ID: 1166454238

View in Genome Browser
Species Human (GRCh38)
Location 19:42927102-42927124
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 4, 1: 3, 2: 3, 3: 16, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166454238_1166454243 -5 Left 1166454238 19:42927102-42927124 CCCCCCTAGATGTGATTTCTCTG 0: 4
1: 3
2: 3
3: 16
4: 163
Right 1166454243 19:42927120-42927142 CTCTGCAACTTCCATTTCCAAGG 0: 2
1: 6
2: 61
3: 1078
4: 14432
1166454238_1166454247 21 Left 1166454238 19:42927102-42927124 CCCCCCTAGATGTGATTTCTCTG 0: 4
1: 3
2: 3
3: 16
4: 163
Right 1166454247 19:42927146-42927168 TTCTAGAGATGAGTAATAATGGG 0: 8
1: 3
2: 1
3: 17
4: 230
1166454238_1166454246 20 Left 1166454238 19:42927102-42927124 CCCCCCTAGATGTGATTTCTCTG 0: 4
1: 3
2: 3
3: 16
4: 163
Right 1166454246 19:42927145-42927167 ATTCTAGAGATGAGTAATAATGG 0: 7
1: 4
2: 0
3: 26
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166454238 Original CRISPR CAGAGAAATCACATCTAGGG GGG (reversed) Intronic
900824762 1:4917504-4917526 CAGGGAAATGACTTCTAGGAAGG + Intergenic
901830232 1:11887640-11887662 CAGAGAACTCACCTCTGGGAGGG + Intergenic
904336185 1:29799990-29800012 CAGAGAACTCCCCTCTAGAGAGG + Intergenic
905577071 1:39053619-39053641 CAGCTAAATCACAACTAGGAAGG + Intergenic
907490681 1:54806987-54807009 CAGAGATGTCAAACCTAGGGAGG - Exonic
909962545 1:81864631-81864653 CAGAAAAATCAAATCCAAGGAGG - Intronic
911436079 1:97859567-97859589 AAGAGAACTTACATATAGGGTGG - Intronic
911728196 1:101264561-101264583 CAGTGAAATCTCCTCTAGTGGGG + Intergenic
913075085 1:115335428-115335450 CTGAGAAATCACTTCTGTGGTGG - Intronic
915766006 1:158363329-158363351 AAGAGAAATTCCATCAAGGGAGG + Intergenic
916349030 1:163827849-163827871 GAGAGAATTCACATCTGGGTTGG - Intergenic
916865777 1:168856631-168856653 TATTGAAATCACATCTAGAGTGG - Intergenic
918138736 1:181701974-181701996 CAGAGAAAGAGCATCTAGGATGG + Intronic
918261686 1:182801911-182801933 CTGATAAATGACAGCTAGGGAGG - Intronic
919839758 1:201600238-201600260 CAGAGAAAGCAAGTCAAGGGAGG - Intergenic
920850977 1:209627634-209627656 CAGAGGACACACATCCAGGGAGG + Intronic
1065118655 10:22506820-22506842 CCGAGAAATCACACCTTGGAGGG + Intergenic
1068913601 10:62405081-62405103 CACTGAAATCACATTCAGGGAGG - Intronic
1071374530 10:84989032-84989054 CAGAGAAATGACATTTTCGGAGG + Intergenic
1071480307 10:86060488-86060510 GTGAGAGATCACATCCAGGGAGG + Intronic
1074218288 10:111409670-111409692 CAGTGACATCACATCTATGCAGG - Intergenic
1075080375 10:119379505-119379527 AAGAGAAATCCTTTCTAGGGGGG + Intronic
1080446933 11:32346000-32346022 CAGAGAGATGAGATCAAGGGGGG + Intergenic
1080694511 11:34589932-34589954 CACAGAAATCAATTCTAGGTGGG - Intergenic
1080768767 11:35321290-35321312 CAGCCAAACCACATCAAGGGTGG + Intronic
1085054899 11:73397843-73397865 CAGAGAAGGCACTGCTAGGGAGG + Intergenic
