ID: 1166459573

View in Genome Browser
Species Human (GRCh38)
Location 19:42974373-42974395
Sequence ATGGGGATGGAGAATTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 2, 1: 1, 2: 5, 3: 50, 4: 541}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166459573_1166459580 -6 Left 1166459573 19:42974373-42974395 CCATTCCAATTCTCCATCCCCAT 0: 2
1: 1
2: 5
3: 50
4: 541
Right 1166459580 19:42974390-42974412 CCCCATGCTGAGGAGGCTGGAGG 0: 3
1: 0
2: 5
3: 41
4: 383
1166459573_1166459578 -9 Left 1166459573 19:42974373-42974395 CCATTCCAATTCTCCATCCCCAT 0: 2
1: 1
2: 5
3: 50
4: 541
Right 1166459578 19:42974387-42974409 CATCCCCATGCTGAGGAGGCTGG 0: 3
1: 0
2: 1
3: 37
4: 387
1166459573_1166459583 14 Left 1166459573 19:42974373-42974395 CCATTCCAATTCTCCATCCCCAT 0: 2
1: 1
2: 5
3: 50
4: 541
Right 1166459583 19:42974410-42974432 AGGATTCAGAATGCAGAATCAGG 0: 3
1: 0
2: 1
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166459573 Original CRISPR ATGGGGATGGAGAATTGGAA TGG (reversed) Intronic
903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG + Intronic
903381938 1:22903251-22903273 ATGGGGATAGAGGACAGGAATGG - Intronic
903589571 1:24444361-24444383 AAGGGGATGGAAAAGTGGAAAGG + Intronic
903691045 1:25173870-25173892 CTGGGGATGGGGAATTGGTTGGG - Intergenic
903785966 1:25861601-25861623 TTGCAGATGGAGAATAGGAAGGG - Exonic
903827408 1:26156105-26156127 TTGGGGATGGAGATCGGGAATGG - Intergenic
903958532 1:27041586-27041608 ATGGGGATGAAGAGATTGAAAGG - Intergenic
904123814 1:28222143-28222165 ATGAGGATGGATAATAGTAATGG + Intronic
904162954 1:28534947-28534969 ATGGGGATGGAGAAGTGGGCAGG - Intronic
904398121 1:30236649-30236671 AGCAGGATGGGGAATTGGAAGGG + Intergenic
904608703 1:31713566-31713588 ATGGGGAAGGGGAATGGGAGTGG + Intergenic
904768538 1:32868783-32868805 GTGGTGATGGAGAAATAGAAAGG - Intronic
905225468 1:36475813-36475835 ATGGGGACGGAGACTTCGAGAGG + Intronic
905256471 1:36688566-36688588 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256492 1:36688620-36688642 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256513 1:36688674-36688696 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256612 1:36688944-36688966 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256635 1:36689008-36689030 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905912925 1:41666042-41666064 ATGGGGATGGAGGATGGAGAGGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906608057 1:47184783-47184805 AAGGGGACGGAGACTTGGTAGGG - Intronic
907654376 1:56327405-56327427 ATGGGGATGGAGATGTGAATGGG + Intergenic
907879311 1:58530375-58530397 ATGGGTATGGAGAGTTAGAAGGG - Intronic
908333475 1:63096041-63096063 ATGGGGATGGACAATGGGAATGG + Intergenic
909094501 1:71270826-71270848 AGTGGGATGGAGAGCTGGAAAGG + Intergenic
910488900 1:87746353-87746375 AGTGGGATGGGGAACTGGAAAGG - Intergenic
911017764 1:93352576-93352598 ATGGGCATGTAGATTTGTAAAGG + Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911132555 1:94404638-94404660 AAGGGGATGCAGAAATAGAATGG - Intergenic
911168399 1:94745411-94745433 ATGGGGATGGGGAGTAGGGATGG + Intergenic
911169575 1:94756802-94756824 ATAGGGATGGACCATTGGAGAGG - Intergenic
913057896 1:115179117-115179139 TTGGGGGAGGAGAATTGGGAAGG + Intergenic
913401623 1:118440783-118440805 ATAGGGATGGAAAATTTGGAAGG - Intergenic
914214604 1:145613892-145613914 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914420744 1:147526545-147526567 ATGTGGAGGGAGGACTGGAATGG + Intergenic
914466546 1:147934282-147934304 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
915526095 1:156477104-156477126 GTGGGGGTGGAGACTTGGCAGGG + Exonic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
915987886 1:160484561-160484583 AAGGGGTTGGAGAGTTGGAATGG - Intergenic
916396262 1:164391114-164391136 ATGAGGATGGAGAGTTGGGTAGG - Intergenic
917211025 1:172632106-172632128 AGTGGGATGGGGAACTGGAAAGG - Intergenic
917625638 1:176843277-176843299 AAGGAGATGGGGAGTTGGAATGG + Exonic
917742311 1:177972643-177972665 AGGAGGATGGAGACTGGGAAAGG - Intronic
918171559 1:182002946-182002968 AGTGGGATGGGGAATTGGAAAGG + Intergenic
918404727 1:184200491-184200513 ATGTGAATGGAGGATGGGAAGGG - Intergenic
918457107 1:184732323-184732345 GTGGGGATGGGGAATAGGGAGGG + Intronic
918586672 1:186196189-186196211 ATGAGTATGTGGAATTGGAAAGG - Intergenic
919098966 1:193070232-193070254 ATGGGGAGGGAAAAAAGGAATGG - Intronic
919476679 1:198038910-198038932 ATGGTGGTGGAGAATATGAAAGG - Intergenic
919664624 1:200280011-200280033 ATGGGGATGGAATATGGGAGAGG + Intergenic
920841007 1:209553720-209553742 ATGGATTTGGGGAATTGGAAGGG - Intergenic
921259705 1:213374888-213374910 ATGGGGAGGGAAAATTTAAAAGG + Intergenic
921480703 1:215661663-215661685 ATAAGGATGGAGATTTAGAAAGG + Intronic
921699114 1:218247003-218247025 AATGGGATGAAGATTTGGAATGG + Intergenic
922038136 1:221869924-221869946 ATGGGGAAAGAGAATAGGACCGG + Intergenic
922689004 1:227672317-227672339 GTGGGTATGGAGAGTTAGAAAGG + Intronic
923271809 1:232362008-232362030 TGGGGAATGGGGAATTGGAAAGG - Intergenic
923450276 1:234110719-234110741 ATGGGAATGTAAATTTGGAAGGG + Intronic
923589052 1:235302245-235302267 ATGGGGAGGGGGAAGTGTAAAGG + Intronic
1062767174 10:74696-74718 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1063286251 10:4692080-4692102 AAGGGGAAGGAGAAGGGGAACGG + Intergenic
1063303876 10:4878587-4878609 ATGGGGAAAGGGATTTGGAAAGG + Intergenic
