ID: 1166466926

View in Genome Browser
Species Human (GRCh38)
Location 19:43040743-43040765
Sequence CAGTGAACACAGAGGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 4, 1: 0, 2: 5, 3: 28, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166466926_1166466931 26 Left 1166466926 19:43040743-43040765 CCAAACTTCCTCTGTGTTCACTG 0: 4
1: 0
2: 5
3: 28
4: 336
Right 1166466931 19:43040792-43040814 TGTTTCTCCCATCACAAGTGTGG 0: 1
1: 0
2: 1
3: 42
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166466926 Original CRISPR CAGTGAACACAGAGGAAGTT TGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900856993 1:5194234-5194256 CACTGAATAGACAGGAAGTTAGG - Intergenic
902348652 1:15837114-15837136 CACTGAACGAAGAGGAAGTGCGG - Intergenic
902608892 1:17585549-17585571 CCGTGGCCTCAGAGGAAGTTGGG + Intronic
902786026 1:18733302-18733324 CATTCAACACAGAGCGAGTTAGG + Intronic
904515319 1:31050130-31050152 CAGTGTAAACAAAAGAAGTTCGG - Intronic
907065013 1:51472524-51472546 CAGTTATAACAGAGGAAGTAGGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
911192158 1:94958953-94958975 CAGTGAACACAACAGAAGTCAGG - Intergenic
913143698 1:115967849-115967871 CAGTGAAAACATATGATGTTTGG - Intergenic
913393192 1:118337265-118337287 CAGTGAACTCAGAGAATTTTTGG - Intergenic
913417537 1:118628269-118628291 TAGTGAACTCAGTAGAAGTTAGG - Intergenic
915460307 1:156066603-156066625 CAGAGGACACACAGGAGGTTAGG + Intronic
916460959 1:165023771-165023793 CAGTGCACACACACGAAGTAGGG + Intergenic
917062360 1:171055267-171055289 AAGTGAGAACACAGGAAGTTTGG - Intronic
917376870 1:174358223-174358245 CAGAGAACAAAGAGAAGGTTTGG + Intronic
918079128 1:181192213-181192235 CAGGGAACACAGAAGATGTGAGG - Intergenic
918288019 1:183077637-183077659 CAGTGAGAACATAGGATGTTTGG + Intronic
918665883 1:187150401-187150423 CAGTGAAAACATAGGAACTCAGG + Intergenic
919569927 1:199235548-199235570 CAGAGAACACAGTGAAAGTGAGG + Intergenic
920944847 1:210518867-210518889 CAGAGAACAAATAGAAAGTTGGG + Intronic
921057031 1:211550062-211550084 CAGTCAACACAAGGCAAGTTGGG - Intergenic
921367430 1:214386929-214386951 CAGAGAACACAGAGGAGGTGGGG + Intronic
922182910 1:223249866-223249888 CAGTGAAAAGAGAGGAAGAAAGG + Intronic
923348364 1:233079751-233079773 CAGCGAACACAAAGGAAGGCTGG - Intronic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
1063502719 10:6569658-6569680 GAGGGAACACAGAGGAATTGGGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064865980 10:19880695-19880717 AAGTGAAGACAGATGATGTTGGG - Intronic
1064958297 10:20935854-20935876 CAGTGATAAGAGTGGAAGTTGGG - Intronic
1066343020 10:34554987-34555009 CACAGAACACAGAGGATTTTAGG + Intronic
1068307581 10:55233676-55233698 CAGTGAAGAGAGAGAAAGTGTGG + Intronic
1070338378 10:75474965-75474987 CAATGAACACAGAGTATGGTGGG - Intronic
1072392705 10:95004398-95004420 CAGTGAGAACATAAGAAGTTTGG + Intergenic
1072569373 10:96645271-96645293 CAGTCATAACAGAGGAAGTTTGG + Intronic
1072880914 10:99228579-99228601 CATAGAACAAAAAGGAAGTTAGG + Intronic
1074213136 10:111356765-111356787 AAGTGAAAAAAGAGGAAGTGAGG + Intergenic
1074280962 10:112051098-112051120 CAATGAAAAAAGAGGAAGCTGGG + Intergenic
1074786683 10:116848295-116848317 GAGAGAACACGGAGGAAGTTTGG + Intergenic
