ID: 1166476401

View in Genome Browser
Species Human (GRCh38)
Location 19:43129479-43129501
Sequence TTCTTCAGTCTTCCGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166476398_1166476401 0 Left 1166476398 19:43129456-43129478 CCGGTGTAATTACCTAGGAGGAT No data
Right 1166476401 19:43129479-43129501 TTCTTCAGTCTTCCGTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166476401 Original CRISPR TTCTTCAGTCTTCCGTAAGG AGG Intronic