1063505437 10:6593811-6593833 ATGGGGAGGGAGATAGGGAAAGG - Intergenic
1065328463 10:24570453-24570475 ATGGGCAGGGAGAAGAGGAAAGG + Intergenic
1065351569 10:24800189-24800211 ATAGGGCTGGAGAACAGGAAGGG - Intergenic
1066281012 10:33918440-33918462 AGTGGGATGGAGAGCTGGAAAGG + Intergenic
1066323451 10:34328584-34328606 ATGGGTTTGGAGAGTGGGAAAGG - Intronic
1066563145 10:36691973-36691995 AGGAGGATGGAGAAAGGGAAGGG - Intergenic
1067174481 10:43933947-43933969 TGTGGGATGGGGAATTGGAAAGG - Intergenic
1067787514 10:49261274-49261296 ATGGAGAAGGAAAATTGGCAGGG - Intergenic
1067914240 10:50379518-50379540 ACAGGGATAGAGAATTGGAGAGG + Intronic
1068640788 10:59404439-59404461 AGGTGGATGGAGAATTCAAATGG + Intergenic
1068874217 10:61979610-61979632 CTGGGGAAGGACATTTGGAAGGG - Intronic
1068927405 10:62554603-62554625 GTGGGGAGGGAGAACTGAAATGG - Intronic
1068961537 10:62871660-62871682 GTGGAGATGGAGAAGAGGAAAGG + Intronic
1069383472 10:67863449-67863471 AAGGGAAGGGAGAATAGGAAGGG + Intergenic
1069413266 10:68174478-68174500 CTGGGGATGGAAAATGTGAATGG - Exonic
1069933792 10:71901190-71901212 ATGGGGAGGGAAGATGGGAATGG - Intergenic
1069933799 10:71901209-71901231 ATGGGGAGGGAAGATGGGAATGG - Intergenic
1069933806 10:71901228-71901250 ATGGGGAGGGAAGATGGGAATGG - Intergenic
1070252403 10:74784491-74784513 ATGGGGATGAAGACTGTGAAAGG - Intergenic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1071068561 10:81666142-81666164 ATGGAGACAGAGTATTGGAAAGG + Intergenic
1071279370 10:84086336-84086358 ATGGGGATGGAGAAGCCAAAAGG - Intergenic
1071444751 10:85735679-85735701 ATGGGGAGGAAGAATAGAAACGG + Intronic
1071572208 10:86703593-86703615 ATGGAGCTGGAGAAGTGGCAAGG - Intronic
1072021508 10:91408071-91408093 AGGGGGCTGGAGAATGGGAATGG - Intergenic
1072438027 10:95431182-95431204 AAAGGGAGGGAGAAATGGAATGG - Intronic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1072985235 10:100133906-100133928 AGGGGGATGGAGAGGAGGAAGGG - Intergenic
1073553050 10:104421303-104421325 ATGGGTGTGGAGAGGTGGAAGGG - Intronic
1073823335 10:107291145-107291167 AAGGGGAGGGAAAATTGGGAAGG - Intergenic
1074121192 10:110495727-110495749 ATGGGGAGAGAGAACTGGAGAGG - Intergenic
1074315649 10:112359681-112359703 AGGGCAATGGAGAAATGGAAGGG - Intergenic
1074653598 10:115556913-115556935 ATGGGGATGGAACAGTAGAATGG - Intronic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1079074493 11:17375548-17375570 ATGGGCAAGGAGAACTAGAAAGG - Exonic
1079281259 11:19089305-19089327 ATGGGGATGGTGAGCCGGAATGG - Intergenic
1080102329 11:28473922-28473944 ATGGGAATGGGGAAAAGGAAAGG - Intergenic
1080193462 11:29579384-29579406 GGGAAGATGGAGAATTGGAACGG - Intergenic
1080389994 11:31836067-31836089 ATGGGGATGGAGCCCTGTAATGG - Intronic
1080438543 11:32268928-32268950 AAGGGGAAGGGGAATGGGAAGGG + Intergenic
1081155475 11:39684421-39684443 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1081179140 11:39966056-39966078 AGTGGGATGGGGAATTGGAAAGG - Intergenic
1082737201 11:56869656-56869678 ATGGGCATGTAAAATTGTAAGGG + Intergenic
1083918447 11:65765868-65765890 AATTGGATGGATAATTGGAAGGG + Intergenic
1083964654 11:66035975-66035997 AAGGGCATGGAGAAGAGGAAGGG - Intergenic
1084311290 11:68317649-68317671 ATGGGGCTGGGGAATGGGCAGGG - Intronic
1084884679 11:72195932-72195954 GTGGGGAAGTAGAAATGGAAAGG - Exonic
1085472279 11:76766179-76766201 ATGGGGTGGGAGGCTTGGAAAGG - Intergenic
1085843634 11:80041759-80041781 TTGGGGGTGGGGAATTAGAATGG - Intergenic
1086447542 11:86884244-86884266 ATGTGGGGGGTGAATTGGAAGGG - Intronic
1086954210 11:92919126-92919148 ATGGTGATGGGGAATTTTAAAGG + Intergenic
1088777591 11:113100542-113100564 AGTGGGATGGAGAGCTGGAAAGG + Intronic
1088970998 11:114774710-114774732 ATGGGGAAGGAAAAAGGGAAAGG - Intergenic
1089454504 11:118618191-118618213 TTGGGGAGGGAAAATGGGAAGGG - Intronic
1089983860 11:122794746-122794768 TTGGGGATGGAGTATTGGAGAGG + Exonic
1090058297 11:123441983-123442005 TTGAGGATAGAGAATTTGAAAGG + Intergenic
1090241635 11:125187062-125187084 ATGGGGATGGACATTTAGACTGG - Intronic
1091278318 11:134367272-134367294 ATGGTGATGGAGTACTGGACGGG + Exonic
1091392813 12:136256-136278 TTGGGAATGGGGAATGGGAATGG + Intronic
1091809118 12:3380128-3380150 ATGGCTCTGCAGAATTGGAAAGG + Intergenic
1092277874 12:7075953-7075975 ATGAGGATGGAGAATTTCAGGGG - Intergenic
1092391362 12:8082817-8082839 ATGTGCATGGGGAACTGGAAAGG - Intronic
1093011241 12:14109644-14109666 GTGAGGATGGAGAAGTGGCAGGG - Intergenic
1093370310 12:18356662-18356684 AGTGGGATGGAGAGCTGGAAAGG + Intronic
1093430729 12:19082091-19082113 ATGGAAATGGAGAATGGTAAAGG + Intergenic
1093885001 12:24449302-24449324 ATGTGGTTGGAGCATTGGCAAGG - Intergenic
1094438646 12:30450488-30450510 AAGGGGAAGAAGTATTGGAAAGG + Intergenic
1094479490 12:30870325-30870347 ATGGGGCTGGAGAGCTGCAAGGG - Intergenic
1094583102 12:31752415-31752437 AGCAGGATGGGGAATTGGAAAGG + Intergenic
1095669738 12:44844531-44844553 ATGGGGAAGGAGGAGTGGCAGGG + Intronic
1096520729 12:52183213-52183235 ATGGGGATGGAGACTTCCGAAGG - Intronic
1096798094 12:54091032-54091054 AGAGGGAAAGAGAATTGGAAAGG + Intergenic
1096929461 12:55190473-55190495 ATGTAGTTGGAGAATTGGCAAGG + Intergenic
1097087595 12:56480020-56480042 ATGGGTTTGGAGAATAAGAAAGG + Intronic
1097388441 12:58979469-58979491 ATGGGGAAGAAGAATTGAATTGG - Intergenic
1097405847 12:59188728-59188750 ATGGGGAGGGAGTATTGTATAGG + Intergenic
