ID: 1166482991

View in Genome Browser
Species Human (GRCh38)
Location 19:43188535-43188557
Sequence CAGAAGAGGGAGCAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1163
Summary {0: 1, 1: 7, 2: 19, 3: 121, 4: 1015}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166482980_1166482991 27 Left 1166482980 19:43188485-43188507 CCCTGGGGGCAGTGATGTCTGGG No data
Right 1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG 0: 1
1: 7
2: 19
3: 121
4: 1015
1166482982_1166482991 26 Left 1166482982 19:43188486-43188508 CCTGGGGGCAGTGATGTCTGGGG 0: 8
1: 4
2: 1
3: 28
4: 300
Right 1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG 0: 1
1: 7
2: 19
3: 121
4: 1015

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166482991 Original CRISPR CAGAAGAGGGAGCAGCAGGA TGG Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900320654 1:2081840-2081862 CAGCACAGAGGGCAGCAGGAAGG - Intronic
900652272 1:3735465-3735487 CAGAACACGGAGCAGCCAGATGG + Exonic
900779572 1:4609022-4609044 CAGCAGAGGGAGCAGCAAGGGGG - Intergenic
901045238 1:6392394-6392416 CAGAATCGGAAGCAGCAGGCTGG - Intronic
901061284 1:6473146-6473168 GACAAGATGGAGCAGCTGGAGGG - Exonic
901627247 1:10631296-10631318 CAGCAGAGGGAGGGGCAGGGCGG - Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902441417 1:16432605-16432627 GAGAAGAGGGAGGAGCTTGAAGG - Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902617101 1:17629811-17629833 CCGAAGAGGGAGCCGAAGGTGGG - Intronic
902695563 1:18138506-18138528 CCCAGGAGGTAGCAGCAGGAGGG + Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902951962 1:19891680-19891702 CAAGAGAGAGGGCAGCAGGAGGG + Intronic
903004772 1:20291418-20291440 GAGAAGAGGGAGCAGGAGAAGGG - Intronic
903237270 1:21958157-21958179 CAGAAGGTGGGGCAGCAAGAGGG - Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904376268 1:30084348-30084370 CAGAGGAGGGAGCAGAAGGTGGG + Intergenic
904409391 1:30315921-30315943 CAGAAGGGGGAGGAGAAGGGAGG - Intergenic
904435016 1:30489258-30489280 CAGAGCAGGTAGCAGCAGTAGGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904769464 1:32872670-32872692 CAGCACAGGAACCAGCAGGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
904998624 1:34650762-34650784 GAGCTGAGGAAGCAGCAGGAAGG + Intergenic
905002541 1:34684419-34684441 CAGAGAAGGGAGCAGCTGGGGGG - Intergenic
905022703 1:34828704-34828726 CAGAGGATGGGGCAGCAGAAGGG - Intronic
905058702 1:35121172-35121194 CAGAAGAGGTGGCGGCAGGAGGG - Intergenic
905349223 1:37333107-37333129 CAGAGGAGTGAGCTGCAGGCAGG - Intergenic
905388987 1:37624294-37624316 CATAACAGGCAGCAGCAGGAGGG - Intronic
905471181 1:38193267-38193289 AGGCAGAGGGAACAGCAGGAAGG + Intergenic
905693472 1:39958913-39958935 CAGAAGGGTGAGGAGAAGGAAGG + Intronic
905793676 1:40803423-40803445 CAGCAGAGGGAGAAGCAGAAGGG - Intronic
906556499 1:46718622-46718644 CAGGAGAGGTGGCGGCAGGAGGG + Exonic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906843969 1:49169977-49169999 CAGAAGGGGGAAGAGCAGGAGGG + Intronic
906874778 1:49525577-49525599 AAGAGGAGGGGGCAACAGGAAGG + Intronic
907248695 1:53123642-53123664 CAGAGGAGGGCACAGCTGGATGG + Intronic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907413479 1:54298343-54298365 CTGACGAGGGGGCAGCAGGAAGG + Intronic
907455367 1:54572092-54572114 CAGAAGAGAGGCGAGCAGGAAGG - Intronic
907528614 1:55070360-55070382 CAGAAGAGGCAGTACTAGGAAGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907759368 1:57342916-57342938 CCAAAGAGTGAGCAGCAGCAAGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
