ID: 1166462627

View in Genome Browser
Species Human (GRCh38)
Location 19:43002752-43002774
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 3, 1: 1, 2: 2, 3: 26, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901054185 1:6440937-6440959 TGCCAGATCCTGGTAGTGAACGG + Exonic
901136131 1:6997497-6997519 TGTAAAAACCTGAAATTGAGAGG - Intronic
902309980 1:15574798-15574820 TGTCAAGGCCTGAACGTGATGGG - Exonic
902480124 1:16707394-16707416 TGCCAGATCCTGGTAGTGAACGG - Intergenic
903774485 1:25783830-25783852 TCTCAAATCCTGAAAAGGCAAGG - Exonic
903817656 1:26076501-26076523 TTTCTAATCCTGAGAGTCAAGGG + Intergenic
904358707 1:29958795-29958817 TGTGAAACCCTGAAAGCGAGGGG + Intergenic
904979437 1:34484598-34484620 TGGCAATTGCTGTAAGTGAAAGG + Intergenic
906594281 1:47060618-47060640 TGTCTAATACTGACAGTGGAGGG - Intergenic
907340847 1:53735231-53735253 TTTAAAATGCTGAATGTGAAGGG - Intergenic
909613273 1:77576150-77576172 TGTGAAGTCATGAAAGTGGAAGG + Exonic
909719010 1:78744314-78744336 TGATACATCCTGAGAGTGAACGG + Intergenic
910364008 1:86444759-86444781 GCTTGAATCCTGAAAGTGAAAGG + Intronic
910666322 1:89728958-89728980 TGACACAACCTGAAAGTGAGAGG + Intronic
910671841 1:89781686-89781708 TGTCAGATGCTAAAAGTGAAAGG + Intronic
911987352 1:104644668-104644690 TTTCATATCATGAAAGTGCAAGG + Intergenic
913437651 1:118863995-118864017 TGTCAAAAGCTCAAAGTGAAAGG + Intergenic
914390021 1:147212527-147212549 TCTCAATTCCTGCAAGAGAAGGG + Exonic
916184311 1:162115967-162115989 TGTCAAATACTCAAAGTAGAAGG + Intronic
916215881 1:162393514-162393536 TGTAAAAACTTGAAAATGAAAGG + Intergenic
918391495 1:184067997-184068019 TGATAAATCCTGCAAGTGGATGG - Intronic
920505436 1:206512339-206512361 TATCAAAAGATGAAAGTGAAAGG + Intronic
920582136 1:207120116-207120138 TGACTAATCCTGATAATGAAGGG - Intronic
921496581 1:215849774-215849796 TGTCAAATGTTGAAAGACAATGG + Intronic
922307644 1:224357543-224357565 AGTCAACTCCTGGATGTGAAAGG - Intronic
922447581 1:225710547-225710569 TGTCAAATCCTTCCAGTGAATGG + Intergenic
923834746 1:237597955-237597977 AGACATAGCCTGAAAGTGAAGGG + Intronic
923861009 1:237892019-237892041 TGGCAAATCCTGTGAGTAAATGG - Intergenic
1064790931 10:18957454-18957476 TGGCAACACCTGAAAATGAATGG - Intergenic
1064887889 10:20132696-20132718 ACTCATATGCTGAAAGTGAAAGG - Intronic
1065488345 10:26255825-26255847 TTTCAAATCCTAAAATTGGAAGG + Intronic
1067987886 10:51171375-51171397 TGCAATATCCTGGAAGTGAATGG + Intronic
1068338718 10:55673083-55673105 TGTCACATCGTGAGAGTGAAAGG + Intergenic
1068540366 10:58286739-58286761 TGTGAATTCATGAAAATGAATGG + Intronic
1068990291 10:63143172-63143194 TCTGAAATCCTGTAATTGAAAGG + Intronic
1070837489 10:79459043-79459065 TGTCCACTTTTGAAAGTGAAAGG - Intergenic