1085339921 11:75724394-75724416 AATAGAGACCACATCTAGGGAGG + Intronic
1086776631 11:90843256-90843278 CAAAGAAATCACATCTGAGGTGG - Intergenic
1087115436 11:94519833-94519855 CAGAGAATTAGCATCTAGAGAGG + Intergenic
1087847588 11:102990928-102990950 CAGAGAAATCACCTGTTTGGTGG - Intergenic
1088768380 11:113008277-113008299 CAGAATAATCACAGATAGGGGGG + Intronic
1090176964 11:124658749-124658771 CAGAGAAGTCACATGGAAGGAGG + Intronic
1091876767 12:3941175-3941197 CAGAGAAACCACTTTTAGAGTGG - Intergenic
1091985384 12:4906949-4906971 CAAGGAACTCACATCTAGGTAGG + Intergenic
1092830739 12:12442075-12442097 CAGGGAAACCACACCTGGGGAGG - Intronic
1093682755 12:22021832-22021854 CAGAGAAATTACATCAAGTTTGG - Intergenic
1095371686 12:41475099-41475121 CCTAGAAATCACTTCTAGGTAGG - Intronic
1098756932 12:74375807-74375829 TAGAGAACTCACATTTATGGAGG + Intergenic
1099272322 12:80526128-80526150 CAGAGAAAGCACAGATAGGATGG - Intronic
1101170487 12:102087521-102087543 GAGAGAAATCACATTTAGCAGGG + Intronic
1101293351 12:103394810-103394832 CAGAGAAATTCCATCCAGTGTGG + Intronic
1108465801 13:50714305-50714327 AAGAGAATTCACCACTAGGGTGG - Intronic
1108545879 13:51492829-51492851 GAGAGAATTTACATCTTGGGTGG + Intergenic
1109259270 13:60124024-60124046 AAGACACATCACATCTAGGTAGG + Intronic
1111756255 13:92399396-92399418 CATAGAAATCAAATCTAGAAGGG + Intronic
1112298939 13:98213091-98213113 CACAGGAATCACATATAGGGAGG - Intronic
1113595974 13:111533199-111533221 GAAAGAAATCTCATCTAGGCTGG - Intergenic
1118453766 14:65927292-65927314 CAGAGAAATGAAATCTAGGATGG - Intergenic
1122017454 14:98808334-98808356 CAGACAAATGACAGCCAGGGCGG + Intergenic
1122372134 14:101234671-101234693 CAGAGAATCCCCCTCTAGGGTGG + Intergenic
1124991561 15:34679280-34679302 CAGACAAGTAACATCTAGTGAGG - Intergenic
1125639150 15:41215110-41215132 CAGAGAAAACATCTCTAGGGAGG - Intronic
1127674760 15:61228772-61228794 CAGAAAAATCAAAGCCAGGGGGG + Intronic
1127765800 15:62184906-62184928 CAGAGTAATCAAATGTTGGGAGG - Intergenic
1127771303 15:62233135-62233157 CAAAGAAATCTTTTCTAGGGAGG - Intergenic
1128840128 15:70843409-70843431 AAGAGAAGTTACCTCTAGGGAGG - Intronic
1129016225 15:72471652-72471674 CAGAGAAAGCAGATCAAGGTAGG - Intergenic
1130788519 15:87126522-87126544 CAGTGAAATCACACCTGGGTTGG + Intergenic
1133187288 16:4109079-4109101 GTGAGAAATCTTATCTAGGGTGG - Intronic
1135271737 16:21075601-21075623 CAGAGAAGACACATCAAAGGAGG + Intronic
1137699332 16:50485016-50485038 CACAGAAATCAGCTTTAGGGTGG + Intergenic
1138423905 16:56917618-56917640 GAGAGAAATGAGATCTGGGGTGG + Intergenic
1143771104 17:9169506-9169528 CAGAGAACTCACATCCAGGGAGG - Intronic
1146912360 17:36657022-36657044 CAGAGACCACACATCTAGGAAGG - Intergenic
1148227298 17:45907881-45907903 CAGAGATTTCACAGCTGGGGAGG + Intronic
1150174538 17:63037436-63037458 AAGAGAAATCACAGATAAGGGGG + Intronic
1156197053 18:34786419-34786441 CAGGAAATTTACATCTAGGGAGG + Intronic