910069553 1:83195289-83195311 CAGGTGTGGGAACAGCAGGAAGG - Intergenic
910209705 1:84780355-84780377 CAGAAGAAAGAACAGCAGGTTGG + Intergenic
910471455 1:87557603-87557625 CAGAAGAGGGAAGTGAAGGATGG - Intergenic
911008753 1:93255777-93255799 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
911164350 1:94711895-94711917 CTGAAGAGGACGCAGCAGCAAGG - Intergenic
911568903 1:99498440-99498462 CAGCAGCTGGAGCAGAAGGAAGG + Intergenic
912449668 1:109761214-109761236 AGGAAGAAGTAGCAGCAGGATGG - Intronic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912500950 1:110121559-110121581 GAGAGGAGGGACCAGCAGGACGG - Intergenic
912614453 1:111084127-111084149 CAGGAGAGAGAGAAGCATGAAGG - Intergenic
912793373 1:112674807-112674829 GAGATGAGGGTGCAGCAGGAGGG - Intronic
912812250 1:112803189-112803211 CAGACGAGTGGGCACCAGGAGGG - Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913179919 1:116311453-116311475 CAGAAGAGGGAAGAGCAGACTGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913264812 1:117033923-117033945 CAGAAGGAGGAGCAGGACGAAGG - Exonic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
914508595 1:148310303-148310325 CAGAAGCGGCAGCAGCCGGCGGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915038623 1:152949020-152949042 CAGGAGAGGCAGCACCAGGCTGG + Intergenic
915142359 1:153775505-153775527 CAGCAGGGGCAGCAGCAGGAGGG - Exonic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915191869 1:154157601-154157623 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915328395 1:155093123-155093145 CAGAAGAGGGAGGAGGTGGGAGG + Intergenic
915527885 1:156487375-156487397 CAGAAGTGGGAGCAGCAGTGGGG - Intronic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916002096 1:160626861-160626883 CAGCTTAGGGTGCAGCAGGAAGG - Intronic
916579820 1:166097186-166097208 GAGTAGAGGAAGCAGCAGAAAGG + Intronic
917580167 1:176368941-176368963 CAGAAGAGGCAGCACCTGGCAGG + Intergenic
918316852 1:183329690-183329712 AAGAAAAGGTAGGAGCAGGAAGG - Intronic
918618957 1:186580559-186580581 CAAAAGCTGGAGCAGCATGATGG - Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918906217 1:190499105-190499127 AGGAAGATGGAGCAGCAGCAAGG + Intergenic
918912604 1:190592847-190592869 GAGCAGAGGTAGAAGCAGGAGGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919841110 1:201610045-201610067 CAGAAGAAGGAGCAGAGAGAAGG + Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920269343 1:204751637-204751659 CAGACGAGGGAGCAGTGGGAGGG - Intergenic
920299945 1:204982541-204982563 CCGCAGCGGGAGCACCAGGAGGG - Intronic
920737942 1:208552241-208552263 GAGAAAAGGAAGCAGAAGGAAGG - Intergenic
920890433 1:209979595-209979617 GAGAGTAGGGGGCAGCAGGAGGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
922082250 1:222308609-222308631 CCTAAGGGGGAGAAGCAGGAGGG + Intergenic
922157596 1:223052275-223052297 GAGAAGAGGAGGGAGCAGGAAGG - Intergenic
922195215 1:223353736-223353758 CAGAGGAAGGGGCAGCAGCAGGG + Intronic
922232810 1:223701195-223701217 CTGCAGAGCGGGCAGCAGGATGG + Intergenic
922233346 1:223704956-223704978 TGGAACAGGGAGCGGCAGGAGGG - Intronic
922574897 1:226654982-226655004 GAGAAGGGAGAGCAGGAGGAGGG + Intronic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922674701 1:227543110-227543132 AAGAAGAGGGGGCGCCAGGAAGG - Intergenic
922722687 1:227906646-227906668 AGGGAGAGGGAGGAGCAGGAAGG - Intergenic