1071723842 10:88176071-88176093 AGACAGAGCCTGAAAGTGAAGGG - Intergenic
1071939036 10:90567156-90567178 TTTCATAGACTGAAAGTGAAGGG - Intergenic
1076287002 10:129310040-129310062 TGTTAAATACTGCAAGGGAAAGG + Intergenic
1077853074 11:6094549-6094571 GCACAAATCCTGAAAGAGAAAGG - Intergenic
1079845763 11:25465477-25465499 ACACAAATGCTGAAAGTGAAAGG + Intergenic
1080203231 11:29698708-29698730 TCACAACTTCTGAAAGTGAAGGG - Intergenic
1080360953 11:31512947-31512969 TGTTAAATTTTGATAGTGAAGGG + Intronic
1085042978 11:73337744-73337766 TGGCAGAGACTGAAAGTGAAGGG - Intronic
1085211123 11:74779783-74779805 TGTCAAATGAAGTAAGTGAAAGG - Intronic
1085507854 11:77070300-77070322 GGGCACATCCTGACAGTGAAGGG - Intronic
1086774872 11:90817999-90818021 AGCCAAATCCAGAAACTGAAAGG - Intergenic
1087326652 11:96732105-96732127 TTTCAAATAATGAAAGAGAATGG - Intergenic
1088094867 11:106086907-106086929 TTTCAAAGCCTGAAAATAAAAGG + Intronic
1090108125 11:123873844-123873866 TGGTGAAACCTGAAAGTGAAAGG - Intergenic
1090636056 11:128691282-128691304 TTTTAAATCCTGAAAGGGGATGG - Intronic
1092101965 12:5890841-5890863 TGACCAATCCTGTAAGTGAATGG - Intronic
1092184475 12:6468578-6468600 TGTCAAATCCAGAAAAGGAAGGG - Intronic
1094070418 12:26406871-26406893 TGTCAAATACAAAAAGTGTATGG + Intronic
1095280195 12:40342254-40342276 AGTCAGATACTGAAAATGAAAGG - Intronic
1095343547 12:41121373-41121395 TTTGAAATCCTGGTAGTGAAGGG - Intergenic
1097656572 12:62370695-62370717 TGTCAAATTCTCAAAGGTAAAGG - Intronic
1103677606 12:122668472-122668494 TCTCAGGTCCTGAAAGTGCAGGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1105532623 13:21233346-21233368 TGTCAGAACATGAAAGGGAAAGG + Intergenic
1106013044 13:25843403-25843425 TGTCAAAACCTCAAACTGTAAGG + Intronic
1106434850 13:29714404-29714426 GGTCAAAGCCTGAAAATGCAGGG - Intergenic
1106451269 13:29884974-29884996 TTGAAAATCCTTAAAGTGAAAGG + Intergenic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1107380854 13:39855284-39855306 TGTCAAAACCACAAAGTGGAGGG - Intergenic
1109962763 13:69653940-69653962 TGCCTAATCCTGAAGCTGAATGG - Intergenic
1110383643 13:74882981-74883003 TGTAAAAGCCTCAAGGTGAAAGG + Intergenic
1111062290 13:83038041-83038063 TGCCAAATCCAGGAAGAGAATGG + Intergenic
1111760626 13:92459447-92459469 TGTCAAATCCAATAAGTGACAGG + Intronic
1112895451 13:104294119-104294141 TGACAAACGCTGAAAGAGAAAGG - Intergenic
1112935458 13:104792542-104792564 TTTCAAATAATGAAAGTGCAAGG + Intergenic
1115096713 14:29646409-29646431 GGATAAATCCTTAAAGTGAATGG + Intronic
1116325465 14:43528372-43528394 TGTCAAATGGTAAAAGTTAATGG - Intergenic
1116656318 14:47657851-47657873 TGTCATATCCTGCAAGTGTGGGG - Intronic
1118500252 14:66355687-66355709 TGTCAGCTCCTGAAAGGCAATGG - Intergenic
