ID: 1166482749

View in Genome Browser
Species Human (GRCh38)
Location 19:43187325-43187347
Sequence GCCATGTCCCGCGGGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166482749_1166482756 -3 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482756 19:43187345-43187367 GGCTCGTTGAGACGCAGGAGGGG No data
1166482749_1166482753 -8 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482753 19:43187340-43187362 GACATGGCTCGTTGAGACGCAGG No data
1166482749_1166482764 29 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482764 19:43187377-43187399 ACAGAGCAGGGGTTCAGAGCTGG No data
1166482749_1166482757 -2 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482757 19:43187346-43187368 GCTCGTTGAGACGCAGGAGGGGG No data
1166482749_1166482758 5 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482758 19:43187353-43187375 GAGACGCAGGAGGGGGAGCCTGG No data
1166482749_1166482755 -4 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482755 19:43187344-43187366 TGGCTCGTTGAGACGCAGGAGGG No data
1166482749_1166482761 17 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482761 19:43187365-43187387 GGGGAGCCTGGGACAGAGCAGGG No data
1166482749_1166482754 -5 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482754 19:43187343-43187365 ATGGCTCGTTGAGACGCAGGAGG No data
1166482749_1166482759 6 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482759 19:43187354-43187376 AGACGCAGGAGGGGGAGCCTGGG No data
1166482749_1166482762 18 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482762 19:43187366-43187388 GGGAGCCTGGGACAGAGCAGGGG No data
1166482749_1166482760 16 Left 1166482749 19:43187325-43187347 CCAGGAACCCCGCGGGACATGGC No data
Right 1166482760 19:43187364-43187386 GGGGGAGCCTGGGACAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166482749 Original CRISPR GCCATGTCCCGCGGGGTTCC TGG (reversed) Intronic