1075082812 10:119395319-119395341 CAGTGACCACAGAGGCAGCCAGG - Intronic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1078189195 11:9077563-9077585 CAGAGAACTCAGGAGAAGTTAGG + Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1078996997 11:16711950-16711972 CAGTGAGAACAGATGATGTTTGG + Intronic
1079109492 11:17596477-17596499 CAGTGCACACAGAGGAGGCTGGG + Intronic
1081101613 11:39008721-39008743 GAGTGAAAACATAGGATGTTTGG + Intergenic
1081484968 11:43520537-43520559 CAGACAACACAGAGGAATTAGGG - Intergenic
1082618035 11:55386243-55386265 CAGTGAACAATGAGAAAGTCTGG + Intergenic
1083157753 11:60835641-60835663 AAGTGAACAGAGAGGAAGGGAGG + Intergenic
1084220973 11:67678933-67678955 CAGTGAAAACATACGATGTTTGG - Intronic
1085244334 11:75087248-75087270 ATGTTGACACAGAGGAAGTTAGG + Intergenic
1085521074 11:77139217-77139239 CAGTGAACACATAGGAGATCTGG - Intronic
1086152910 11:83632484-83632506 CAGTCAGCACTGATGAAGTTTGG + Intronic
1086438610 11:86805885-86805907 CTGGGAACACAGCAGAAGTTAGG - Intronic
1089832989 11:121345534-121345556 CAGAGAACAGAGAGGATGCTGGG - Intergenic
1091383807 12:79144-79166 CCGAGAACACAGAGGGAGCTGGG + Intronic
1092402523 12:8188798-8188820 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1093193181 12:16098802-16098824 CAGGGAACACAGATGAGGTCTGG + Intergenic
1094124478 12:27008851-27008873 CATTGAAGACTGAGGAAGGTGGG + Intronic
1095335406 12:41018329-41018351 GAGTGAAAACAATGGAAGTTGGG - Intronic
1096074732 12:48795930-48795952 TAGTGAAGACTGAGGAAGTCTGG - Intergenic
1097316604 12:58178001-58178023 TAATGAACACAGATGAAGTAGGG - Intergenic
1097968357 12:65605416-65605438 CAGTGAACAATGAGGAAATGAGG + Intergenic
1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG + Intergenic
1098353564 12:69588069-69588091 TAGTAAAGACAGAGGAAGTAAGG - Intronic
1099160321 12:79233325-79233347 CAGTGAAAACACAGGAAACTGGG - Intronic
1100007239 12:89908988-89909010 CAGTGAGCACAAAGGAACCTAGG + Intergenic
1101578677 12:106021851-106021873 CAGTGAACAGAGAGGCAGAGAGG + Intergenic
1102452907 12:113055103-113055125 AAAGGAACACAGAGGAAGATGGG + Intergenic
1102625215 12:114229521-114229543 CAGTTAACACAGACTAAATTAGG - Intergenic
1103160359 12:118724207-118724229 CCTTGAACAATGAGGAAGTTAGG - Intergenic
1103935264 12:124472838-124472860 CAGTGAGCACCCAGGAACTTGGG + Intronic
1105059461 12:133135283-133135305 CAGTGACCAAATAGTAAGTTGGG + Intronic
1105413167 13:20188515-20188537 CAGAGGACACAGAGAAGGTTTGG - Exonic
1105738055 13:23292433-23292455 CAAAGAACAAAGAGAAAGTTGGG - Intronic
1108712737 13:53049802-53049824 CACTGAACTAAGAGGAGGTTTGG + Intronic
1108889015 13:55229563-55229585 CCTTGAATACAGAGGAGGTTGGG + Intergenic
1110507922 13:76310907-76310929 AATTGAACATAGAGGGAGTTCGG - Intergenic
1112639059 13:101252258-101252280 CAGAGAACAGAGAGGAAGAAGGG - Intronic
1113096373 13:106668326-106668348 GTGTGAACATAGAGGAAGCTGGG - Intergenic
1114053466 14:18943676-18943698 CAGTGAACACAGCACCAGTTGGG + Intergenic
1114109093 14:19458249-19458271 CAGTGAACACAGCACCAGTTGGG - Intergenic
1114166018 14:20219089-20219111 CAGTGAACACAGGGGAACTATGG + Intergenic
1114307980 14:21440866-21440888 CAGAGGACACAGAAGCAGTTAGG + Intronic
1115129988 14:30043174-30043196 CAGTGAGAACATAGGATGTTTGG + Intronic