1159860166 18:73639260-73639282 AAGAGAAACCACATCCAAGGTGG - Intergenic
1162520173 19:11174929-11174951 GAGAGAAATTATATCCAGGGTGG - Intronic
1162754959 19:12852319-12852341 CAGATGCACCACATCTAGGGAGG - Exonic
1164332541 19:24273393-24273415 GGGAGACATCACATCTAGGCAGG - Intergenic
1164787009 19:30941510-30941532 CAGAGAAATCACTAGGAGGGAGG - Intergenic
1165574558 19:36802995-36803017 CAGAGAAATGGTCTCTAGGGAGG - Intergenic
1166276967 19:41760841-41760863 CACAGAAAATACAGCTAGGGGGG + Intronic
1166406137 19:42523168-42523190 CAGAGAAAACACACCTAGTGGGG - Intronic
1166419741 19:42627112-42627134 CAGAGAAAACACACCTAGGAGGG - Intronic
1166431350 19:42730442-42730464 CAGAGAAATCACATCTATGGGGG - Intronic
1166431726 19:42733447-42733469 CAGAGAAAACATACCTCGGGCGG - Intronic
1166434844 19:42758662-42758684 CAGAGAAAACATACCTTGGGCGG - Intronic
1166451793 19:42908236-42908258 CAGAGAAATCACATCTAGGGGGG - Intronic
1166454238 19:42927102-42927124 CAGAGAAATCACATCTAGGGGGG - Intronic
1166464032 19:43016431-43016453 CAGAGAAATCACATCTAGGGGGG - Intronic
1166464406 19:43019433-43019455 CAGAGAAAACATACCTTGGGGGG - Intronic
1166470186 19:43073014-43073036 CAGAGAAATCACATCTAGGGGGG - Intronic
1166483790 19:43195659-43195681 CAGAGAAATCTCATCTAGGGGGG - Intronic
1166484154 19:43198658-43198680 CAGAGAAAACATACCTCGGGGGG - Intronic
1166490907 19:43259521-43259543 CAGAGAAATCACATATAGGGGGG - Intronic
1167685350 19:50952620-50952642 CAGAGCACCCACATCCAGGGGGG + Exonic
927808707 2:26170206-26170228 CAGAGACGCCACATCTACGGTGG - Intergenic
929879659 2:45824766-45824788 CAGAAAACTCACATAAAGGGAGG - Intronic
931103815 2:59032318-59032340 AGGAGAAATTACAGCTAGGGAGG - Intergenic
931578540 2:63746970-63746992 GAGAGACATCACATGTAGGCAGG - Intronic
933389694 2:81654090-81654112 CAGAGAATCCAAATCTAAGGAGG - Intergenic
933598097 2:84302942-84302964 CAGAGTAGTCAATTCTAGGGAGG + Intergenic
936648757 2:114402485-114402507 CAAGGAAATCACACCTAGGTAGG - Intergenic
936686726 2:114836405-114836427 GGGAGAAATCACATTTCGGGAGG + Intronic
939319641 2:140601626-140601648 CACAGAACCCACATCTAGTGGGG + Exonic
940680358 2:156777671-156777693 CAGAGAATTCACATCTAATTGGG + Intergenic
941189235 2:162356237-162356259 CAAAGTACTCACATCTAGTGAGG - Intronic
944273627 2:197810109-197810131 CAGCCAAATCACATCTCGGGAGG - Intronic
1168823956 20:796333-796355 CAGGGAATCCACATCTAAGGAGG + Intergenic
1169274703 20:4225760-4225782 AAGAGAACTCACATCTGGGAAGG + Intronic
1169303872 20:4471372-4471394 CAGAGAACCCTCATCTTGGGAGG + Intergenic
1170786883 20:19475040-19475062 CATAAAAATCACATCCAGGCTGG + Intronic
1171112474 20:22496657-22496679 CAGAGAAAACTCATCTATGGTGG + Intergenic
1181502421 22:23324401-23324423 CAGAGAAATCACATCTGAGGAGG - Intergenic
949679206 3:6493372-6493394 TAGAAAAATCACATATAAGGTGG + Intergenic