922793112 1:228321509-228321531 AAGGAGATGAAGCAGCAGGAAGG + Exonic
922825056 1:228512065-228512087 AAGAAGAGGGAGGGGCAGGGGGG - Intergenic
923193323 1:231641506-231641528 CCAAAGAGTGAGCAGCAGCAAGG + Intronic
923221224 1:231895918-231895940 TAGACCAGGGAGCAGCATGAAGG - Intronic
923676654 1:236086343-236086365 CTTAAGAGGGAGGAGCAAGATGG - Intergenic
923977823 1:239284553-239284575 CATAAGCGGGAGCAGAAAGAGGG - Intergenic
924302428 1:242652674-242652696 GAGTAGAGGTAGCAGCAGAAGGG - Intergenic
924538337 1:244957726-244957748 GGGAAGAGGGAGCAGGGGGAGGG - Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1063220002 10:3958309-3958331 GAGAAGTGAGAGCAGCAGGATGG + Intergenic
1063266689 10:4459106-4459128 CAGAAGAGGAAGCAGAGGTAGGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064040789 10:11961498-11961520 CAGAAGAGGGAAGAGGAGGGAGG + Intronic
1064116986 10:12586663-12586685 CTGGTGAGGGGGCAGCAGGAGGG - Intronic
1064176485 10:13079796-13079818 GAGAAGAGAGAGCAGCAGCGTGG + Intronic
1065086040 10:22177870-22177892 CAGAAGAGGAAGCAGAAGAAAGG + Intergenic
1065206065 10:23358819-23358841 CAGAAGAGGAACCAGCACCAAGG + Intergenic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1067009605 10:42698043-42698065 GAGAAGAGGGAGAAGAAGAAGGG - Intergenic
1067054184 10:43041699-43041721 CAGAAGAGCGTGCTGAAGGAGGG + Intergenic
1067133040 10:43583576-43583598 CAGAAGAGAAAGCAGGAGAATGG + Intergenic
1067173306 10:43925012-43925034 CTTCAGCGGGAGCAGCAGGAGGG - Intergenic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067337511 10:45377328-45377350 CAGAAGAGGGGGCAGAATGTAGG - Intronic
1067482118 10:46608708-46608730 CAAAAGAGGTAACAGTAGGATGG - Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067612631 10:47732959-47732981 CAAAAGAGGTAACAGTAGGATGG + Intergenic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068776338 10:60872294-60872316 CAGAAAAGTGAGCAAAAGGAGGG + Intronic
1069061300 10:63897356-63897378 CAGAAGAGAGAGTAGCTGTATGG - Intergenic
1069214566 10:65803645-65803667 AAGAAGAGGGAGCAGGAGAGTGG - Intergenic
1069234933 10:66059151-66059173 CAGAGGGGGGAGTATCAGGAAGG + Intronic
1069432285 10:68348529-68348551 AAAAAAAGGCAGCAGCAGGAAGG + Intronic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1069949762 10:72010778-72010800 CAGAGGAGGGAGCAGTGGGGAGG - Exonic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070522078 10:77262692-77262714 CAAGAGAGGGAGCAGGAGCAAGG - Intronic
1070782686 10:79146738-79146760 CGGAAGCGGGAGCAGAGGGAGGG - Intronic
1071170815 10:82861850-82861872 CAGAAGAGGAGGTTGCAGGAAGG - Intronic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1071412101 10:85407107-85407129 CAAATGAGAGAGAAGCAGGAGGG - Intergenic
1071476653 10:86031405-86031427 CAAAAGGGGGGGCAGGAGGAGGG + Intronic
1071628056 10:87193202-87193224 CAAAAGAGGTAACAGTAGGATGG + Intergenic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071984140 10:91033886-91033908 CAGAATAGTTAGCAGCAGCATGG - Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073407337 10:103309425-103309447 CAGAAGAGAGAGAATAAGGAGGG - Intronic
1073547393 10:104362577-104362599 GAGATGGGGGAGCAGGAGGAGGG - Intronic
1073827047 10:107336420-107336442 CAGGAGAGGGAAGAGCAGGAAGG - Intergenic
1073893330 10:108124708-108124730 CAGAGGAGGCAGCAACAGTATGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074527924 10:114277851-114277873 AAGATGAGGGGGCAGGAGGAGGG + Intronic