1115296391 14:31831907-31831929 CAGGAAACATAGAGGAAGTAAGG + Intronic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1117784527 14:59268786-59268808 CAGAGAGCACAGAGGAAGACTGG - Intronic
1118548443 14:66920831-66920853 CAGTGAAAACATACGATGTTTGG + Intronic
1118555405 14:67013268-67013290 CAGGAAAAACATAGGAAGTTAGG - Intronic
1118721618 14:68598600-68598622 CCGTGGACTCAGAGGAATTTGGG - Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1120145855 14:80977618-80977640 AAGTGAAAAAAGAGGTAGTTTGG - Intronic
1120290871 14:82569226-82569248 CAGAGAACACAATGGAACTTTGG + Intergenic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1121010890 14:90519499-90519521 AAGTTAACACAGAGGATGGTGGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1124557607 15:30741761-30741783 CAGTGAGAACATAGGATGTTTGG - Intronic
1127554426 15:60073468-60073490 CAGGGCACTCACAGGAAGTTTGG + Intergenic
1127935274 15:63631308-63631330 CAGTGGAGACAGTGGAAGTTAGG - Intronic
1128510061 15:68307805-68307827 CAGGGGACAAAGAGAAAGTTGGG + Intronic
1128847550 15:70914638-70914660 TAGTGAATACAGAGGAATCTAGG + Intronic
1131546176 15:93317326-93317348 TAGTGAAAAAAGAGGAAGCTGGG + Intergenic
1133059198 16:3163526-3163548 TTGTGGACAAAGAGGAAGTTGGG + Intergenic
1136451663 16:30357299-30357321 CTGAGAACACAGAGCAAGGTGGG + Exonic
1137487515 16:48903871-48903893 AGGTGACCACAGAGGCAGTTTGG - Intergenic
1139044942 16:63046597-63046619 CAGTGAGAACATAGGATGTTTGG - Intergenic
1139751648 16:69112593-69112615 CAGTGACCACAGAGTAAATCAGG + Intronic
1140825040 16:78698200-78698222 CAGACAACACAGATGGAGTTTGG + Intronic
1141018411 16:80471660-80471682 TAGTGATCAGAGAGGAAGATGGG + Intergenic
1143108779 17:4542253-4542275 CAGTGAACACACAGGAGCTGAGG - Intronic
1144469024 17:15520362-15520384 AAGGGAACCCAGAGGACGTTAGG - Intronic
1144927338 17:18823309-18823331 AAGGGAACCCAGAGGACGTTAGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146530344 17:33603077-33603099 CATGGCACACAGAGGAAGATGGG - Intronic
1146804973 17:35857820-35857842 AAGGGAACATAGAGGAAGGTAGG + Intronic
1146922025 17:36720091-36720113 GAGTGCAACCAGAGGAAGTTTGG - Intergenic
1147488643 17:40843087-40843109 CAGTGAACAGAGAGAAGGATTGG - Intergenic
1149622132 17:58053713-58053735 TAGTGAAGTCAGAGGAAGATTGG - Intergenic
1152141000 17:78536698-78536720 GAGTGAACAGTCAGGAAGTTGGG + Intronic
1153069025 18:1083479-1083501 CAGTGAAAACATATGATGTTTGG + Intergenic
1153345070 18:4016807-4016829 CAGAGATCACACAGGAAGTAAGG - Intronic
1153700959 18:7692690-7692712 CAGTGAAAACAGAGGAAGATAGG - Intronic
1155289396 18:24325472-24325494 GAGTGAACCCTGAGGAAGTCTGG - Intronic
1156788833 18:40948083-40948105 CAGTGATCACAGAGCAACTATGG + Intergenic
1157792174 18:50542404-50542426 CAGTCAGCAGAGAGGGAGTTGGG - Intergenic
1161052213 19:2170457-2170479 CAGTCAACACAGAGGAGTTGCGG + Intronic
1164810656 19:31152738-31152760 AAGGAAGCACAGAGGAAGTTAGG - Intergenic
1165827970 19:38716433-38716455 CAGTGAAGACAGCGGCAGTGGGG + Intronic
1166260769 19:41639372-41639394 CAGTGAACACAGCGGAAATTTGG - Intronic
1166405874 19:42521636-42521658 CAGTGGACACAATGGAGGTTTGG - Intronic
1166419586 19:42626166-42626188 CAGTGACCACAGCGGGGGTTTGG - Intronic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1166431192 19:42729491-42729513 CAGTGAACATAGAGGGGGTTTGG - Intronic
1166434317 19:42754701-42754723 CAGTGAACATAGAGGGGGTTGGG - Intronic