1118520218 14:66575227-66575249 TGAAAAATGCTGAAAGTGAGAGG - Intronic
1119762392 14:77160860-77160882 CCTCAAATCCTGGAAATGAAAGG - Intronic
1120936476 14:89900551-89900573 TGACAAAGCCTGAATGTGACAGG - Intronic
1123775736 15:23578240-23578262 TGTCAGATCCTGCAGGTGAGGGG + Intronic
1125922003 15:43530500-43530522 TGTCAAATGCTGGTATTGAATGG + Exonic
1127625788 15:60778906-60778928 TGTCTAAACCTGAAACTCAAAGG - Intronic
1130013687 15:80171822-80171844 TGTCAAGTCTTGAAAGGCAAAGG + Intronic
1130018789 15:80209565-80209587 TGTCAAAGCGTGAAGGTGTAAGG + Intergenic
1132828168 16:1915105-1915127 TGCCAAAGCCAGAAAGTGCAGGG + Intronic
1133437699 16:5793965-5793987 TGTAAAATCATGAAACTGCAAGG + Intergenic
1134317954 16:13137082-13137104 TGAAAACTCCTGAAAGGGAAAGG - Intronic
1134431176 16:14207940-14207962 TGTCAGATCCTACAAGTTAAAGG - Intronic
1140748461 16:78001950-78001972 TCTCTACTCCTGAAGGTGAAGGG - Intergenic
1142008813 16:87703424-87703446 TGTCACAGCCTGTAAGTGAATGG + Intronic
1142556062 17:778321-778343 TGTCAGATCCTGCAAGTTAAGGG - Intronic
1146549222 17:33765524-33765546 TTTCATTTCCTGAAAGTGACAGG - Intronic
1146613518 17:34331678-34331700 TCACAAATCCAGAAAGTGAACGG - Intergenic
1149431552 17:56598198-56598220 TTTCAAATACTGGAAGAGAATGG + Intergenic
1150668194 17:67165104-67165126 TGTACTATCCTGAAAGTGATTGG - Intronic
1150824122 17:68459554-68459576 TGTGAAATTCTGGAAGTAAAGGG + Intergenic
1151935899 17:77260932-77260954 TGAGAAATCCTGGAAGTTAAAGG - Intergenic
1154295691 18:13145078-13145100 TGTAAAACCCTGAAAGGAAAGGG + Intergenic
1155349260 18:24890594-24890616 GGTCATATGCCGAAAGTGAAGGG + Intergenic
1155813236 18:30266967-30266989 TGTGAAATTCAGGAAGTGAAGGG + Intergenic
1156953298 18:42931295-42931317 TATCAAATCCTTAAACTAAATGG + Intronic
1157867923 18:51202209-51202231 TGTCAAATCCTGCCATGGAAAGG - Intronic
1158153931 18:54404140-54404162 TGGCAAAACCTGACAGAGAAAGG - Intergenic
1158980263 18:62753691-62753713 TGTTATATCCTGAAAAGGAAGGG - Intronic
1162574324 19:11490015-11490037 CGTCAAATCCTCCAAGTTAAAGG + Intronic
1163299686 19:16436267-16436289 TGTGACAGTCTGAAAGTGAAGGG + Intronic
1164260489 19:23564883-23564905 AGTCAAATCATGAAGGTGAAGGG + Intronic
1165338613 19:35193727-35193749 TGTCAGATCCCAAAAGTTAAGGG + Intergenic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1166273534 19:41734310-41734332 TGTCAAATCCTGAGAGTAGAGGG - Intronic
1166278602 19:41774154-41774176 TGTCAAATCCTGAGAGTAGAGGG - Intergenic
1166398012 19:42456712-42456734 TGTCAAATCCTGAGAGTAGAGGG + Intergenic
1166413851 19:42577507-42577529 TGTCAAATCCTGAAAGTAGAGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166450730 19:42898410-42898432 TGTCAAATCCTGAAAGTAAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
1167501262 19:49850068-49850090 AGACAAATCCTGAAAGTAGAAGG - Intergenic