955440745 3:58952351-58952373 GGGAGAATTCACATCCAGGGTGG - Intronic
955548249 3:60055261-60055283 CAGGGAAGTGACATCTAGAGTGG + Intronic
955713874 3:61808439-61808461 CAGATAAATCATATGTAGGTGGG + Intronic
958555311 3:95667212-95667234 AAGAGAAACCACATCTGGGGCGG - Intergenic
958985352 3:100774345-100774367 CAGAGTAAACACATGTGGGGTGG + Intronic
959551279 3:107661669-107661691 CAGAGAAATCACAGACAGGGAGG - Intronic
960553068 3:118997626-118997648 CTCAGACAGCACATCTAGGGTGG + Intronic
965084704 3:164080070-164080092 CAAATTAATCTCATCTAGGGAGG - Intergenic
965564542 3:170099858-170099880 CAGAAAAATCAAATCTACTGTGG + Intronic
966845862 3:184129222-184129244 CACAGCAATTACCTCTAGGGGGG + Intergenic
968169620 3:196499503-196499525 CAGAAAAAACTCATCTATGGTGG + Intronic
969979561 4:11140772-11140794 CAGACAAATCCCACCTAGAGTGG - Intergenic
970211469 4:13714532-13714554 CAAAGAAAACTCATATAGGGAGG + Intergenic
971731265 4:30384791-30384813 CAGGGAAATAACATCTACTGAGG - Intergenic
976239520 4:82940145-82940167 CAGAGAACTTATATCTAAGGTGG + Intronic
976732342 4:88276722-88276744 CAGGGTAATCACATCTAGCGAGG - Intronic
977650773 4:99466667-99466689 CAGAAAAACCACATTTAGGCTGG + Intergenic
978697672 4:111602090-111602112 CAGAAAAATTACATATAGGTTGG + Intergenic
978973558 4:114840410-114840432 CAAAGAAATCAGATCTAGTGTGG + Intronic
980188332 4:129491078-129491100 CACAGAACTCACATCTAGTTGGG - Intergenic
980237503 4:130128445-130128467 TAGAGAGATCACATCTGGTGAGG - Intergenic
981965199 4:150591752-150591774 AAAAGAGAACACATCTAGGGAGG + Intronic
982283080 4:153705955-153705977 CAGAGAAGTGACAGCTAGGTAGG - Intergenic
983820132 4:172182639-172182661 CAAAGCAATCATTTCTAGGGGGG + Intronic
986548760 5:8929101-8929123 CAGAAGAATCAAATCTAGGGTGG - Intergenic
988897573 5:35694260-35694282 GAGAGAAAACACACATAGGGAGG - Intronic
989204868 5:38800423-38800445 CAGAGACATCACATAGTGGGTGG - Intergenic
989318467 5:40108327-40108349 CATACAAATGACATCTTGGGTGG + Intergenic
990441348 5:55848624-55848646 CAGAGATATAACATCAAGGATGG - Intergenic
993044788 5:82854778-82854800 CAGATAAAGGACATGTAGGGTGG + Intergenic
993839394 5:92858363-92858385 CAGATAAATCAGAACTAGGGAGG + Intergenic
994346066 5:98687921-98687943 CAGACAAATCACAAGTAAGGAGG + Intergenic
995528793 5:113072731-113072753 GATAGAAATCACCCCTAGGGTGG - Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1000654739 5:163862849-163862871 CAGAGAAAGCACATCTAGTTCGG + Intergenic
1001148213 5:169203294-169203316 CCAAGAAAACATATCTAGGGTGG + Intronic
1001962826 5:175890528-175890550 CAGAGTAATCACCTCCATGGCGG + Intergenic
1003232722 6:4269249-4269271 CCGAGGAATCACATCTGGTGAGG - Intergenic
1003840682 6:10116133-10116155 TAGGGAAATAAAATCTAGGGAGG + Intronic
1008594741 6:53030218-53030240 CAGAGAAAACATTTCTACGGGGG - Intronic
1008680834 6:53870228-53870250 CCGAGAAATCACATGAATGGTGG - Intronic
1010115968 6:72311712-72311734 AATAAAAATCACATTTAGGGAGG + Intronic