1166438024 19:42786080-42786102 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166444199 19:42844727-42844749 CAGTGAACATAGAGGGGGTTCGG - Intronic
1166447164 19:42868469-42868491 CAGTGAACATAGAGGGGGTTGGG - Intronic
1166452015 19:42910293-42910315 CAGTGAACACAGCGGGGATTTGG - Intronic
1166454091 19:42926141-42926163 CAGTGAACATAGAGGGGATTTGG - Intronic
1166463877 19:43015484-43015506 CAGTGAACATAGAGGGGGTTTGG - Intronic
1166466926 19:43040743-43040765 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166470413 19:43075067-43075089 CAGTGAACACAGCGGGGATTTGG - Intronic
1166473057 19:43096818-43096840 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166481542 19:43178592-43178614 CAGTGAACACAGCGGGGATTTGG - Intronic
1166483639 19:43194708-43194730 CAGTGAACATAGAGGGAGTTTGG - Intronic
1166484013 19:43197710-43197732 CAGTGAACACAGCGGGGATTTGG - Intronic
1166486729 19:43220357-43220379 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166490751 19:43258570-43258592 CAGTGAACATAGAGGGACTTTGG - Intronic
1166493839 19:43283805-43283827 CAGTGAACACAGAAGAAATTTGG - Intergenic
1167189879 19:47978160-47978182 CAGTGAACCATGAAGAAGTTAGG - Intronic
1167252226 19:48405398-48405420 CAGTGAATACTGAGGTAGTTAGG - Intronic
1167708502 19:51096244-51096266 CAGTGAGAACATAGGATGTTCGG - Intergenic
1167857973 19:52257959-52257981 CAGTGAACTCTGAGGAACTGAGG - Intergenic
1168041973 19:53765956-53765978 CAGTTATCAGAGAGGAAGATGGG - Intergenic
925794101 2:7524417-7524439 AAATGGACACAGAGGAAGTGAGG - Intergenic
926271799 2:11372238-11372260 CAGAGAGCACACAGGAGGTTGGG - Intergenic
926401991 2:12506671-12506693 CAGTGACCAAAAAGCAAGTTTGG - Intergenic
926468517 2:13222515-13222537 AAGTAAATACATAGGAAGTTTGG - Intergenic
926827158 2:16916992-16917014 AAGGCAATACAGAGGAAGTTAGG + Intergenic
926852465 2:17214736-17214758 CAGTGGCCACAGGGGATGTTTGG + Intergenic
927267801 2:21172599-21172621 CATAGGACACAAAGGAAGTTTGG + Intergenic
927310940 2:21630524-21630546 CAGAGAACACAGAGGCAATCAGG + Intergenic
928477281 2:31641729-31641751 CAATGAACACAGAAAAAGTTTGG + Intergenic
928627177 2:33151696-33151718 CAGTGAAAACATACGATGTTTGG + Intronic
929209575 2:39340352-39340374 GAGTGAACACAGAGAAAGATAGG + Intronic
929687426 2:44046743-44046765 CAGTGAACACAGAGCACCTTGGG + Intergenic
929816548 2:45237483-45237505 CAGTGAACCCACAGGATGTGGGG + Intergenic
931193027 2:60023888-60023910 CAGTGAAATCAGAGGAGGTGAGG - Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
931616644 2:64165900-64165922 TAGTGAACACTGAGGGAGGTAGG - Intergenic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
935338180 2:102036024-102036046 CAGTGACCACAGCAGCAGTTCGG + Intergenic
937028374 2:118717903-118717925 CTGGGAACCCAGAGGACGTTGGG - Intergenic
937786292 2:125903421-125903443 CAGTGAAAGAAGAGGAAGTAAGG + Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938717505 2:134034503-134034525 GAGTGAGGACAGAGAAAGTTAGG - Intergenic
938928939 2:136069093-136069115 AGGTGAACACAGAGGTAGTAGGG + Intergenic
939410846 2:141822959-141822981 CCGTGAACAGAGCTGAAGTTGGG + Intronic
940157285 2:150671279-150671301 CAGTGAACACATATGATGTTTGG - Intergenic
940680798 2:156782706-156782728 CAGTGAGAACAGATGATGTTTGG - Intergenic