1097965253 12:65572458-65572480 ATGGGGAGGGAGAAACAGAATGG - Intergenic
1098389622 12:69955731-69955753 TTGGTGAGAGAGAATTGGAATGG + Intronic
1099933222 12:89097667-89097689 AGGGAGATGGAGATTTTGAAAGG - Intergenic
1100241786 12:92716927-92716949 TTGGGGATAGATAAGTGGAACGG - Intergenic
1100573972 12:95871866-95871888 ATGGGGAAGGAGAATTGCACTGG - Intronic
1101540593 12:105661314-105661336 ATGGGAATGAAGCAGTGGAAAGG - Intergenic
1101805198 12:108057396-108057418 GTGGGGATGCAGCAGTGGAAAGG - Intergenic
1102167910 12:110820901-110820923 AAGGGGATGGAGAGAGGGAAGGG - Intergenic
1103332228 12:120162280-120162302 ACGGAGATTGAGAATTGGGAAGG - Intronic
1103948757 12:124540758-124540780 ATGGGGGTGGAGAGCTGGAGGGG + Intronic
1104173848 12:126309842-126309864 ATGATGATGGAAAATTGTAATGG - Intergenic
1104424385 12:128663042-128663064 ATGGGGCTGGAGCCATGGAAAGG - Intronic
1104857935 12:131910509-131910531 ATGGGGATGGGGTGTTGGAGGGG + Intronic
1105247795 13:18668130-18668152 ATGAGAATGGAAAATTGGAAGGG - Intergenic
1105595158 13:21830613-21830635 AGGGGGAGGGAGAAGGGGAAAGG - Intergenic
1106331834 13:28746464-28746486 ATGGTGATGGAGAAAGGAAAGGG + Intergenic
1106495813 13:30273375-30273397 ATAAGGATTGAGAATTGGCATGG - Intronic
1107600230 13:42005374-42005396 TTAGGGATGGAGAATTGGTTGGG - Intergenic
1107795453 13:44046903-44046925 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1107817537 13:44257348-44257370 AGGGGGAAGGAGACTGGGAATGG - Intergenic
1108176512 13:47798213-47798235 ATGGGGAGGGAAAACTGGGAGGG + Intergenic
1108227838 13:48307390-48307412 CTGTGGATGGAGTATTGGTAAGG + Exonic
1108575256 13:51784869-51784891 ATGGGGATTGAGAAATGGAAGGG - Intronic
1108767246 13:53647156-53647178 ATGGGGATGAACAATGGGAATGG - Intergenic
1109202891 13:59450662-59450684 CTGTGGATGGGGAATTAGAATGG - Intergenic
1109742090 13:66567329-66567351 ATGGGGATGGAGCTTTTAAAGGG + Intronic
1110028921 13:70580364-70580386 ATGGAGATGGGAAATTGGCATGG + Intergenic
1110134915 13:72054785-72054807 TTGAAGATGGAGAATTGGAGAGG - Intergenic
1111353787 13:87070306-87070328 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1111736604 13:92148653-92148675 CTGGGGTTGCAGGATTGGAATGG + Intronic
1112109764 13:96283311-96283333 GCTGGGATGGAGAACTGGAAAGG - Intronic
1112956073 13:105059711-105059733 AGAGGGATGGAGAGCTGGAAAGG - Intergenic
1113055099 13:106259469-106259491 TGTGGGATGGGGAATTGGAAAGG + Intergenic
1114262845 14:21051245-21051267 ATGGGGCTAGGGCATTGGAAAGG + Intronic
1114711765 14:24785798-24785820 TTGGGGATGGGGAGATGGAAAGG + Intergenic
1115254943 14:31390167-31390189 ATGGGGATGGAGCAGTGGAGGGG + Intronic
1115501654 14:34055087-34055109 GAGGGCATGGAGAAGTGGAAGGG + Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115899566 14:38129635-38129657 AGAGGGATGGAGAGCTGGAAAGG - Intergenic
1116737260 14:48707809-48707831 ATAGGGACGCAGACTTGGAAAGG - Intergenic
1117012312 14:51483416-51483438 ATGGTGATGGGGCATTTGAAGGG + Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1118810178 14:69267421-69267443 ATGGGTCTGGAAAAGTGGAAAGG - Intronic
1119081321 14:71697011-71697033 ATGGGGATGGAGATGAGGATGGG + Intronic
1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG + Intergenic
1119514112 14:75234546-75234568 AAGGGGGTGGAGAAATGGAGTGG - Intergenic
1120115986 14:80617986-80618008 ATGGGGATGGACTATTTTAAAGG + Intronic
1120752359 14:88209674-88209696 GTGGGGCTGGAGAAGTGGAGGGG - Intronic
1120871637 14:89342589-89342611 GAGGGGATGAAGAATAGGAAAGG - Intronic
1121593358 14:95137476-95137498 ATGGGGATAGGGAAGGGGAAGGG + Intronic
1121593383 14:95137549-95137571 AAGGGAATGGAGAAGGGGAAGGG + Intronic
1121647042 14:95525711-95525733 AGGGGGAAGGAGGATTGGAAAGG - Intergenic
1121666920 14:95679659-95679681 AAAGGGGTGGACAATTGGAATGG - Intergenic
1124647679 15:31450451-31450473 AAGGGGAGGGAGAGGTGGAAGGG + Intergenic
1125864247 15:43029472-43029494 ATGGGGAGGGACAGATGGAAAGG + Intronic
1127686874 15:61354605-61354627 ATGGGGACGGAGAAAAAGAAAGG - Intergenic
1128109948 15:65069956-65069978 CTGGGGATGGAGAAAAGGATAGG - Intronic
1128116783 15:65112509-65112531 ATGGGGATGGGGAGTGGGATGGG + Intronic
1128226452 15:66004779-66004801 GTGAGGCTTGAGAATTGGAAAGG - Intronic
1129612653 15:77072762-77072784 ATGAGGATGAAGAAATGCAAAGG - Intronic
1130062409 15:80579270-80579292 ATCAGGAAGGAGAATGGGAAAGG + Intronic
1130367677 15:83254788-83254810 AAGGGGATGGAGAAGTAGCAGGG + Intergenic
1131378592 15:91945615-91945637 AGGGAGATGGAGAGTTGGAGAGG + Intronic
1132289221 15:100687801-100687823 ATGGAAAGGGAGAAATGGAAGGG + Intergenic
1132528313 16:428953-428975 GTGAGGATGGGGAAGTGGAAGGG + Intronic
1133808775 16:9145273-9145295 AGCGGGATGGGGAATTGGAAAGG - Intergenic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1135672508 16:24387290-24387312 AGTGGGATGGGGAGTTGGAAAGG + Intergenic
1136076234 16:27819374-27819396 ATGGGGATGGGGTTTTGGGATGG - Intronic
1137364462 16:47848834-47848856 ATGGGGTGGGACAATTGGGAGGG - Intergenic
1137707381 16:50545054-50545076 TTGGGGGAGGAGAATGGGAAAGG - Intergenic
1137776424 16:51058434-51058456 ATGGGGAGGGAGAGAGGGAAGGG + Intergenic
1139253406 16:65518654-65518676 CTGGGGATGGTGAAGTGGAAAGG - Intergenic
1140374657 16:74435061-74435083 CTGAGGATTGAGAATTGCAAGGG - Intergenic
1140956966 16:79874933-79874955 ATTGGGATTGGGAATTGGGATGG + Intergenic