1010947350 6:81991785-81991807 CAGAGAAATCAAAACTGGGCTGG + Intergenic
1012150965 6:95751909-95751931 CACAAAAATCACAGCTAGAGAGG + Intergenic
1018030873 6:159840505-159840527 CAGAGAATACACTTCTAGGGGGG - Intergenic
1019068219 6:169320613-169320635 CAGAGCTATCAGACCTAGGGAGG - Intergenic
1021009599 7:15444941-15444963 CAGGGAGCTGACATCTAGGGAGG + Intronic
1024196516 7:47064339-47064361 GAGAAAAATAAGATCTAGGGTGG - Intergenic
1032236077 7:130124479-130124501 CAGAGGATTTACATCTTGGGAGG + Exonic
1032881212 7:136092508-136092530 AAGAGAGAGCACATGTAGGGAGG + Intergenic
1034773901 7:153806304-153806326 CAGAGAAATTACATCTGGATAGG - Intergenic
1035615971 8:1002149-1002171 CTGAGAACTCACAGCTAAGGAGG + Intergenic
1036294653 8:7526255-7526277 CAGAGAGATCACAGTGAGGGAGG - Intergenic
1036327909 8:7794736-7794758 CAGAGAGATCACAGTGAGGGAGG + Intergenic
1039199129 8:35068228-35068250 CAGAAAAATCTAATCTATGGTGG + Intergenic
1039703511 8:39984764-39984786 CAGAGAAATGACATCAATGCAGG + Intronic
1043409753 8:79981766-79981788 CAAGGAAATCACATCAAGGAAGG + Intronic
1043467010 8:80519338-80519360 CAGATAAATCACAGCCAGGAGGG + Exonic
1044762355 8:95534816-95534838 TAGAGAAGTCACATTTTGGGGGG + Intergenic
1045513984 8:102840899-102840921 CATAGATATCATATCTTGGGAGG - Intronic
1045775935 8:105802434-105802456 GAAAGATATCACATCTTGGGTGG - Exonic
1047137639 8:122098624-122098646 CATAGAAATCACTTCTAGCAAGG + Intergenic
1047187461 8:122646864-122646886 CAGAAAAATCAGACCTACGGAGG + Intergenic
1048629823 8:136230299-136230321 CAGAGAAATCTCCTTTAGGTGGG + Intergenic
1054733158 9:68722008-68722030 CTGAGAAATCACTTCTAGGGAGG - Intronic
1056508938 9:87284412-87284434 CAGAGGGATTATATCTAGGGGGG - Intergenic
1057003154 9:91531523-91531545 GAGAGAAAGCATATATAGGGTGG + Intergenic
1058362792 9:104170161-104170183 CAGAGAAATGACTACTAGGTAGG - Intergenic
1060080830 9:120643143-120643165 AGAAGAAATCACATCCAGGGAGG + Intronic
1060311606 9:122467346-122467368 CAAAAAAATCACATCCAAGGTGG - Intergenic
1187082792 X:16008806-16008828 CAGAAAGCTCACATCTAGTGAGG - Intergenic
1189993772 X:46619658-46619680 CAGAGCAATTACATTTGGGGAGG + Intronic
1190018528 X:46850735-46850757 CAGAGAAGGGACATCTGGGGCGG - Intronic
1190323476 X:49191920-49191942 CAGAAAAATCACCTCTGGCGGGG + Intronic
1192990835 X:76454420-76454442 CAGAGAATTCATAGGTAGGGTGG - Intergenic
1193635333 X:83943505-83943527 CAGAGACAACTCAGCTAGGGGGG + Intergenic
1194663753 X:96655369-96655391 CAGAGAAAAGACACCTAGAGTGG + Intergenic
1194966241 X:100291694-100291716 CAGAGAAAACACATTTAAAGGGG + Exonic
1197331435 X:125158020-125158042 CAGAGACATCAAATTTATGGCGG + Intergenic
1200226407 X:154420114-154420136 CAGAGAGATGGCATCTGGGGTGG + Intronic
1200312636 X:155094504-155094526 CCAAGAAATCACATAAAGGGAGG + Intronic
1200839929 Y:7770972-7770994 CATTGTAATCACACCTAGGGTGG - Intergenic