940857597 2:158741610-158741632 CAGCAAACACAGAGGACATTGGG + Intergenic
941627969 2:167850724-167850746 CAGTGAGCACACACGACGTTTGG - Intergenic
941724457 2:168845967-168845989 GAGAGAACTCAGAGGAAGGTGGG - Intronic
942382244 2:175403952-175403974 CAGTAAACACTGAGTAAGTATGG - Intergenic
942574982 2:177353693-177353715 CAGTGAGAACACAGGATGTTTGG + Intronic
943389113 2:187240305-187240327 AAGTGAGAACAGATGAAGTTAGG + Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944907397 2:204276185-204276207 AAGAGAACAGACAGGAAGTTAGG - Intergenic
945075645 2:206036490-206036512 CAGTGAGAACATAGGATGTTTGG - Intronic
945746980 2:213730308-213730330 TAGTGAATAAAGAAGAAGTTTGG + Intronic
947600896 2:231449418-231449440 CATTGAAAACACAGGTAGTTTGG - Intergenic
948267012 2:236642483-236642505 AAGTAAACACCGGGGAAGTTAGG + Intergenic
1169291787 20:4359181-4359203 CAGTGAAGAAAGAGGATGTTTGG - Intergenic
1170103622 20:12729387-12729409 CACTGATCACAAAGGAAGGTTGG - Intergenic
1170217961 20:13911719-13911741 AAGTGAATAAAGAGCAAGTTAGG + Intronic
1170401640 20:15991273-15991295 TAGTGAACACATAGCAAGTGAGG + Intronic
1170602413 20:17850823-17850845 CTTTGAACAATGAGGAAGTTAGG + Intergenic
1170718724 20:18856180-18856202 CCTTGGACTCAGAGGAAGTTGGG + Intergenic
1170999725 20:21400587-21400609 CATTGAAAACAGACGAAGATAGG + Intergenic
1171198104 20:23217280-23217302 GAGTGAGAACAGAGGATGTTTGG + Intergenic
1171558258 20:26097326-26097348 CAAAGACCACACAGGAAGTTTGG + Intergenic
1172395680 20:34602809-34602831 CAGGGAACATGGAGGAACTTGGG - Intronic
1172900383 20:38330446-38330468 CAGTGATCTCAGAGGAAGGGGGG - Intronic
1173954714 20:47022182-47022204 CAGTGACCACAGAACGAGTTTGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175069553 20:56321701-56321723 CAGTGAAGACATATGATGTTTGG - Intergenic
1175452703 20:59083701-59083723 CATTGAACATATAGGAATTTAGG - Intergenic
1178311148 21:31531090-31531112 CTGTGCACAGAGAGGACGTTGGG - Intronic
1180471935 22:15666057-15666079 CAGTGAACACAGCACCAGTTGGG + Intergenic
1181329861 22:22081560-22081582 AAGTGAACTAAGAGGAAGTGAGG + Intergenic
949367709 3:3301126-3301148 CAGTGAACAAGGAGGAAATTAGG - Intergenic
950844760 3:16003886-16003908 CATTGGAAACAGAGGAAGTGGGG + Intergenic
951956897 3:28266899-28266921 CAGTGAACACTGAGTACATTGGG + Intronic
952234011 3:31460547-31460569 CAGTGAAGGCAGAGGGTGTTGGG - Intergenic
952848182 3:37706085-37706107 AAATGAAACCAGAGGAAGTTTGG + Intronic
955047886 3:55377011-55377033 AAGCCAACACAGAGGAAGTAGGG - Intergenic
955054195 3:55441600-55441622 CTTTGAAAGCAGAGGAAGTTGGG + Intergenic
955309950 3:57875583-57875605 GAGTGCAAACAGAGAAAGTTTGG + Intronic
955573044 3:60328188-60328210 CACTGAACACAGAGTAAGGCAGG + Intronic
957840576 3:85663527-85663549 TAGTGAGCACAGAGGTTGTTGGG - Intronic
958480322 3:94637740-94637762 CAGTGAAAACATACGATGTTTGG + Intergenic
962279222 3:134037637-134037659 CACTGCACAGAGAAGAAGTTAGG - Intronic
963051108 3:141144778-141144800 CAGGCAACACACAGGGAGTTGGG + Intronic
963227260 3:142874896-142874918 TAGGGTACACAGAGGTAGTTAGG + Intronic
963559947 3:146852250-146852272 CAGGGAACAAAGATAAAGTTGGG + Intergenic
965353985 3:167651134-167651156 AAGTGAAAAAACAGGAAGTTGGG - Intronic
965357833 3:167698918-167698940 CACTGAAAACTGAGAAAGTTAGG - Intronic