1074533579 10:114313109-114313131 TGGGAGAGGGGGCAGCAGGAAGG + Intronic
1075021805 10:118957619-118957641 CAGAAGCTGGAAGAGCAGGAAGG + Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075810013 10:125218499-125218521 CAGAAGAGGGAGCATCAGCAGGG - Intergenic
1076105985 10:127824117-127824139 AAGCAGAGGGAGAAGCAGCATGG + Intergenic
1076251568 10:128988076-128988098 CAGAAGGTGGGGCAGCAAGAGGG + Intergenic
1076426178 10:130369256-130369278 GGGAAGAGGGAGCAGGAGGGAGG + Intergenic
1076429048 10:130388855-130388877 GGGAAGAGGGAGGAGCAGGAGGG + Intergenic
1076612720 10:131736723-131736745 CAGAGGAGGGAGAGCCAGGATGG + Intergenic
1076696873 10:132251296-132251318 GAGGAGAGGGAGCAGAGGGACGG + Intronic
1076825533 10:132965458-132965480 GAGAAGTGGGAACCGCAGGAAGG - Intergenic
1076825554 10:132965559-132965581 GAGAAGTGGGAACGGCAGGAAGG - Intergenic
1076825590 10:132965766-132965788 GAGAATTGGGAACAGCAGGAAGG - Intergenic
1077557228 11:3231546-3231568 GAGGAGAGGGAGGAGAAGGAGGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078183660 11:9032957-9032979 CAGCCGTGGGAGCAGCACGAGGG + Intronic
1078550841 11:12279671-12279693 CAGCAGAGAGAGAGGCAGGAAGG - Intronic
1078887447 11:15518491-15518513 ACGAAGATGGACCAGCAGGAAGG + Intergenic
1079077156 11:17391052-17391074 CAGAAGGGTGAGCAGCAGGGAGG - Intergenic
1079105911 11:17572323-17572345 GAGAAGGAGGAGCAGCAGGGAGG + Intronic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1080000754 11:27346408-27346430 CAGAAGAGAGGGAAACAGGAGGG + Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080474210 11:32574630-32574652 GATAAGAGGAAGGAGCAGGAAGG + Intergenic
1080638183 11:34141671-34141693 CAGAAGATGAAGGAGCAGCAGGG - Intronic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081006898 11:37755753-37755775 CAGATGAAGGACCAGCAGGCTGG - Intergenic
1081180724 11:39983519-39983541 CAGAAGGTGAAGCAGGAGGAGGG - Intergenic
1081524246 11:43913940-43913962 CAGAAGAGGGGGCAGCACTGGGG + Intronic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081831060 11:46114813-46114835 GAGGAGAAGGAGCAGCAGAAAGG - Intronic
1081879538 11:46436441-46436463 CCGAAGAGGGACCACAAGGATGG + Intronic
1081904347 11:46657780-46657802 CCTAAGAGGGAGCAGAAAGAAGG - Intronic
1082140649 11:48604338-48604360 GAGAAGAAGTGGCAGCAGGAGGG - Intergenic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083642698 11:64153944-64153966 CAGAGGAGGGGGCAGCTGCAGGG - Intronic
1083712951 11:64560000-64560022 CAGGAGGGGGAGCGGGAGGAGGG - Intronic
1084374978 11:68770373-68770395 CAGGAGATGGAACAGCAGAAAGG - Intronic
1084437087 11:69149347-69149369 CCAAAGAGTGAGCAGCAGCAAGG + Intergenic
1084437874 11:69154808-69154830 CACAGGAGGGAGGAGCAGGGAGG + Intergenic
1084975115 11:72792815-72792837 CAGATGAGGGGGCAGCACTAAGG - Intronic
1085250606 11:75141163-75141185 CAGATGAGTGAACAGGAGGAAGG + Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085440624 11:76559360-76559382 TAGAAGAGGAAGAAGCAGGTAGG + Intergenic
1086056117 11:82649068-82649090 GAGAAGAAGGAGCAGAAGAAAGG - Intergenic
1086064223 11:82730017-82730039 CAGAAGGTGAAGCAGCAGGAAGG + Exonic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1088084910 11:105965807-105965829 CAGAGGAAGGGGCTGCAGGATGG + Intronic
1088828579 11:113516141-113516163 GAGAAGAGAGAGCAGGAGGGAGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089202609 11:116733506-116733528 GAGAAGAGGGAGCCCCAGGCTGG + Intergenic