1141755215 16:85986493-85986515 AAGCAGATGGAGAACTGGAATGG + Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142548228 17:720576-720598 ATGGGGAGGATGGATTGGAAGGG + Intronic
1142548279 17:720805-720827 ATGGGGAGGATGGATTGGAAGGG + Intronic
1142548289 17:720852-720874 ATGGGGAGGATGGATTGGAAGGG + Intronic
1142548299 17:720899-720921 ATGGGGAGGATGGATTGGAAGGG + Intronic
1143384941 17:6523574-6523596 GTGGGGATGGGGGATGGGAAGGG + Intronic
1144523740 17:15972090-15972112 ATGGGGCAGGAGAATGGGAGTGG + Intronic
1145061676 17:19738027-19738049 AAAGGGGTGGAGACTTGGAATGG + Exonic
1145905135 17:28512104-28512126 AAGGGGATGGAGAAATGGGCTGG - Intronic
1146338696 17:31999379-31999401 TTGGGGAGGGAAAATTGGAATGG + Exonic
1147167426 17:38600961-38600983 ATGGGCAAGGGGAGTTGGAATGG + Intronic
1148111478 17:45147047-45147069 GTGGCGAAGGAGAAGTGGAAAGG + Intergenic
1148852922 17:50563376-50563398 ATGGAGATGGAGAACTGATATGG + Intronic
1148853216 17:50564829-50564851 CTGGGGCTGGAGAATTGAATGGG + Intronic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1148987011 17:51631756-51631778 AAGGTCATGGAGAATTGGAAGGG - Intronic
1149804341 17:59600932-59600954 CTGGAGATGGAGAAGTGGTAAGG - Intronic
1151305538 17:73260802-73260824 CTGGGGAGGGAAAATTGGGATGG - Intronic
1152026821 17:77815361-77815383 ATGGTGTTGAAGCATTGGAAGGG - Intergenic
1152302028 17:79500627-79500649 AGGGGGATGGGGAAATTGAAGGG - Intronic
1152870470 17:82751054-82751076 ACGGGGATGGAGGATGGGGACGG - Exonic
1153284751 18:3447903-3447925 ATGGGAACCGAGAATTGGAAAGG - Intronic
1153502434 18:5762829-5762851 ATGGGGATGGTGCAATGGGATGG + Intergenic
1153927945 18:9850921-9850943 ATTGGCTTGGAAAATTGGAATGG + Intronic
1154441051 18:14391004-14391026 ATGAGAATGGAAAATTGGAAAGG + Intergenic
1155079660 18:22396206-22396228 AAATGGATGGAAAATTGGAATGG - Intergenic
1156003923 18:32418047-32418069 ATGTTGGTGGAGAATTGGAATGG - Intronic
1156035901 18:32768884-32768906 ATTGGGATGGAGGAGTGGAGAGG - Intronic
1156234836 18:35192447-35192469 ATGGGGATTGGGAGATGGAAAGG - Intergenic
1157063833 18:44323850-44323872 ATAGAGATGGAGGATAGGAAGGG + Intergenic
1157513193 18:48293361-48293383 TTGGGGATGGAGCATTTGAGAGG - Intronic
1157602454 18:48902331-48902353 AAGGGGATGGAGAAAGGGGAAGG - Intergenic
1157622899 18:49026439-49026461 CAGGGGATGGAGAAATGGCAGGG - Intergenic
1158001793 18:52628074-52628096 ATAGAGAATGAGAATTGGAAAGG - Intronic
1158452313 18:57578216-57578238 AGGGGCAAGGAGAAATGGAATGG + Intronic
1159366227 18:67468962-67468984 ATGGCAATGGAGAATTGCCAAGG - Intergenic
1159447389 18:68557518-68557540 AGAGGGGTGGGGAATTGGAAAGG + Intergenic
1159862792 18:73669140-73669162 GAGGGGATGGAGAAAGGGAAAGG + Intergenic
1159953740 18:74504980-74505002 ATAGGAATGGAGAATGGGACAGG - Intronic
1160077629 18:75693333-75693355 ATGGGGATGGAGCATTTAGAGGG - Intergenic
1160665613 19:326665-326687 AGGTGGATGGAGAATGGGAGTGG - Intronic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1162690511 19:12426035-12426057 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1162948882 19:14058976-14058998 AGGGGGCTGGAGAATTGGTGTGG + Intronic
1162953393 19:14085242-14085264 ATGGGTAAGGAGACTTGGAGGGG - Intronic
1163050494 19:14679718-14679740 ATGAGGCTGGAGAAGTGGAGTGG - Intronic
1163698230 19:18774660-18774682 ATGGGGATGGGGCCTTGGGAAGG + Intronic
1164408615 19:27977294-27977316 ATGGGGAAGGAAGAGTGGAAAGG + Intergenic
1164869210 19:31629202-31629224 TTGGGGATGGGGACTTGGGAGGG - Intergenic
1164976522 19:32576998-32577020 AAGGGGAAGGGGAATGGGAAAGG - Intergenic
1165924219 19:39317046-39317068 AGGGGGAGGGAGAAGTGGACTGG + Intergenic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1166476891 19:43134409-43134431 ATGGGGATGGAGAACTGGAATGG - Intronic
1166836564 19:45670984-45671006 TTTGGGATGGAGACTGGGAAGGG + Intronic
1166851910 19:45765307-45765329 AGGGGGATGGAGACCTGGACAGG + Exonic
1167663191 19:50808458-50808480 ATGGGGCTGGATAATGGGGATGG - Intergenic
1168314434 19:55478274-55478296 AAGGGAATGGGGAGTTGGAAGGG + Intronic
925436047 2:3838238-3838260 ATGAGGTAGGAGAATTGGAGCGG + Intronic
925448251 2:3946394-3946416 ATGGGAGGAGAGAATTGGAAGGG + Intergenic
925548288 2:5041746-5041768 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
925957166 2:8978150-8978172 ATGAGGCTGGAGAGGTGGAAGGG - Intronic
926698144 2:15784914-15784936 ATGGGGATGTAGAAGTGGTCAGG - Intergenic
927870394 2:26619370-26619392 TTGGGAATGGAGAATGGAAAAGG + Intronic
927927744 2:27025252-27025274 TTGGGGAAGTAGAGTTGGAAGGG - Intronic
928536690 2:32247990-32248012 ATAGACATGGAGACTTGGAAAGG + Intronic
929208981 2:39332375-39332397 ATGGGTATGGAGAAAGTGAATGG - Intronic
929481229 2:42310323-42310345 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
929617853 2:43326435-43326457 ATGGGGGGCGGGAATTGGAATGG + Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930672681 2:54167992-54168014 ATTGGGATGGAGAAATGGGATGG - Intronic
931372305 2:61675013-61675035 ATGGGGATAAAAAATGGGAATGG + Intergenic
931401198 2:61933058-61933080 AGTGGGATGGGGAGTTGGAAAGG + Intronic
931502203 2:62881461-62881483 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
931912600 2:66917857-66917879 ATGGGGATGCATAATTCCAATGG + Intergenic
931942847 2:67272023-67272045 ATGGGGAGGGAGCTTTGGAATGG - Intergenic
932121597 2:69105665-69105687 GTGGGGAAGGAAAATGGGAAAGG - Intronic
933084073 2:78032791-78032813 ATGTGAATGGAGAAGTGGTAAGG - Intergenic
933714647 2:85351058-85351080 ATGGGGATTGAGCCCTGGAAAGG + Intronic