965806647 3:172548932-172548954 CAGTGAATACAGAAAAAGTGGGG + Intergenic
965876688 3:173331691-173331713 CAGTGAAGAGAGAGGAAGCAAGG + Intergenic
969845873 4:9919638-9919660 GAGTGACCTCAGAGGCAGTTTGG + Intronic
969961854 4:10952495-10952517 CAGTGGACACATTGGATGTTGGG + Intergenic
972013884 4:34219823-34219845 CAGTGAGAACATAGGATGTTTGG - Intergenic
973309340 4:48690982-48691004 CAGTGAACACAGAGAAAAAGAGG - Intronic
973974810 4:56252440-56252462 CAGTGAACCCACAGAAAGTTAGG - Intronic
974226305 4:59049940-59049962 CAGTGAGCACAGGGAAAATTAGG - Intergenic
975558323 4:75686383-75686405 CAGTGAGAACAGAGGAAATGGGG + Intronic
975988744 4:80234461-80234483 CAGGGAAAAAACAGGAAGTTTGG - Intergenic
977053748 4:92163189-92163211 CAGTGAAGGGAAAGGAAGTTGGG - Intergenic
977993776 4:103477776-103477798 CAAGGAATACAGAGGAAGATGGG + Intergenic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
979772036 4:124538342-124538364 CAGGAAATACAGAGGAGGTTGGG + Intergenic
979958246 4:126982155-126982177 AAGAGAACACAGAGGATTTTAGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980823080 4:138041362-138041384 AAGTGATGACAGAGGATGTTTGG + Intergenic
981758149 4:148163555-148163577 AAGAGAGCACAGAGGACGTTAGG - Intronic
982899731 4:160983123-160983145 TAAAGAACACAGAGGAAGATAGG + Intergenic
982999659 4:162398280-162398302 CAGTGAGAACATAGGATGTTTGG - Intergenic
983534864 4:168846675-168846697 CAGTCTACCCAGAGGAAGATAGG + Intronic
983893937 4:173061239-173061261 AAGTGAAAACAGACGATGTTTGG + Intergenic
985564262 5:607421-607443 CAGTGAACACAGTTGAGGGTGGG - Intergenic
986097655 5:4575610-4575632 CAGTGAAGAAAGAGGGAGTTAGG - Intergenic
986299865 5:6469942-6469964 GAGTGAACACAGAGGACATTCGG + Intronic
986584004 5:9295417-9295439 AAGTGAACAAAGAGAAAGATGGG + Intronic
986630387 5:9766909-9766931 CAGTGATCAATGAGGAAGTGAGG - Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
990789624 5:59462678-59462700 CAGAGAGCAAATAGGAAGTTGGG + Intronic
993454222 5:88108877-88108899 CAGTGAGCAAACATGAAGTTTGG + Intergenic
993498196 5:88632199-88632221 CAGTGATTTTAGAGGAAGTTGGG - Intergenic
993560149 5:89396625-89396647 CAATGAAAACAGAGCATGTTAGG - Intergenic
995858874 5:116621126-116621148 CAGTGAGAACACACGAAGTTTGG - Intergenic
996663543 5:126031747-126031769 CAGTGAGAACATAAGAAGTTTGG - Intergenic
997876061 5:137548097-137548119 AAGTGAAAACATAGGAAATTTGG + Intronic
998660736 5:144234510-144234532 AAGTGAACACAGTGGCTGTTTGG + Intronic
998661645 5:144245533-144245555 CAGAGGACAAAGAGGAAGTGGGG + Intronic
998776809 5:145612693-145612715 CAGTGAAAACATACGATGTTTGG + Intronic
999572584 5:152937426-152937448 CAGTAAAGAATGAGGAAGTTGGG - Intergenic
1000713167 5:164606203-164606225 CAGTGAGAACATAGGATGTTTGG + Intergenic
1001917811 5:175576104-175576126 CTGAGAACCCAGAGGAAGTTGGG + Intergenic
1002461182 5:179374651-179374673 CAGAGAGCACAGAGGACGTCGGG + Intergenic
1003684115 6:8283683-8283705 CAGTTATCAAAGAGGAATTTTGG - Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005073111 6:21880986-21881008 CAGTGAGAACAGACGATGTTTGG - Intergenic
1006413819 6:33891965-33891987 CAGTAAAAAGAGAGGAGGTTTGG - Intergenic
1007275063 6:40667271-40667293 CAGTGAATACAGAGGTGGGTGGG - Intergenic
1008403787 6:51096262-51096284 CAGTGAACACGGAGGTGGTGTGG - Intergenic