1089283521 11:117391180-117391202 CAGCTGAGGGAGCAGCTGGAAGG + Exonic
1089459601 11:118644832-118644854 CAGAAGAGAGGCCAGCTGGAGGG - Intronic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1089920262 11:122203093-122203115 CACAAGGGGGAGCCGCCGGAGGG - Intergenic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090142270 11:124277559-124277581 CAGAAGAGGGAGCCACAAGAAGG + Intergenic
1090204862 11:124878500-124878522 AAGGGGAGGGGGCAGCAGGAAGG + Intronic
1090402844 11:126460097-126460119 GAGGAGCGGGAGCAGGAGGAGGG + Intronic
1090618780 11:128542365-128542387 GAGAAGAGGGAGGAAGAGGAGGG + Intronic
1090657411 11:128856480-128856502 CAGAAGAGGGAGCAGGGGAGGGG + Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091800719 12:3323054-3323076 GAGAGGAGGGAGAAGAAGGAAGG + Intergenic
1091933692 12:4417667-4417689 CGGGAGGAGGAGCAGCAGGAGGG - Intergenic
1092091005 12:5803672-5803694 CGGAAGAGGGAGCAGCGTGGGGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092286259 12:7130653-7130675 CAGAAGGGGCAGCAGCAGGAGGG - Exonic
1092743826 12:11654634-11654656 GAGAAGAGGAAGTAGTAGGAGGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093214134 12:16343274-16343296 CATGTGAGGAAGCAGCAGGAAGG + Intergenic
1093561971 12:20552511-20552533 GAGGAGGAGGAGCAGCAGGAGGG + Intronic
1093687026 12:22068411-22068433 AAGATGAGGGAGCAGCTGGTTGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094197853 12:27767834-27767856 AAGAAGAGGGAGTAGTGGGAAGG + Intronic
1095343337 12:41118766-41118788 TAGAAGAGGGAGCAGGGGAAGGG + Intergenic
1096509434 12:52119614-52119636 CAGGAGGAGGGGCAGCAGGAGGG - Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096629693 12:52918113-52918135 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096817075 12:54208532-54208554 GAAAAGAGAGGGCAGCAGGATGG + Intergenic
1096956758 12:55534319-55534341 GAGTAGAGGAAGCAGCAGAAAGG + Intergenic
1097172797 12:57127180-57127202 CAGAAACAGGAGCAGCACGAAGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098727846 12:73991145-73991167 TAGAAGAGGGAGCAGACGGAAGG + Intergenic
1098922184 12:76312867-76312889 AAAAAGAGGGAGCAGCGGGCTGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099252398 12:80272542-80272564 CAGAAGAGGGAGGGCCAGGGAGG - Intronic
1099720378 12:86354873-86354895 CCAAAGAGTGAGCAGCAGCAAGG + Intronic
1099948453 12:89272510-89272532 CAGGAGAGAGAGGATCAGGAAGG - Intergenic
1101791872 12:107934960-107934982 CAGAAGAGGGACCACCAGCAGGG - Intergenic
1102069883 12:110009671-110009693 CAGATGAGAGAGATGCAGGAAGG + Intronic
1102230371 12:111257649-111257671 GGGAAGAGGGAGGAGGAGGAAGG - Intronic
1102353699 12:112214445-112214467 CAGAAGAGGGTCTAGCAGGTAGG + Intronic
1102424009 12:112826258-112826280 ATGTTGAGGGAGCAGCAGGAAGG + Intronic
1102624042 12:114220324-114220346 AACAAGAGGGAGCAGGAAGATGG - Intergenic
1102749878 12:115283251-115283273 CAGAAGATGGCCAAGCAGGAGGG - Intergenic
1102773584 12:115499597-115499619 CAGTGGAGGCAGCAGCAAGAGGG - Intergenic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103345633 12:120248241-120248263 TAGAAGAGGGGGCTGGAGGATGG + Intronic
1103668263 12:122589576-122589598 CAGGAGGCTGAGCAGCAGGAGGG - Intronic
1103915703 12:124374575-124374597 CAGGAGAGCGAGCAGCAGCGAGG - Intronic
1104040525 12:125127245-125127267 CAGCAGAGTGAGCAGCAGGAAGG + Intronic
1104714336 12:131006466-131006488 CTGAAAAGGGAGGAGCAGGTGGG + Intronic
1104981985 12:132577279-132577301 CAGAACAGGGAGCCCCAGGGAGG - Intronic