934715182 2:96538889-96538911 ATGGGGAGGGAGAGAAGGAAAGG + Intronic
936756963 2:115725857-115725879 AAGAGGATGTAGTATTGGAAAGG + Intronic
937260503 2:120583409-120583431 ATGAGGATCGAGAATCAGAATGG - Intergenic
937518820 2:122686093-122686115 ATGGAGATGAAGAATTTGTAGGG - Intergenic
937538726 2:122923409-122923431 AGCGGGATCGGGAATTGGAAAGG + Intergenic
938043413 2:128095383-128095405 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
938651937 2:133391879-133391901 CGGGGGCTGGAGAATTGGGAGGG - Intronic
938775613 2:134538823-134538845 ATGGGGAAGGAGACCTGGGAGGG + Intronic
939044657 2:137236164-137236186 ATGGGGATAGAGAAATGGAAAGG + Intronic
939124045 2:138154018-138154040 ATGGGGGTGGATAATAGGAAAGG - Intergenic
939257398 2:139761333-139761355 AAGGGGAGGGAGAACAGGAAAGG - Intergenic
940491107 2:154362154-154362176 ATTGGCATTAAGAATTGGAATGG + Intronic
941234024 2:162946629-162946651 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
941717532 2:168779719-168779741 AGTGGGATGGGGAGTTGGAAAGG - Intergenic
942294980 2:174508240-174508262 AAGGGGAGGGAGATGTGGAAAGG + Intergenic
943465601 2:188225333-188225355 AAGGGTATGAAGACTTGGAAAGG - Intergenic
943564373 2:189499845-189499867 ATGTGGAGGTATAATTGGAAAGG - Intergenic
944287883 2:197972880-197972902 AAGTGTATGGAGAACTGGAAGGG - Intronic
944348274 2:198695264-198695286 AAGGGGATGGAAAAGGGGAATGG + Intergenic
944635192 2:201669168-201669190 TTGGGCATGGAGAAGGGGAAAGG + Intronic
944913348 2:204331995-204332017 ATGGAGATGGAGAAAGGGCAAGG - Intergenic
944944298 2:204665489-204665511 ATAGGCGTGGATAATTGGAATGG - Intronic
945815981 2:214605490-214605512 AAGGGGAAGGAGTATTGGAAAGG - Intergenic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
946010493 2:216560143-216560165 AAGGGGAAGGGGAATGGGAAGGG - Intronic
946100042 2:217312705-217312727 AAGGGTATGCAGAATTGGATAGG + Intronic
946237387 2:218332535-218332557 ATGGGGAAGGAGGAAGGGAAGGG - Intronic
946406153 2:219493043-219493065 AGGGGAATGGAGAAGTGGAGAGG + Exonic
946494922 2:220186497-220186519 ATGGAGATGGAGAAAATGAATGG + Intergenic
946545315 2:220735121-220735143 ATGGGGATAGGGAAGTTGAAGGG + Intergenic
946545703 2:220740626-220740648 ACGTGGCTGGAGTATTGGAAGGG + Intergenic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
947335622 2:229079921-229079943 ATGGGCATGGAGCACTGGCATGG + Intronic
947343626 2:229166979-229167001 AAGGGGAAGGGGAAGTGGAAGGG + Intronic
947897917 2:233692658-233692680 TTCGGGATAGAGAATTGGCAGGG + Intronic
948208291 2:236174229-236174251 ATGGGGAGTGAGAATTGGAATGG + Intergenic
948265331 2:236631845-236631867 GTGGTGATAGAGAATTGGAAGGG + Intergenic
948339975 2:237241947-237241969 TTGGGCATGGAGACTTGGAATGG + Intergenic
948344335 2:237282673-237282695 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948344349 2:237282703-237282725 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948344354 2:237282721-237282743 AAGGGGAAGGAGAAGAGGAAGGG + Intergenic
948558561 2:238835251-238835273 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1168949889 20:1790062-1790084 ATGAGGCTGGAGAGATGGAACGG + Intergenic
1168981602 20:2008698-2008720 ATAGGTCTGGAGAATTGGAAAGG - Intergenic
1169663571 20:8007600-8007622 ATGGGGATGGAGAAGTAGCTAGG - Intronic
1170327371 20:15171412-15171434 ATGGTGAAGGAGAGATGGAAGGG - Intronic
1170657880 20:18306536-18306558 ATGAAGATGGAGATCTGGAAGGG - Intronic
1170735101 20:19007514-19007536 TTGGGAAGGGAGAATTGGAAAGG + Intergenic
1171158533 20:22899396-22899418 ATGGGCATAGAGAAATGGCAGGG + Intergenic
1171959988 20:31486353-31486375 CTGAGGATGGAGGATTGGACTGG - Intergenic
1172080801 20:32339080-32339102 ATGGGGATGGAGAACGGGGCTGG + Intergenic
1172167402 20:32907588-32907610 CTGGAGATGGAGAATTGTCAGGG + Intronic
1172228816 20:33323357-33323379 ATGGGGAAGGAGCAGTGGATAGG - Intergenic
1172396205 20:34607517-34607539 AATGGGATGGAGAGCTGGAAAGG - Intronic
1172700569 20:36851412-36851434 ATGAAGATGGAGAAGTGGACGGG - Intronic
1173461283 20:43245269-43245291 ATGGGGATGGGGAAGGGGACAGG - Intergenic
1173581027 20:44146576-44146598 ATGGGCTTGAAGCATTGGAAAGG - Intronic
1173964618 20:47102708-47102730 CTGGGGAGGAAGAAATGGAAAGG - Intronic
1174096969 20:48097330-48097352 ATGGGGAAGGAGCACTGGCATGG - Intergenic
1174137825 20:48392885-48392907 GAGGGGATGGAGGATGGGAAGGG + Intergenic
1174279884 20:49431724-49431746 ATGGGGATGGAGAAGTGAATGGG - Intronic
1174587065 20:51617678-51617700 AAGGGGTTGGAGAGATGGAATGG - Intronic
1174709522 20:52690257-52690279 AAGGGGAAGGAGAAGGGGAAAGG - Intergenic
1175044385 20:56091015-56091037 ATGGGGCTTGAGGATAGGAAGGG - Intergenic
1175258987 20:57663251-57663273 AGGGAGATGGAGATTTGCAAGGG + Intronic
1176455004 21:6900191-6900213 ATGAGAATGGAAAATTGGAAAGG - Intergenic
1176833177 21:13765239-13765261 ATGATAATGGAAAATTGGAAAGG - Intergenic
1177095099 21:16822907-16822929 ATGGGACTTGAGAATTGTAATGG + Intergenic
1177114866 21:17073349-17073371 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1177656992 21:24030225-24030247 AGGGGTTTGGAAAATTGGAAGGG + Intergenic
1178468345 21:32869475-32869497 ATGGGGATGGAGATCGGGATGGG - Intergenic
1178515605 21:33244575-33244597 TTGGGGAGGGAGAATGGGTAGGG + Intronic
1178894940 21:36550437-36550459 ATGTGGAGGGAGAATTGGAGGGG + Intronic
1179716100 21:43289433-43289455 CTGGGGAGGGAGAATTGGTAGGG - Intergenic
1180870305 22:19142793-19142815 AGGAGAATGGAGACTTGGAACGG - Exonic
1181150252 22:20878177-20878199 ATGGGGAGTAAGGATTGGAAGGG + Intronic
1181440960 22:22935002-22935024 ATGGGGCTGGAGCTGTGGAATGG - Intergenic
1181597256 22:23924162-23924184 ATGGAGATGGAGGATAGCAAAGG + Intergenic
1181880974 22:25979798-25979820 ATTGGGATGGAGAAGGGGAAGGG - Intronic
1182989555 22:34754085-34754107 ATGGGGATGTAAAATAGAAAAGG - Intergenic
1183965121 22:41436877-41436899 ATGGCGATGGGGAGTTGGACAGG + Exonic
1184103366 22:42353389-42353411 ATGGGCATGGAGAGTAGGGAAGG + Intergenic
1184350050 22:43937469-43937491 ATGGGAAGGGAGACTTGGCAAGG - Intronic
949689670 3:6621301-6621323 AGTGGGATGGGGAATTGGAAAGG - Intergenic
950614551 3:14148480-14148502 ATGGGGATGGAAAGCTGGCATGG - Intronic
950683234 3:14599572-14599594 CTGGGGAGGGGGAGTTGGAAAGG + Intergenic
950971180 3:17189747-17189769 ATGGTAATGGAGCATAGGAAGGG - Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
952279736 3:31911367-31911389 ATGGGGGTGGAGGAGTGGAATGG + Intronic
952608894 3:35183042-35183064 ATGTGGTTGTAGACTTGGAATGG + Intergenic
952674146 3:36006832-36006854 ATTGGCAAGGAGAATGGGAATGG + Intergenic
953217282 3:40931105-40931127 AAGGGGAAGGAAAAGTGGAAAGG + Intergenic
953285471 3:41602377-41602399 GAAGGGAAGGAGAATTGGAAGGG + Intronic
953550683 3:43900226-43900248 ATGGACATGGAGAACTGCAAGGG + Intergenic
953575318 3:44108754-44108776 AGATGGATGGAGAATTGGAGAGG + Intergenic
955452499 3:59084950-59084972 ATAGTGATGGAGAATGGTAATGG - Intergenic
955609854 3:60745408-60745430 ATGAAGATGGAGAGTTGGTAGGG + Intronic
955828526 3:62975737-62975759 AGGGAGATGGAGAATTGTCAAGG + Intergenic
955837151 3:63068628-63068650 CTGGGGATGGGGAAGTGAAAGGG + Intergenic
956014111 3:64863070-64863092 ATGGGGATGAATACTTAGAAAGG - Intergenic
956132467 3:66067364-66067386 GTCAGGATGGAGAATTGGAAGGG + Intergenic
956668335 3:71663101-71663123 ATGGGGATGGCGGCTTGCAAGGG - Intergenic
956724460 3:72145756-72145778 CTGGGGCTGGAGAGTGGGAAGGG - Intergenic
957423660 3:80006353-80006375 ATGGAGATGGAGATCTGGAGAGG + Intergenic
958023956 3:88028441-88028463 AGCAGGATGGAGAACTGGAAAGG - Intergenic
958429563 3:94021992-94022014 TAAGGAATGGAGAATTGGAAAGG - Intronic
958550794 3:95609362-95609384 ATGGGGACAGAGAATGGCAAGGG - Intergenic
958722452 3:97861016-97861038 ATGGACATGGAGAATAGAAAGGG - Intronic
959155702 3:102664025-102664047 AGTGGGATGGAGAGCTGGAAAGG - Intergenic
959842183 3:110990291-110990313 AAGGGGAGGGGGAGTTGGAATGG + Intergenic
960325010 3:116285165-116285187 ATGGGGATGGGGAAGTTGAAGGG - Intronic
960573963 3:119211292-119211314 GTGGGGAAGGAGAATTTGAAAGG - Intergenic
961192356 3:124972532-124972554 ATGGGGATGCAGACTTTGGATGG - Intronic
961808345 3:129505521-129505543 ATGGTGATGGATTCTTGGAAGGG - Intronic
962368968 3:134805109-134805131 CTGGGGATGGGGGATTGGGAAGG + Intronic
962452320 3:135530608-135530630 ATGTGGAAGCAGGATTGGAAGGG - Intergenic
962707957 3:138063054-138063076 ATGGGAATGCAGAATGGAAATGG + Intronic
962987625 3:140550034-140550056 ATGGAGATGAAAAATTGGCAGGG - Intronic
962987788 3:140551485-140551507 ATGGAGATGAAAAATTGGCAGGG - Intronic
963030690 3:140972304-140972326 GTGGGGTTGGGGAATTGGATAGG + Intronic
963095961 3:141540876-141540898 CTGGCAGTGGAGAATTGGAAAGG + Intronic
964349188 3:155786112-155786134 ATGGGAAAGGAGAAAGGGAAGGG + Intronic
964480385 3:157133277-157133299 ATGGGGATGGGGACAAGGAAAGG + Intergenic
964493086 3:157258035-157258057 ATGGAGTTGGAGTATGGGAATGG - Intergenic
965208426 3:165751649-165751671 ACTGGGATGGAGAGCTGGAAAGG - Intergenic
966300877 3:178478653-178478675 ATGGGGCTGGAGAAATAGATGGG + Intronic
966358063 3:179103381-179103403 AAGTGGATGGAGAATTGGGGAGG + Intergenic
967222586 3:187260173-187260195 GGAGGGATGGAGAAATGGAAGGG - Intronic
967391738 3:188962856-188962878 ATGGTGATTGACACTTGGAAAGG - Intronic
967488309 3:190059414-190059436 TGGAGGATGGAAAATTGGAAAGG + Intronic
967966717 3:194966430-194966452 ATGGAGATGGAGTGTTGGTAGGG - Intergenic
968924506 4:3539827-3539849 CTGGGGAAAGAAAATTGGAAAGG - Intergenic
970328372 4:14952936-14952958 ATGAGAAGGGAGAATTGGAGTGG + Intergenic
970578495 4:17451292-17451314 AGTGGGATGGGGAATTGGAAAGG + Intergenic
971870977 4:32238093-32238115 ATGCTGAAGGAAAATTGGAATGG + Intergenic
972053026 4:34764496-34764518 AGTGGGATGGAGAGCTGGAAAGG - Intergenic
972442822 4:39113306-39113328 AACGTGTTGGAGAATTGGAAGGG + Intronic
973936483 4:55851742-55851764 ATGGTGAGGGAAAATTAGAATGG + Intergenic
974790771 4:66685463-66685485 ATGAGGATGGAAAATGGAAATGG - Intergenic
975707062 4:77121881-77121903 AGCAGGATGGGGAATTGGAAAGG + Intergenic
976515992 4:85967059-85967081 ATGGGGATAGAGAATGAGCAAGG + Intronic
978076001 4:104530392-104530414 ATGGGGAGGGTGCATTCGAAAGG + Intergenic
978434725 4:108671490-108671512 ATGGCTATTGAGTATTGGAAAGG + Intergenic
979466314 4:121042394-121042416 TTGGAGATGGAGAATGGGAGTGG + Intronic
980853233 4:138409052-138409074 ATTTTGATGCAGAATTGGAATGG - Intergenic
980866042 4:138554218-138554240 ATAAGGATGGAGAATTAGACTGG - Intergenic
981610744 4:146591056-146591078 ACAGGGATGGAGAATACGAAGGG + Intergenic
982117246 4:152107831-152107853 GAGGAGATGGAGAATTTGAATGG + Intergenic
983654802 4:170071907-170071929 ATGGAGATGGAGAATGTGAGAGG + Intronic
984278012 4:177633723-177633745 AGAAGGATGGGGAATTGGAAAGG - Intergenic
984954033 4:185027847-185027869 ATGGGGATGGGAAATTGAATGGG + Intergenic
988151422 5:27386957-27386979 GTGGAGATGGAGAATTCTAAGGG - Intergenic
988785897 5:34565153-34565175 ATGGGGAAGGAGACCCGGAAGGG - Intergenic