1202714161 1_KI270714v1_random:33300-33322 TGCCAGATCCTGGTAGTGAACGG - Intergenic
925023454 2:589310-589332 TCACAAATCCTTAAAGTAAATGG + Intergenic
925557978 2:5153188-5153210 TTTAAAATCCAAAAAGTGAATGG - Intergenic
925721856 2:6837388-6837410 TGTCATACCCTGAAAGTGCCAGG - Intergenic
926026406 2:9548980-9549002 TGTCAATGCATTAAAGTGAATGG - Intronic
926478893 2:13363351-13363373 TGTCCAATGCTGAATGTGCAGGG - Intergenic
929242660 2:39667401-39667423 AGTCAAGTTCTGAAAGTTAAAGG - Intronic
930205159 2:48580381-48580403 AGACATATGCTGAAAGTGAAAGG - Intronic
930402907 2:50913415-50913437 TGCCAAGTCCAGAAAATGAAAGG + Intronic
931571775 2:63676265-63676287 TTGCTAATTCTGAAAGTGAAAGG + Intronic
931576989 2:63728425-63728447 TGTATGATCCTGAGAGTGAAGGG + Intronic
937850765 2:126633237-126633259 TGTCCAATCCTAAAAATAAATGG + Intergenic
938739496 2:134217887-134217909 TGTCAAATCCTTTAAGGAAAGGG - Intronic
939733488 2:145814522-145814544 TGTCAAATTATCAAGGTGAATGG - Intergenic
941268355 2:163392515-163392537 TGTCAAATCCAGAGATTCAAAGG + Intergenic
942423784 2:175837706-175837728 TGTGAACTCCTGAAACTGGAAGG - Intergenic
942868397 2:180704773-180704795 TCTCATAGTCTGAAAGTGAAGGG - Intergenic
944317140 2:198295361-198295383 TTAAAAATCCTGAAAGTCAAAGG - Intronic
945548085 2:211182976-211182998 TGTAAAAGCCAGAAAGTGGACGG - Intergenic
946253488 2:218427780-218427802 TGTCAGGTCCTGAAAGTGCAAGG - Intronic
1169806597 20:9566330-9566352 TGTCAGACCCTGACAGTGGAGGG + Exonic
1169921558 20:10739726-10739748 GCTCAATTCCAGAAAGTGAAAGG - Intergenic
1170068016 20:12335581-12335603 TGTCAAATGCAAAAATTGAATGG + Intergenic
1170610948 20:17912777-17912799 TGACAAATGATTAAAGTGAAGGG - Intergenic
1173103589 20:40110414-40110436 TGTGAAATACTGACAGCGAAAGG + Intergenic
1177182823 21:17761769-17761791 TGTAAAAGCGTGAAAGGGAAGGG - Intergenic
1177626263 21:23664602-23664624 TGTTTATTCCTGAAAGTGAGTGG + Intergenic
1177728871 21:25002675-25002697 TGTTTATTCCTGAAAGTGAGTGG + Intergenic
1179201216 21:39223098-39223120 TGACAAATCCAAAATGTGAAAGG + Intronic
1179815553 21:43903943-43903965 TGGACAAGCCTGAAAGTGAAAGG - Intronic
1181375365 22:22453842-22453864 TTTCATATCCTGGAAGTTAATGG - Intergenic
1181853113 22:25764224-25764246 TTACAAATCCTTAAAGTGTAAGG - Intronic
1182583628 22:31330014-31330036 TGTGTAATTTTGAAAGTGAATGG - Intronic
949113013 3:285972-285994 TGTTCAATCTTGAAAGTGACAGG - Intronic
949659009 3:6255842-6255864 TGACAAAAACTGAAGGTGAAAGG + Intergenic
950173638 3:10856431-10856453 AGTTAAATCATGAAAGTGGAGGG - Intronic
950174893 3:10866231-10866253 GGTCAAGTCCTTAAAGGGAAGGG - Intronic
950902281 3:16508654-16508676 TGTCAAAAACTGAATGTGAATGG + Intronic
953759863 3:45678197-45678219 TGTGGAAGACTGAAAGTGAAGGG - Exonic