1008566986 6:52778170-52778192 CAGAGAACACAGAGTGATTTAGG - Intergenic
1008568923 6:52796130-52796152 CAGAGAACACAGAGTGATTTAGG - Intronic
1008570533 6:52812235-52812257 CAGAGAACACAGAGTGATTTCGG - Intergenic
1008580477 6:52902294-52902316 CAGAGAACACAGAGTGATTTAGG - Intronic
1008730123 6:54472105-54472127 TAGGGAACTCAGAGGAAGTCAGG - Intergenic
1009934832 6:70221724-70221746 GAGTGCACAAAGAGGAAGTCAGG + Intronic
1010715020 6:79218478-79218500 CAGTGAACACAAATGAACTACGG + Intronic
1011774707 6:90716626-90716648 CACTTCACACAAAGGAAGTTGGG - Intergenic
1013402712 6:109814610-109814632 CATTGAATACACAGGACGTTAGG - Intronic
1013773207 6:113650429-113650451 CAGTCCCCACAGAGAAAGTTTGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017550242 6:155498171-155498193 CAGTGGTTACAGAGGGAGTTTGG + Intergenic
1017635664 6:156440581-156440603 CAATGAACAGAGAGTATGTTAGG - Intergenic
1018634601 6:165849657-165849679 CAGAGAGCTCAGAGGAAGTGGGG + Intronic
1019074123 6:169373372-169373394 CAGTGAGAACATAGGAGGTTTGG - Intergenic
1022777471 7:33542563-33542585 CAGTGAAAACATATGATGTTTGG + Intronic
1023290414 7:38662681-38662703 CTGTGATCAGAGAGGACGTTTGG - Intergenic
1024629848 7:51238100-51238122 CAGTGACCAGAGAGGACGCTGGG + Intronic
1024779726 7:52833936-52833958 CAATGTACAGAGAGGCAGTTTGG + Intergenic
1025099858 7:56125183-56125205 CAGTGAACACTGAGCAACCTGGG + Intergenic
1026235777 7:68526069-68526091 CAGTGAGAACATAGGATGTTTGG - Intergenic
1026244844 7:68610801-68610823 CAGTGAACTCAGATGAAATGAGG + Intergenic
1027484521 7:78743923-78743945 GTGTGATCAAAGAGGAAGTTAGG - Intronic
1029350237 7:100008232-100008254 CATTGGACACAGATGAATTTAGG - Intergenic
1029884359 7:103851243-103851265 CAGTGAAAACATACGATGTTTGG - Intronic
1029891729 7:103936825-103936847 GAGTGAACACATGGAAAGTTAGG - Intronic
1030333256 7:108295809-108295831 CACTGACCACAGAGGTACTTTGG - Intronic
1032268352 7:130383586-130383608 CAGTGACCACAGAGGACATGGGG + Intronic
1033268030 7:139903178-139903200 CAGTGAGAACATAGGATGTTTGG + Intronic
1034294671 7:149961766-149961788 AAGTGTACACATAGGAAGTGTGG + Intergenic
1034294681 7:149961847-149961869 AAGTATACACAGAGGAAGTATGG + Intergenic
1034294691 7:149961928-149961950 AAGTATACACAGAGGAAGTATGG + Intergenic
1034811374 7:154135024-154135046 AAGTATACACAGAGGAAGTATGG - Intronic
1034811384 7:154135105-154135127 AAGTGTACACATAGGAAGTGTGG - Intronic
1035121347 7:156570533-156570555 CAGTGAAAACATACGATGTTTGG - Intergenic
1035291919 7:157844704-157844726 CCGGGAACACAGAGCAACTTAGG - Intronic
1035949538 8:4005045-4005067 CAGTGAGAACATAGGATGTTTGG - Intronic
1036345775 8:7961559-7961581 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1036539733 8:9694349-9694371 CAGTGAACTCACAGTGAGTTAGG + Intronic
1036613470 8:10370400-10370422 CAGTGAAGAAATAGCAAGTTAGG + Intronic
1036637351 8:10560501-10560523 CAGTGAAATCTGAAGAAGTTAGG - Intergenic
1036862910 8:12368565-12368587 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1038054082 8:23841649-23841671 CACTGAACAGAAAGAAAGTTGGG + Intergenic
1038183437 8:25249900-25249922 CAATGAAAAGAGATGAAGTTGGG - Intronic
1039074743 8:33679911-33679933 CAGTGAGAACATAGGATGTTTGG - Intergenic
1041081874 8:54222027-54222049 GAGTGAGCACACAGGAAGGTGGG - Intergenic