990962940 5:61414036-61414058 ATGGGGTAGGAGAAATGGACAGG + Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
995109736 5:108415593-108415615 TTGGGAATGGAGCATTGCAATGG - Intergenic
995241131 5:109886067-109886089 ATGGGGGTGGAGTATGGGAGGGG - Intergenic
996236638 5:121138896-121138918 ATGGGAAGGGAGAAAAGGAAAGG - Intergenic
997427339 5:133812398-133812420 CTGGGGATGGAGAAGTGTCAGGG - Intergenic
997604425 5:135163857-135163879 ATGGGGCTGGAGAGGTGGACAGG + Intronic
998073345 5:139216451-139216473 ATGTGGAGGGAGCATTGGAAGGG + Intronic
998365833 5:141630173-141630195 ATGGGGAGGGAGATATGGGAAGG - Intronic
998394731 5:141811481-141811503 TTGGGGATGGAGAAATGAAAAGG - Intergenic
998576264 5:143320599-143320621 TTGGGGATGGAAAAGTGGAGAGG + Intronic
999102268 5:149036479-149036501 AAGAGGATGGAAAATAGGAATGG - Intronic
999511410 5:152256591-152256613 GTGGGGATGGGGAATTGAGAGGG - Intergenic
999933211 5:156456162-156456184 ATGGGGAGGTAGCTTTGGAATGG + Intronic
1000100061 5:158007753-158007775 AGCGGGATGGGGAATTAGAAAGG - Intergenic
1000967101 5:167670835-167670857 ATGGGGAAGGAAAAATGGCAAGG - Intronic
1001184738 5:169558867-169558889 ATGGGGATGGAGAGGAGGCAGGG - Intergenic
1002584298 5:180232195-180232217 ATGGTGTTTGAGAGTTGGAAGGG - Intergenic
1002765880 6:238268-238290 CTGGGAAGGGAGAATTGAAAAGG + Intergenic
1003286059 6:4734700-4734722 ATGGGGATGGGGAAGAGGATGGG + Intronic
1003530784 6:6935989-6936011 ATAGTGGTGGAGAATTAGAAAGG - Intergenic
1003810962 6:9780117-9780139 ATGGGGCAGGTGAATTGAAAAGG - Intronic
1004447727 6:15716013-15716035 GTGGGCCTGGAGAATTTGAATGG + Intergenic
1005277370 6:24234201-24234223 ATGAGGAAGGAGAATTTTAAAGG + Intronic
1008085492 6:47239866-47239888 AAGGGGAAAGAGAATTGGAGTGG - Intronic
1009564642 6:65297772-65297794 ATGTGGAGGGAGAAGAGGAAAGG - Intronic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1010240184 6:73608145-73608167 ATGGGGGTGGGGAGTGGGAATGG - Intronic
1010291481 6:74142843-74142865 ATGGGGATGGGGAGATGCAAAGG + Intergenic
1010609264 6:77933202-77933224 ATATTCATGGAGAATTGGAATGG - Intergenic
1010784652 6:79986156-79986178 ATGGGCTTGGAGAATTAGAAAGG + Intergenic
1011112460 6:83853583-83853605 TGGGGGATGGAGAGTTGGAGGGG - Intronic
1011415503 6:87115721-87115743 GTGGGGATAGAGCATTGTAATGG - Intergenic
1012092323 6:94914670-94914692 AGGGTGATGGAGAATTGTGAGGG - Intergenic
1012451228 6:99354071-99354093 ATGGGGAAGGAGAGATGTAAGGG + Intergenic
1012956577 6:105576995-105577017 CTTGGCATGGACAATTGGAATGG - Intergenic
1012966217 6:105676348-105676370 AGAGGGATGGAGCATTTGAAGGG - Intergenic
1013043499 6:106460545-106460567 ATGGGGGTGGGGAATTGTGAGGG + Intergenic
1013164782 6:107579936-107579958 AGGAGGATGGAGAATTAGGAGGG + Intronic
1013396760 6:109748559-109748581 ATGGGGATTTAGAATGGAAAAGG + Intronic
1014249425 6:119100210-119100232 ATGGTGAGGGAGAAATGAAATGG + Intronic
1014786276 6:125623518-125623540 ATGGGGAGGGAGAATTGTTTTGG + Intergenic
1017557691 6:155589698-155589720 GAGGGGATGTAGACTTGGAAAGG + Intergenic
1017953967 6:159162677-159162699 AGGGGGAAGGAGACTTGAAAAGG + Intergenic
1018697202 6:166399607-166399629 ATGTGGACGCAGGATTGGAAGGG + Intergenic
1019369756 7:655497-655519 ATGGGGATGCAGTTTTGGAGGGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1020552620 7:9625680-9625702 CTGACGATGGAGAATGGGAATGG + Intergenic
1021058945 7:16085700-16085722 TTGGGGATGGAGATGGGGAAAGG + Intergenic
1021614526 7:22488319-22488341 TTGGGGAAGGAGAAGAGGAAGGG + Intronic
1021665828 7:22978646-22978668 ATGGGGTTGAAGAAATTGAATGG + Intronic
1021853781 7:24833811-24833833 ATGGGTAGGGAGATTGGGAAGGG - Intronic
1022274423 7:28841817-28841839 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022357052 7:29625786-29625808 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022499105 7:30871457-30871479 AGGAGGATGGAGACTTGGGAGGG + Intronic
1022513883 7:30963480-30963502 GTGGAGATGGAGGGTTGGAATGG - Intronic
1022963267 7:35450444-35450466 AAGGGGGTGGAGAATTGCAGAGG - Intergenic
1023296658 7:38721847-38721869 ATGGGACTGGAGAAGGGGAATGG + Intergenic
1023299342 7:38752445-38752467 TAGGTGATGGAGAAGTGGAAAGG + Intronic
1023891940 7:44399107-44399129 ATGGGGTTGGAGGAGAGGAAAGG - Intronic
1027477687 7:78653835-78653857 ATGAGGATGGACAAGTGGTATGG - Intronic
1027951480 7:84822474-84822496 ATGGGGGTGGAGATTGGGACTGG + Intergenic
1028426142 7:90691482-90691504 TTGTGGATGGAGAATAGTAAGGG + Intronic
1028611524 7:92717368-92717390 AAGGGGAAGGAGAAGGGGAAAGG + Intronic
1030902396 7:115140609-115140631 AAGGGGAAGGAGAACGGGAAGGG - Intergenic
1031399278 7:121312652-121312674 ATGAGGTTGGAAAATTGGATGGG - Intergenic
1031865989 7:127039624-127039646 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1033257044 7:139810472-139810494 ATGGGGATAGATGAATGGAAAGG + Intronic
1033281806 7:140011355-140011377 ATTGGGATGGAGAATGGCAGGGG - Intronic
1033804378 7:144937556-144937578 AAGGGGAAGGAGAAAGGGAAGGG - Intergenic
1033857175 7:145577870-145577892 AAGGGGATGGGGAGCTGGAAAGG + Intergenic
1033996847 7:147360789-147360811 TTAGGGATGGGGAGTTGGAATGG - Intronic
1034054051 7:148015918-148015940 AGGGAGTTGGTGAATTGGAAAGG - Intronic
1034775783 7:153825348-153825370 AAGGGGATTGGGAATAGGAATGG - Intergenic
1035023734 7:155813665-155813687 ATGGCGATTGAGAAGGGGAAGGG - Intergenic
1035377931 7:158419032-158419054 ATGGTGAAGGAGAAGTGGCAAGG - Intronic
1035574411 8:695820-695842 ATGGGGAGGGAGGAGAGGAAGGG - Intronic
1036718038 8:11144888-11144910 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1037559291 8:20058087-20058109 ATGTGGATGGAGAGATGGGAAGG - Intergenic
1037593601 8:20334918-20334940 ATGAGGAGGTTGAATTGGAATGG + Intergenic
1038048343 8:23786369-23786391 AAGGGGAGGGAGAAATGGATTGG - Intergenic
1038604058 8:28980650-28980672 GTGGGGGTGGAGAATGGGATGGG - Intronic
1040601778 8:48891924-48891946 ATGGGGATGGGGACTGGGACTGG - Intergenic
1040743080 8:50604509-50604531 AAGGGGAGGGAAAAGTGGAAAGG - Intronic
1041486681 8:58385144-58385166 TTGGGGATGGGGGATAGGAAAGG - Intergenic
1041975475 8:63794474-63794496 TTCAGGAAGGAGAATTGGAAAGG + Intergenic
1042059326 8:64799687-64799709 ATGGGGATGATGGACTGGAAGGG - Intergenic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042888517 8:73580049-73580071 AAGGGAATGTAGAATTGGAAAGG - Intronic
1042985859 8:74582065-74582087 ATGGGGTTGTGGAAATGGAAAGG + Intergenic
1043403801 8:79910477-79910499 AAGGGGATGAAAAATTGGGATGG + Intergenic
1044360458 8:91277354-91277376 ATGGGGATGCAGTATTGAACAGG - Intronic
1044402234 8:91786155-91786177 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1044637069 8:94336661-94336683 GTGGGGATGGAGACTTGTGATGG + Intergenic
1045189380 8:99867875-99867897 ATGAGGATGAAAAACTGGAAGGG - Intronic
1045416657 8:101974366-101974388 CTGGGGATAGAGAATGGGACAGG - Intronic
1045581304 8:103483286-103483308 GTGGGGATGGGGAATGGGAAGGG + Intergenic
1045780742 8:105860214-105860236 ATGGGGATAAAGAATTGTATGGG + Intergenic
1047507354 8:125490350-125490372 ATTGGGATGGGGAAGTGGGAGGG - Intergenic
1047523727 8:125615292-125615314 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1047929179 8:129709708-129709730 ATGAGGACAGAGAATTGGGAAGG - Intergenic
1048698006 8:137050174-137050196 ATGGGGATGTGGACTTGGGAAGG - Intergenic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1050059152 9:1687426-1687448 ATTGGGATGGGGACCTGGAAAGG + Intergenic
1050147888 9:2589497-2589519 TTGGGGGTGGAGAGTGGGAAGGG + Intergenic
1050504331 9:6331769-6331791 ATAAGGATGTAGAATTGAAAAGG + Intronic
1050772807 9:9224308-9224330 ATGGGGAGGGAGAAAGGGAAAGG + Intronic
1052164271 9:25304311-25304333 ATGGGGAAGGAGAGAGGGAAGGG + Intergenic
1052294100 9:26878597-26878619 AGGAAGATGGAGAATGGGAAGGG - Intronic
1054855296 9:69892875-69892897 AGTGGGATGGAGAGCTGGAAAGG - Intronic
1055403487 9:75949318-75949340 ATGGGGTTGGAGCATTTGAAAGG + Intronic
1055879697 9:80986227-80986249 AGAGGGAGGGAGAATTGGATGGG - Intergenic
1056069742 9:82973776-82973798 AAGAGAAAGGAGAATTGGAAGGG - Intergenic
1056361388 9:85861163-85861185 ATGGGAGTGGATAAATGGAATGG + Intergenic
1056704329 9:88939328-88939350 CTGGGAATGGAGAATTGAGATGG + Intergenic
1057789870 9:98117818-98117840 AGGGGGATGGACAAATGGATGGG + Intronic
1058345752 9:103959396-103959418 GTGGGAACGGAGAATTAGAAAGG - Intergenic
1058385532 9:104430877-104430899 GTGAGGATGGAGAATTGGGCAGG + Intergenic
1058418079 9:104808721-104808743 AAGGTGCTGGAGAATTGGAGAGG - Intronic
1058721575 9:107769206-107769228 AGGGGGATTGAGAATGAGAAAGG - Intergenic
1058750348 9:108033182-108033204 ATGAGGATGGAGAAGGGGATGGG - Intergenic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1060264183 9:122100880-122100902 ATGGGTGTGCAGAAGTGGAAAGG - Intergenic
1060434789 9:123584114-123584136 ATGGGGAAGGAGGATTGAATGGG - Intronic
1060816712 9:126638994-126639016 ATTGGGAAGGAGAATTGGAGAGG + Intronic
1060816731 9:126639061-126639083 GTTGGGAAGGAGAATTGGAGAGG + Intronic
1060994987 9:127870811-127870833 ATGGGAATGGGGCATGGGAATGG + Intronic
1061947437 9:133916570-133916592 ATATGGATGGAGAAGGGGAAAGG + Intronic
1062099110 9:134718834-134718856 ATGGGGATGGGAGAGTGGAAAGG + Intronic
1185540489 X:899393-899415 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1185616456 X:1424809-1424831 AGGTGGATGGATAAATGGAAGGG - Intronic
1186102051 X:6167687-6167709 ATGGGGATGGAGAAGAAGCAGGG - Intronic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1186977946 X:14928359-14928381 ATGAAGAGGGAGAATTGGCAAGG - Intergenic
1187324479 X:18273944-18273966 AGTGGGATGGGGAATTGAAAAGG - Intronic
1187371938 X:18716592-18716614 ATGGGGATGGAGAGCCGGGAGGG - Intronic
1187968823 X:24639538-24639560 GTGGGTAGGGAGAAGTGGAAAGG - Intronic
1188122513 X:26326617-26326639 TGGGGGATGGGGAATGGGAATGG - Intergenic
1189257747 X:39653549-39653571 ATGGGGGTGGAGGGTCGGAAGGG - Intergenic
1189860172 X:45263642-45263664 TTGGGGTTGGAGATTGGGAAAGG + Intergenic
1190561950 X:51694980-51695002 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1190570965 X:51781010-51781032 ATGGTGATAGAGAATTAGAGTGG + Intergenic
1190988729 X:55523601-55523623 ATGGGGATGGAGAGGCAGAAAGG + Intergenic
1192089726 X:68140926-68140948 AGCAGGATGGGGAATTGGAAAGG - Intronic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1195513315 X:105742886-105742908 ATGGAGATGGAGAAGGGGACTGG - Intronic
1196331607 X:114476791-114476813 ATGGGGAGGGAAAAATAGAATGG + Intergenic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197190423 X:123641486-123641508 TGGGATATGGAGAATTGGAAAGG - Intronic
1197493014 X:127142018-127142040 ATGTGGAAGGAGAATAGAAATGG + Intergenic
1198437370 X:136630372-136630394 ATGGGGCTGAACAATTAGAAGGG - Intergenic
1199267812 X:145848723-145848745 ATGGTGAAGGACACTTGGAAAGG - Intergenic
1202191159 Y:22247329-22247351 ATGAGGGTGGAGCATTGGACAGG - Intergenic