954527925 3:51289694-51289716 AGTCATACACTGAAAGTGAAGGG + Intronic
956117303 3:65931357-65931379 AGGCAAATCCACAAAGTGAAAGG - Intronic
956959251 3:74379071-74379093 TGTCAGTTCCTGAAAGAAAATGG - Intronic
959636149 3:108573473-108573495 TATCAAAACCTGAAAGAGAATGG - Intronic
960105788 3:113795162-113795184 TTGGAAATCCTGAAAGAGAAGGG + Exonic
960885461 3:122389479-122389501 AATAAAATCCTGGAAGTGAAGGG - Intronic
961682066 3:128606035-128606057 TGTGACATCCTGTAAATGAATGG + Intergenic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
963503444 3:146157287-146157309 TGTAAACTCTTCAAAGTGAAGGG - Intronic
964193070 3:154028691-154028713 TGTTAAATTCTGAAAGTTCAGGG - Intergenic
964688290 3:159421998-159422020 TGTTATCTTCTGAAAGTGAATGG + Intronic
965463694 3:169000760-169000782 TGTCATGTTCTGTAAGTGAATGG - Intergenic
965695053 3:171399826-171399848 TGGAAAATACTGAAAGAGAATGG - Intronic
966263573 3:178009870-178009892 TGTCTCATTCTGAAATTGAAAGG - Intergenic
966538147 3:181057388-181057410 TGTCAAAATCTGAAATGGAAAGG - Intergenic
969383875 4:6829621-6829643 TCCCACAGCCTGAAAGTGAATGG + Intronic
969828943 4:9780369-9780391 TGCCTAAACCTGAAACTGAAGGG - Intronic
970349398 4:15186256-15186278 TGAGAAATCTTGAAAATGAATGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
976194714 4:82521624-82521646 TGTAAGATGCTGAAAGGGAATGG + Intronic
977669788 4:99682788-99682810 TGTCAACACCAGAAAATGAATGG - Intergenic
978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG + Intergenic
980758456 4:137196581-137196603 TGTCAAATACTGGTGGTGAAAGG + Intergenic
981716436 4:147757148-147757170 TATCAGAACCTGAAAGTTAATGG + Intronic
983936533 4:173506706-173506728 CTTCAAATCCAGGAAGTGAAGGG - Intergenic
986812928 5:11379109-11379131 CTACAAATCCCGAAAGTGAAAGG + Intronic
987923631 5:24314121-24314143 TGTCTAATACTGACAGTGACAGG + Intergenic
987968416 5:24908269-24908291 TGTAAAATATTGAAAATGAATGG - Intergenic
990011072 5:50998836-50998858 TGTTAACTCTTGTAAGTGAACGG + Intergenic
990043403 5:51399093-51399115 GATCAACTCCTGAAAGAGAAGGG - Intergenic
990457087 5:55998415-55998437 TCTCAACTCCTAAAAGTGATGGG + Intergenic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
993140936 5:84032762-84032784 TGTATAATTCTGAAAGTGTAAGG - Intronic
996673389 5:126146688-126146710 TAGCAAATCCTGACAGTAAATGG + Intergenic
997543893 5:134689263-134689285 TGGCAATTCCTCAAAGTTAATGG + Intronic
997712475 5:136017411-136017433 AGTCAAATGATGAAAGAGAAAGG - Intergenic
997729208 5:136153578-136153600 GGTCAAGTCCTGAAAGAGAAAGG - Exonic
997857848 5:137389468-137389490 TGTCAAATCCACAAAGTCAGGGG - Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1003970097 6:11291010-11291032 TTTCACATGCTGGAAGTGAAAGG + Intronic
1004324400 6:14661429-14661451 AGTCAAAGAGTGAAAGTGAAGGG + Intergenic
1006824961 6:36928156-36928178 TGTCAAATCCTGACAGTTCCAGG - Intronic
1007242889 6:40439637-40439659 TGTCACTTCCTGAGAGTGTATGG - Intronic
1009881116 6:69567412-69567434 TGTCAAAACCTGAAAGTTCTGGG + Intergenic
1012103595 6:95123979-95124001 TTAGAAATCCTGAAAGAGAAAGG + Intergenic
1013019736 6:106201510-106201532 TGTCAAAGCCTAAAAGAAAAAGG + Intronic
1013360018 6:109385188-109385210 TGTCATATTCTTACAGTGAATGG - Intergenic
1013690844 6:112640945-112640967 AGAGAAATTCTGAAAGTGAAAGG + Intergenic
1013742147 6:113299830-113299852 TGGCCTATGCTGAAAGTGAAAGG - Intergenic
1014139510 6:117925316-117925338 TGTCAAATTCAGCAAGAGAAAGG - Intronic
1014690884 6:124562140-124562162 TTTCAAGTCCTGAAATTTAAAGG - Intronic
1015329964 6:131965687-131965709 TCTAAAATTCTGAAAGGGAAAGG + Intergenic
1015571824 6:134629690-134629712 TGTCACATCCTGAAAAGGAATGG + Intergenic
1015871130 6:137777568-137777590 TTTCAAATCATGAAAGGGATAGG + Intergenic
1016623441 6:146139389-146139411 TGTCCAATGCTGAAAGTACAGGG + Intronic
1018644763 6:165937217-165937239 TGTCTAATCCTGAATATGGAAGG + Intronic
1019111708 6:169722899-169722921 CGTCAAATGCTGGAAGTGCAAGG + Intronic
1021815661 7:24445302-24445324 TGTCAAATCCCGTATGCGAAAGG + Intergenic
1022999367 7:35791885-35791907 TCACAAATCGTGAAAGGGAAAGG + Intergenic
1023222568 7:37934391-37934413 AGTCAAAGACAGAAAGTGAAGGG + Intronic
1023239854 7:38132160-38132182 TCTTAAATCCAGAAAGTAAATGG + Intergenic
1023620119 7:42062653-42062675 TTTCAAATCCTGAAATTGCTTGG + Intronic
1026305725 7:69139648-69139670 TGTCAAATCCTTCAACAGAATGG + Intergenic
1028838880 7:95404734-95404756 TGTGGAAAGCTGAAAGTGAATGG - Intergenic
1029907924 7:104111031-104111053 TTTCAAATGCTGACAGTGAGAGG - Intergenic
1034644510 7:152633393-152633415 TGACACATCCTGAAAGTTTAGGG - Intergenic
1036982600 8:13487236-13487258 TGACAGATACTGAAAATGAATGG + Intronic
1037474102 8:19239249-19239271 TGTCAAATCCTGAATGAAGAGGG + Intergenic
1039121333 8:34151264-34151286 TGTCACATGCTGAAAGTCACGGG - Intergenic
1039682678 8:39759180-39759202 TGTCCAATACTGAAAGAAAATGG + Intronic
1040689137 8:49912936-49912958 AGTGAAATCCAGAAAGTGATAGG + Intronic
1041677627 8:60551322-60551344 TGGCTAATGCTGAAAATGAATGG + Intronic
1042716099 8:71774486-71774508 TGTAAAGTCCTGGAAGAGAAAGG + Intergenic
1043634680 8:82372599-82372621 TGTAATATCCAGAAAGGGAAAGG - Intergenic
1044132507 8:88542666-88542688 TGTGCTATCCTGAAAGTCAAAGG - Intergenic
1044489399 8:92794162-92794184 AATCAAATGCTGAAAGTGTAAGG + Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1047097993 8:121644299-121644321 TGTCAAAACCTGAAAGGGATGGG - Intergenic
1047820413 8:128513541-128513563 TTTCAAATCCAGGAAGTGATGGG + Intergenic
1048481311 8:134796324-134796346 TGTCAGATCCCGCAAGTGGAGGG - Intergenic
1048527114 8:135213305-135213327 TGGCAAATCATGAAAGGGCAAGG - Intergenic
1051944866 9:22555687-22555709 TCTCCAAGTCTGAAAGTGAAAGG + Intergenic
1051992322 9:23166410-23166432 TGTCTAATCCTGAAAGTGAGAGG - Intergenic
1052119827 9:24699035-24699057 TAGCAAAAACTGAAAGTGAAAGG - Intergenic
1053059302 9:35017207-35017229 AGTCAAACCCTGTAATTGAATGG + Intergenic
1054710556 9:68506763-68506785 TGTCTTGTCATGAAAGTGAATGG - Intronic
1055287526 9:74745204-74745226 TGTGAAATGCTTAAAGTGTATGG + Intronic
1055443890 9:76363758-76363780 TGTTTAATCCTGACAGTAAATGG + Intergenic
1055444019 9:76364916-76364938 TGTTTAATCCTGACAGTAAATGG - Intergenic
1057836029 9:98446007-98446029 TTTCAAATCCCTAGAGTGAATGG + Intronic
1058339882 9:103881554-103881576 TGTGAAATACAGAAAGAGAAGGG - Intergenic
1058715393 9:107718114-107718136 TGTCAAAGCCTGAAAGACATAGG - Intergenic
1059050452 9:110919063-110919085 TGTCAAATAGCAAAAGTGAAGGG + Intronic
1059056971 9:110993537-110993559 TGTCAAAGCCTGAAAGGTGAGGG + Intronic
1060378250 9:123138624-123138646 TGTCAAATCTTGAAGGAGGAAGG - Intronic
1061566833 9:131446386-131446408 TGTCACATCTGGAAATTGAAAGG - Exonic
1185966525 X:4611795-4611817 TGTCTAATGCTGAAATTGCAAGG + Intergenic
1186104837 X:6194456-6194478 TGCAAAATCCTGAGTGTGAAAGG - Intronic
1186981777 X:14964601-14964623 TGTCAAATCCCACAAGTTAAGGG - Intergenic
1188002846 X:24998408-24998430 ACTCAAATTCTAAAAGTGAATGG + Intergenic
1191071091 X:56400933-56400955 TTTCAACTCCTGACAGTGATGGG + Intergenic
1191659814 X:63637692-63637714 TGTCAACTTCTGAAAGCAAAGGG + Exonic
1191887564 X:65904371-65904393 TGTAAAATCCTGAATAGGAAGGG + Intergenic
1193433996 X:81449233-81449255 TATCACATCCTGAAAGCCAAAGG - Intergenic
1194419376 X:93654015-93654037 TGTCAAATACTGCAAGTGGAAGG - Intergenic
1194790554 X:98143789-98143811 TGTTATGTCCTGAAACTGAAAGG - Intergenic
1194941976 X:100021506-100021528 TTTCATATACTGAAAGTTAAAGG + Intergenic
1195135002 X:101896888-101896910 TGTTAAATCCTGAAAATACAGGG - Intronic
1195824107 X:108978571-108978593 CGTTAAATACTGAAAGTCAAGGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1198398243 X:136244365-136244387 TGCCAAGTCCTGAAGGTGGATGG + Intronic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1198977019 X:142347568-142347590 TGGCAAATGCTGAATGTGAAAGG - Intergenic
1200302598 X:154993046-154993068 TGGCAGGTCCTGAAAGAGAATGG - Exonic
1200326223 X:155242438-155242460 TGCCAAATCTTAAAAGAGAAAGG + Intergenic
1200820635 Y:7579166-7579188 TGTCTACTTCTGGAAGTGAATGG + Intergenic
1202239672 Y:22753576-22753598 TGTCTACTTCTGGAAGTGAATGG - Intergenic
1202392657 Y:24387338-24387360 TGTCTACTTCTGGAAGTGAATGG - Intergenic
1202478125 Y:25282779-25282801 TGTCTACTTCTGGAAGTGAATGG + Intergenic