1041562693 8:59238051-59238073 CAGACTATACAGAGGAAGTTAGG + Intergenic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1042200488 8:66275935-66275957 CAGTGAAGACAGAGTAGTTTCGG - Intergenic
1042204455 8:66314251-66314273 CAGTAAACACACAATAAGTTAGG - Intergenic
1042237899 8:66633300-66633322 CAGTGAACAGAGAAGAATATGGG + Exonic
1042533407 8:69835996-69836018 CACTGGACACACAGGAGGTTTGG + Intergenic
1042676761 8:71329966-71329988 ATTTGAACACAGACGAAGTTAGG + Intronic
1042943013 8:74126470-74126492 CAGGGAACACACAGGAGGGTGGG - Intergenic
1043255580 8:78132755-78132777 GAATGTACACAGGGGAAGTTAGG - Intergenic
1043816411 8:84807247-84807269 CAGTGAACACATACGATGTTTGG + Intronic
1044511174 8:93080778-93080800 CAGTGAAGGGAGAGGAACTTAGG - Intergenic
1045512865 8:102827181-102827203 ACCTGAACACAGAGTAAGTTAGG + Exonic
1047291287 8:123532504-123532526 CTATGAACACAGAGGGAATTGGG + Intronic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048950679 8:139494228-139494250 CAGTGTACATCCAGGAAGTTGGG + Intergenic
1049666050 8:143843169-143843191 AAGTGACCTCAGAGGATGTTTGG - Intergenic
1053300883 9:36948654-36948676 CAGTAAAAACAGAGAAAGTCTGG + Intronic
1053436692 9:38080257-38080279 CAGAGATCACAGAGGATGTCAGG - Intergenic
1055754057 9:79538357-79538379 CAGTAAAAAGAGAGAAAGTTTGG + Intergenic
1056173320 9:84009364-84009386 CACTCAACCCAGAGGAAGGTAGG + Intergenic
1056215262 9:84400445-84400467 CAGTGAAGAAAGAGTAGGTTTGG + Intergenic
1056467860 9:86876670-86876692 CAGAGAACAGAGAGAAAGCTGGG - Intergenic
1057216483 9:93231525-93231547 CCCTGACCACAGAGGAACTTGGG + Intronic
1057522984 9:95774925-95774947 AAGTGAACACAGGGAAAGCTGGG + Intergenic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1059079535 9:111233720-111233742 CAGTGAAGAAGGACGAAGTTTGG - Intergenic
1059926693 9:119216871-119216893 AACTGAAAACAGATGAAGTTTGG + Intronic
1060031919 9:120221986-120222008 CAGTGCTCCCAGAGGAAGCTAGG - Intergenic
1062731289 9:138111509-138111531 AAGGGAGCACAGAGGAATTTGGG + Intronic
1185715615 X:2339622-2339644 CAGTGACAACAGACGATGTTTGG + Intronic
1185879786 X:3730941-3730963 AAGTGAAAACAGAGGAATTTCGG + Intergenic
1185955308 X:4482749-4482771 GAGTGAAAACATAGGATGTTTGG - Intergenic
1186076717 X:5887584-5887606 GTGAGAAGACAGAGGAAGTTGGG - Intronic
1187089468 X:16080193-16080215 CAGTAAACCCAGAAGAACTTAGG + Intergenic
1187500717 X:19836293-19836315 CAGGGAAAACAGAGTAATTTAGG + Intronic
1189904413 X:45743110-45743132 CAGTGAACGCAGAGGTTCTTCGG - Intergenic
1192120244 X:68448499-68448521 CAGTGAACCCAGAGGTAGAGAGG + Intergenic
1193052311 X:77114769-77114791 CAGTGAACACAGTGGGCTTTGGG - Intergenic
1194434830 X:93856615-93856637 CAGTGAAGAGAGAGGAAGCTGGG - Intergenic
1194737660 X:97532349-97532371 GAGTGAATGCAGAGGCAGTTTGG + Intronic
1195746617 X:108124920-108124942 AAGGGAACACAGAGAAAGTAGGG - Intronic
1195775219 X:108396170-108396192 GAGTGGACAGAGTGGAAGTTGGG + Intronic
1196960289 X:120993311-120993333 CAGGAAACACACAGGAGGTTGGG - Intergenic
1197599945 X:128517327-128517349 TACTGAAGACAGAGGAAGCTGGG + Intergenic
1199373501 X:147080241-147080263 CAGAGAACAAGAAGGAAGTTTGG + Intergenic
1199684950 X:150257527-150257549 CAGTTAGCATAGAGGAAGTAGGG - Intergenic
1200237208 X:154473395-154473417 CAGACAACACTGAGGACGTTTGG - Exonic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic