGCAGTTATCTGG + Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1084159228 11:67335998-67336020 GCGGATCACCTGCAGTTATTTGG - Intronic
1084164331 11:67367967-67367989 CAGGTCGACCTGCAGTCCCTAGG - Intronic
1084276108 11:68051767-68051789 CAGATCCACCTGCAGCTCTCCGG - Intergenic
1084509121 11:69592166-69592188 CATGTCCAACTGCAGTCACTGGG - Intergenic
1093356876 12:18177233-18177255 CAGGTGCCACTCCAGTTATTTGG - Intronic
1094804990 12:34081793-34081815 CAGGTCAACCTGAAATAATTGGG + Intergenic
1103148477 12:118616202-118616224 CAGGTCCACCTGCAAATGTTTGG - Intergenic
1104091642 12:125522638-125522660 AAGGTCCACCTTCAGTAGTTTGG - Intronic
1104344231 12:127981544-127981566 GAAGTTCACCTGAAGTTATTAGG + Intergenic
1104771651 12:131367726-131367748 CAGGCCCACCTGCAGACATCAGG + Intergenic
1104783869 12:131437596-131437618 CAGCTCCACCTGGAATGATTTGG + Intergenic
1104878249 12:132051731-132051753 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1105287122 13:19013533-19013555 CAGGCCCACCCACAGTTATCCGG + Intergenic
1105876139 13:24555037-24555059 CAGGCCCACCCGCAGTTATCTGG - Intergenic
1110419212 13:75286645-75286667 GAGGTCCACCTGCTGTGACTAGG + Exonic
1110553454 13:76832070-76832092 CAGGTCCACCTCCAGCTTCTAGG + Intergenic
1113344182 13:109457936-109457958 AGGGTCCAGCTGCAGTTGTTGGG - Intergenic
1113775395 13:112942126-112942148 CAGGCCCACCCGCAGTTATCTGG + Intronic
1113880322 13:113621845-113621867 CAGGCTCGCCTGCAGTTATCTGG + Intronic
1114023329 14:18501101-18501123 CAGATCCCCCTGCAGTTTTCTGG - Intergenic
1115176030 14:30562669-30562691 CAGGCCCACCCGCAGTTACCTGG + Intronic
1115821279 14:37214948-37214970 CAGGCCCACCCGCAGTTATCCGG + Intronic
1116317659 14:43417918-43417940 CATGTCCACCTGCACTTATTAGG - Intergenic
1121631911 14:95427383-95427405 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1125554602 15:40573740-40573762 CGAGTCCACCTTCAGTTCTTGGG + Exonic
1126061220 15:44784670-44784692 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1126254018 15:46603559-46603581 CAGAACCACCTGGAGTTATGTGG - Intergenic
1128882088 15:71253122-71253144 CAGATCCACCTGCAGTTGCCAGG - Intronic
1129921127 15:79319972-79319994 CAGGCCCACCCGCAGTTATCCGG - Intronic
1129931168 15:79412217-79412239 CATGTGCACCAGCAGTGATTGGG - Intronic
1132095947 15:98984986-98985008 CGGGTCCATCTGCTGTTACTGGG + Intronic
1133108153 16:3527610-3527632 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1133785950 16:8973501-8973523 CAGGTTCAAGTGCAGTTATCAGG + Intergenic
1135338034 16:21620675-21620697 CAGGTCAAACTGCAGATTTTTGG - Intronic
1139820199 16:69715058-69715080 CAGTTCCCCCTGCAGTGGTTTGG - Exonic
1143233645 17:5379194-5379216 CAGGGCCACCTTCAGCTACTGGG + Intronic
1143464465 17:7126764-7126786 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1146356098 17:32135538-32135560 CAGGCTCACCCGCAGTTATCGGG - Intergenic
1147116817 17:38306854-38306876 CAGTTCCACCTGCAAGTGTTGGG + Intronic
1147545470 17:41397963-41397985 CTGGTCCACCTGCCGTTTCTAGG + Intergenic
1148412859 17:47482748-47482770 CAGTTCCACCTGCAAGTGTTGGG - Intergenic
1153873323 18:9341112-9341134 CAGGTCCACCTGGATTTAAGTGG + Intronic
1161894076 19:7067136-7067158 CAGGCTCGCCTGCAGTTATCTGG - Intergenic
1162141666 19:8589179-8589201 CAGTTCCACCTGCAGTCAGCTGG + Intronic
1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG + Intergenic
1162785739 19:13033549-13033571 CAGGTGCCCCTTAAGTTATTGGG - Intronic
1163508174 19:17720175-17720197 CAGGTTCACCTGCAGCCACTTGG + Intronic
1163881825 19:19930386-19930408 CAGGCCTGCCTGCAGTTATCCGG - Intronic
1164083496 19:21880735-21880757 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1164955194 19:32377091-32377113 CAGGCCCGCCCGCAGTTATCTGG - Intronic
1165541198 19:36493088-36493110 CAGGCCCGCCCGCAGTTATCTGG - Intergenic
1165708096 19:37990544-37990566 ATCGTCCACCTGCAGTTATGTGG - Intronic
1166282021 19:41800487-41800509 CAGGTCCACTCGCAGTTATCCGG + Intronic
1166433977 19:42751653-42751675 CAGGTCCACCCGCAGTTATCTGG - Intronic
1166446832 19:42865429-42865451 CAGGTCCACCTGCAGTTATTTGG - Intronic
1166472157 19:43087724-43087746 CAGGTCCACCCGCAGTTATCTGG - Intronic
1167227775 19:48260090-48260112 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1167519043 19:49941395-49941417 CAGGCTCGCCTGCAGTTATCCGG + Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1168603399 19:57738701-57738723 CAGGCCCACCCGCAGTTATCCGG + Intronic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
925156659 2:1653363-1653385 CAGGTCCACCTGCCCTGAGTGGG - Intronic
930115717 2:47716700-47716722 CAGGCCCACCCGCAGTTATCCGG + Intronic
931848102 2:66225377-66225399 CAGGTTCACCTGCAGTCACCCGG + Intergenic
932672982 2:73754256-73754278 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
933928938 2:87128148-87128170 AAGGTCCACCTGCATTCATCTGG - Intergenic
934000272 2:87703934-87703956 AAGGTCCACCTGCATTCATCTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935881853 2:107573242-107573264 CAGGCTCACCCGCAGTTATCTGG + Intergenic
940357113 2:152755374-152755396 CAGGCCCGCCTGCAGTTATCCGG + Intronic
947606599 2:231490024-231490046 CAGGCCCGCCTACAGTTATCCGG - Intergenic
948334045 2:237193950-237193972 CAGCTCCACCTGCACACATTTGG + Intergenic
1176007432 20:62874037-62874059 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1176076618 20:63251343-63251365 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1176154952 20:63614592-63614614 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG + Intronic
1180447431 22:15428057-15428079 CAGATCCCCCTGCAGTTTTCTGG - Intergenic
1181044901 22:20209868-20209890 CAGGTCCACTTGCAGCTCCTGGG - Intergenic
1181598045 22:23930408-23930430 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
1184481589 22:44751456-44751478 CAGGTCCCCCTGCAGTGCTTGGG - Intronic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG + Intergenic
953059771 3:39417721-39417743 CAGGCCTGCCTGCAGTTATCCGG + Intergenic
953993237 3:47499851-47499873 CAGCTTCTCCTGGAGTTATTTGG - Intronic
955619404 3:60846609-60846631 AAAGTCCACCTACAGATATTAGG + Intronic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
963158104 3:142120987-142121009 CAGAGCCATCTGCAGATATTGGG + Intronic
964767363 3:160191677-160191699 CAGGCTCACCTGCAGTTCTAGGG - Intergenic
964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG + Exonic
967090558 3:186131296-186131318 CAGGACAACTTGCAGATATTTGG - Intronic
967303431 3:188038683-188038705 CAGGTGCACCAACACTTATTTGG + Intergenic
968050847 3:195654004-195654026 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
968104977 3:195994334-195994356 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968108562 3:196022433-196022455 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
968303272 3:197631921-197631943 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968350909 3:198051172-198051194 CAGGCCCACCCGCAGTTATCCGG + Intergenic
968729873 4:2264642-2264664 CAGGCCCACCTGCAGCCATCTGG - Intergenic
971552305 4:27973245-27973267 CACGACCAGCTGGAGTTATTTGG - Intergenic
972217134 4:36909904-36909926 CAAGTGCCACTGCAGTTATTCGG - Intergenic
974074542 4:57156705-57156727 CAGGTTCATCAGCAGTTATTTGG + Intergenic
974401448 4:61413093-61413115 CAGCTCCACCTGCAGTAACAAGG - Intronic
975377817 4:73665921-73665943 CAGGCCCACCCACAGTTATCCGG - Intergenic
978308110 4:107354293-107354315 CAGGCCCGCCCGCAGTTATCCGG - Intergenic
978443089 4:108755169-108755191 CATGTCCACTTGCAAATATTAGG + Intronic
978622408 4:110646227-110646249 CAGGACCACTTCCACTTATTAGG + Intergenic
982395117 4:154907791-154907813 CAGGTCCACCCGCAGTCATCCGG - Intergenic
982649460 4:158068738-158068760 CTGGGAGACCTGCAGTTATTGGG - Intergenic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
987515509 5:18902050-18902072 AAAGTCCACCTCCAGGTATTGGG + Intergenic
989057495 5:37379307-37379329 CAAGTTCCCCTGCAGTTGTTTGG + Exonic
991097962 5:62759404-62759426 CAGGACCACCTGCAGGACTTGGG + Intergenic
997005855 5:129815311-129815333 CAGGTCCAAGTGGAGTTAGTTGG + Intergenic
997750442 5:136339569-136339591 CAGGTCCAAGTGGAGTTAGTTGG - Intronic
998995221 5:147864188-147864210 CAGTTCCCAGTGCAGTTATTGGG - Intergenic
1002550841 5:179990503-179990525 CAGGCCCACCCGCAGTTATCTGG - Intronic
1003171452 6:3724674-3724696 CAGGGCCACCTTCAGTCACTGGG - Intronic
1004143605 6:13044672-13044694 CACCTCCACCAGCAGCTATTAGG + Intronic
1006647742 6:35526700-35526722 CTGCTCCACCTGCTGGTATTAGG + Intergenic
1008206381 6:48664267-48664289 CAGCTGCACCTGCAGGTCTTTGG - Intergenic
1009022688 6:57961384-57961406 CAAGTTCCCCTGCAGTTGTTTGG - Intergenic
1012051777 6:94355165-94355187 CAGGTGTACCTGCACTTCTTAGG + Intergenic
1013470275 6:110457960-110457982 CAGGCCTGCCTGCAGTTATCTGG + Intronic
1016842877 6:148542116-148542138 CAGGTACACCTGAATTCATTTGG - Intronic
1018280308 6:162178624-162178646 CATGTCCACCTGCAGCACTTTGG - Intronic
1019617060 7:1968636-1968658 CAGGTCCACCTGCTGTTGCGTGG + Intronic
1021898550 7:25260423-25260445 CAGAACTACCTGCAGTAATTTGG - Intergenic
1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG + Intergenic
1030606626 7:111644959-111644981 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1034269179 7:149795385-149795407 CAGGTCCAGCTGCAGGTAATGGG - Intergenic
1035324374 7:158055477-158055499 CAGGCCCACCCGCAGTTATCCGG + Intronic
1035407440 7:158608592-158608614 CAGGTCCACCGACAGATCTTAGG + Intergenic
1040833437 8:51705166-51705188 CAGGGCCCCCTTCAGTTATGTGG - Intronic
1041093487 8:54326474-54326496 CAGATCAACAAGCAGTTATTGGG - Intergenic
1041874810 8:62675755-62675777 CATGTCCACCTGCTTTTATAAGG - Intronic
1042835283 8:73074155-73074177 CAAGTCCACCTGTAATTTTTTGG + Intronic
1043978313 8:86608533-86608555 CAGGCTCACCCGCAGTTATCCGG + Intronic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1049666223 8:143844322-143844344 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1049881355 8:145066302-145066324 CAGGCCCACCCGCAGTTATCCGG + Intergenic
1052419812 9:28228225-28228247 CAGGTATTCCTGCAGTGATTTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1059092449 9:111374346-111374368 CAGGCACACCTGAAGATATTTGG - Intronic
1060972139 9:127744460-127744482 CAGGCCCACCTGCTGTACTTGGG + Intronic
1061482791 9:130905355-130905377 CAGGTCCACGTGCAGCTCGTAGG + Exonic
1061682975 9:132252571-132252593 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1062183924 9:135206317-135206339 CAGGCCTGCCTGCAGTTATTCGG - Intergenic
1062645493 9:137546002-137546024 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1203488194 Un_GL000224v1:77849-77871 CATTCCCACCTGCAGTTATCTGG + Intergenic
1203500815 Un_KI270741v1:19745-19767 CATTCCCACCTGCAGTTATCTGG + Intergenic
1196693973 X:118591165-118591187 CATGTCCACCTGCTGTTGTATGG + Intronic
1198766142 X:140080933-140080955 CAGGGCCTCCTCCAGTTTTTAGG - Intergenic
1198998671 X:142606666-142606688 CAGGTCCACCCGAAGTTGTCCGG - Intergenic
1200412665 Y:2876970-2876992 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1201308993 Y:12577444-12577466 CAAGTCCCACTCCAGTTATTTGG - Intergenic
1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG + Intergenic
1201748382 Y:17405392-17405414 CAGGACCACCCGCAGTTATTTGG + Intergenic