1105014184 12:132776194-132776216 CACAGGCGGGAGCAGCAGGGAGG - Intronic
1105014249 12:132776509-132776531 CACAGGCGGGAGCAGCAGGGAGG - Intronic
1105014266 12:132776588-132776610 CACAGGCGGGAGCAGCAGGGAGG - Intronic
1105306440 13:19172383-19172405 CAGCAGTGGCAGCAGCAGCAGGG - Intergenic
1105657450 13:22456499-22456521 GAGAAGGGTGGGCAGCAGGAAGG - Intergenic
1105943266 13:25170073-25170095 CCGGAGAAGGAGCAGCAGGAAGG - Exonic
1106485296 13:30167085-30167107 CAGAAGTGGGAGCAGCAGCAAGG - Intergenic
1106504304 13:30357658-30357680 CAGTAGTGGGAGCATCTGGAAGG - Intergenic
1106938247 13:34747739-34747761 CAGTAGAGGAAGCAGCAGAAAGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107550313 13:41468401-41468423 CAGGAGAGTGAGGAGCAGGAAGG - Intronic
1107585835 13:41847508-41847530 CAGTAGAGGGTCCAGCAGGAAGG + Intronic
1107975462 13:45683968-45683990 CAGCAGAGGGAGCAGCAGCAGGG - Intergenic
1108564719 13:51684476-51684498 AAAAAGAGTAAGCAGCAGGAGGG - Intronic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1109386810 13:61640469-61640491 CAGAAGCGAGGGGAGCAGGATGG - Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1112184804 13:97117368-97117390 CAGAAGACAGAGTTGCAGGAAGG + Intergenic
1112737985 13:102442965-102442987 GAGTAGAGGAAGCAGCAGAAAGG + Intergenic
1113017740 13:105847000-105847022 CACAAGTGTGAGCAGAAGGAAGG + Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113108421 13:106796348-106796370 CAGAGGAGGCGGCAGCAGGGAGG - Intergenic
1113181231 13:107629599-107629621 GAGAAGAGAGAGCAACTGGAAGG - Intronic
1113499229 13:110760176-110760198 CAGAGGAGGAAGCAGCAGGCAGG + Intergenic
1113640243 13:111952179-111952201 CGGTGGAGGGACCAGCAGGAAGG + Intergenic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1113933465 13:113980916-113980938 GAGAGGAGTGAGCAGGAGGATGG + Intronic
1114482428 14:23044101-23044123 CTCCAGAGGGAGCATCAGGAAGG - Exonic
1114624749 14:24121531-24121553 CAGAACAGGGGGCCTCAGGAAGG + Intronic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115103044 14:29726228-29726250 CAGTAGGGGCAGCAGCAGAAGGG - Intronic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116658157 14:47675731-47675753 TAGAGGAGGGAGCCGCAGAAGGG + Intergenic
1117070831 14:52054209-52054231 CAGAAGAGTGGGCAGCGGAAAGG + Exonic
1118459528 14:65975954-65975976 GAGGAGAGGGAGGAGAAGGAGGG + Intronic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1118606939 14:67511383-67511405 TAGAAGATGGAGCAGCCGGAAGG + Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119182528 14:72614432-72614454 CAGAGGGGAGAGGAGCAGGATGG + Intergenic
1119380229 14:74223845-74223867 CAGGCCAGGGAGCAGCAGCAGGG - Intergenic
1119558651 14:75572430-75572452 CAGGAGAGGCTGCAGCAGGGTGG + Intergenic
1119918531 14:78425272-78425294 GAGAAGAGGGAGCATGTGGAAGG + Intronic
1119937248 14:78603202-78603224 CAGGAAAGAGAGCAGCAGGTGGG - Intronic
1119964508 14:78899202-78899224 AAGAAGAGGGAGGAGAGGGAGGG + Intronic
1120265133 14:82239058-82239080 CAATAGGGGGAGAAGCAGGAAGG + Intergenic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120880800 14:89413941-89413963 GAGAAGGGGGAGGAGGAGGAGGG + Intronic
1120998475 14:90434692-90434714 CAGAGGAAGGGGCAGCAGGGCGG + Intergenic
1121011456 14:90522586-90522608 CAGAAGAGCGGACAGCACGAGGG + Intergenic
1121080467 14:91103884-91103906 CAGAAGTGGGAGCTGGAGGTGGG - Intronic
1121082432 14:91119204-91119226 CAGAAAAGGGAGCAACAAGATGG - Intronic
1121251445 14:92502741-92502763 CAGACGAGGGAGCAGCGGTTCGG + Intergenic
1121581431 14:95035060-95035082 CAGAAAAGGCAGCTGCAGCAGGG + Intergenic
1121803774 14:96797150-96797172 AAGACCAGGGAGCAGAAGGACGG + Intergenic
1122198134 14:100105055-100105077 CAGTAGATGGAGCAGCAAGGAGG - Intronic
1122350588 14:101087673-101087695 GAGAGGAGGAAGCAGCAGGAGGG + Intergenic
1122406157 14:101502308-101502330 CAGATGATGGAGCAGCAGCAAGG + Intergenic
1122777902 14:104130876-104130898 GAGAAGAGGCAGGAACAGGAGGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123130487 14:105981745-105981767 AAGAAGAGGAAGCAGGAGGGAGG - Intergenic
1123899461 15:24862304-24862326 CAGATGAGGTAGAAGCAGCATGG + Intronic
1124279454 15:28350543-28350565 GAGAAGATGGGGGAGCAGGAGGG - Intergenic
1124303244 15:28561065-28561087 GAGAAGATGGGGGAGCAGGAGGG + Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125104793 15:35957865-35957887 CAGAAAAGGGGGTGGCAGGAAGG + Intergenic
1125158247 15:36614216-36614238 CAGAGGGAGGAGCAGCAGCAGGG - Intronic
1126346246 15:47697256-47697278 CAGAACAGAGAACTGCAGGAAGG + Intronic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126928740 15:53622622-53622644 CTGAGGAGGGAGCAGGGGGAGGG + Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127121952 15:55779586-55779608 CAGAAGAGAGAACAGCATGGGGG + Intergenic
1127471694 15:59295955-59295977 CTAAAGAGGGGGCAGGAGGAGGG + Intronic
1127541282 15:59941369-59941391 CAGAAGAGGGAGCAGTGGGGTGG - Intergenic
1127650957 15:61006600-61006622 CAGAGGAAGGAGCAACAGCATGG - Intronic
1128549122 15:68586432-68586454 CTGAGGAGGGAGCAACAGGCCGG + Intronic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128930986 15:71704768-71704790 CAGACCAGGGAGAAGCATGATGG + Intronic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1129698002 15:77751605-77751627 CAGAGGAGGGAGGGCCAGGATGG - Intronic
1129716190 15:77852482-77852504 CAGAAGAGAGAGGAAAAGGAGGG + Intergenic
1129845645 15:78766589-78766611 CCGTGGAGGGCGCAGCAGGATGG + Exonic
1130036170 15:80363375-80363397 CAGAACAGTGAGGAGCAGCAGGG - Intronic
1130256212 15:82327272-82327294 CCGTGGAGGGCGCAGCAGGACGG - Intergenic
1130598741 15:85262715-85262737 CCGTGGAGGGCGCAGCAGGACGG + Intergenic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131325752 15:91442452-91442474 AAAAACAGGGGGCAGCAGGAAGG + Intergenic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132078947 15:98848058-98848080 TAGAAGAGCTAGCAGCTGGAGGG + Intronic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132898875 16:2242764-2242786 CAGAAGTGGGCGGGGCAGGAAGG + Intronic
1132951014 16:2562509-2562531 CAGCCGAAGGAGCTGCAGGATGG - Intronic
1132963335 16:2637661-2637683 CAGCCGAAGGAGCTGCAGGATGG + Intergenic
1133484374 16:6204571-6204593 TAGAAGTGGGAGCATCATGATGG + Intronic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133725579 16:8534420-8534442 GAGAAGTGGGAGCAGGTGGAGGG + Intergenic
1133926937 16:10200875-10200897 CAGAGGAGGGAGAAGCCTGATGG + Intergenic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134231601 16:12434432-12434454 CAGAAGGGGGAGCAGGGCGAGGG + Intronic
1134378447 16:13701574-13701596 CAGAAGAGGCAGGATCATGAAGG + Intergenic
1136007486 16:27340952-27340974 GAGGAGAGTGAGCAGCAGGAGGG + Intronic
1137003113 16:35248653-35248675 CAGAAGAGGGAAAAACAAGAAGG - Intergenic
1137016906 16:35386179-35386201 CAGAAGAGGGAAAAACAAGAAGG - Intergenic
1137029135 16:35506233-35506255 GACAAGAGGGAGGAGCAAGAAGG + Intergenic
1137462789 16:48680532-48680554 CAGCATTGGGAGCAGAAGGAAGG - Intergenic
1137515486 16:49140018-49140040 GTGAAGAGGGTGCAGCAAGAAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137592303 16:49700937-49700959 CAGAGGAGGGAGGAGAAGGGAGG + Intronic
1137704993 16:50528907-50528929 GAGAAGAGGTAGCAGCAGCAGGG - Intergenic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1138335923 16:56252780-56252802 CACAAGAAGGAACAGCTGGATGG - Intronic
1138364498 16:56463085-56463107 GAGAAGAGGGAGCAGGGAGAAGG - Intronic
1138499490 16:57430507-57430529 CAGAAGTGGGAGGAGGATGAGGG + Intronic
1138576240 16:57908912-57908934 CAGGAGAGTGAGCAGAGGGAGGG - Intronic
1138798078 16:59993697-59993719 GAGTAGAGGAAGCAGCAGAAAGG - Intergenic
1139147884 16:64344864-64344886 CCAAAGAGGGAGCAGCAGCAAGG - Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140433133 16:74921946-74921968 CAGTGGAGGAAGCAGAAGGAAGG - Exonic
1140534922 16:75700957-75700979 CAAAAGAGGAAGCAGTAGGGAGG + Intronic
1140675422 16:77324165-77324187 CAGAAGAGGAAGTAAAAGGAGGG + Intronic
1140869721 16:79095455-79095477 AAGAGGTGGGGGCAGCAGGATGG + Intronic
1140924014 16:79565645-79565667 CAGAAGGGGAAGCAACATGAAGG - Intergenic
1141433023 16:83980682-83980704 CAGAAGAGGGTGCAGCAGGTAGG - Intronic
1141606287 16:85155445-85155467 AAGAAGGGGAAGGAGCAGGAAGG + Intergenic
1142237216 16:88927954-88927976 CTGAAGTGGGAGCCGCAGGGAGG + Intronic
1142239950 16:88940600-88940622 CAGGAGGGAGAGGAGCAGGAGGG + Intronic
1142248177 16:88979210-88979232 CAGAGGTGGGGGCAGCAGGAGGG + Intergenic
1142431349 16:90029631-90029653 AACAAGAAGGAGCAGCAGGAGGG - Intronic
1142514285 17:416888-416910 CAGGAGAGAGTGGAGCAGGAAGG + Intronic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1143030676 17:3965215-3965237 CAGAGGAGGAAGTCGCAGGAAGG + Intergenic
1143303506 17:5928292-5928314 CAGAAGCCTGAGCAGCAGGCTGG + Intronic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143655474 17:8291216-8291238 CAGGTGAGGGAGTGGCAGGAGGG - Intronic
1143848461 17:9791249-9791271 CAGCAGGGGGAGCATCAGCATGG + Exonic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144137754 17:12314615-12314637 CACCAGTGGCAGCAGCAGGAGGG + Intergenic
1144188098 17:12815204-12815226 TAGAAGAGGGAGGAGAAGCAGGG + Intronic
1144360508 17:14487324-14487346 CAGCAGGGGGAGCAGTGGGAAGG + Intergenic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1145230991 17:21173028-21173050 CAGAAGATGTAGCAGCGGGTGGG - Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147507103 17:41029729-41029751 CAGCAGTGGCAGCAGCAGGCTGG + Exonic
1147537864 17:41332647-41332669 GAGAAGAGGGAGGTGGAGGAAGG + Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148212017 17:45814329-45814351 CAGTTAAGGGGGCAGCAGGAAGG - Intronic
1148217466 17:45840823-45840845 CTGAGGAGAGAGCAGCTGGAGGG + Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149074683 17:52581063-52581085 CCGAAGAGTGAGCGGCAGCAAGG - Intergenic
1150289917 17:63975196-63975218 CTGGAGAGGGAGCATCAGTAGGG - Intergenic
1151048299 17:70947719-70947741 AAGTAGAGGAAGCAGCAGAAAGG + Intergenic
1151145230 17:72034394-72034416 GAGAGGAGGGGGAAGCAGGAGGG - Intergenic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151353749 17:73546412-73546434 AAGAGGAGGGAGCCGCAGGCAGG + Intronic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1151418488 17:73982298-73982320 GAGAAGAGGGAGCAAGGGGAGGG + Intergenic
1151769041 17:76147682-76147704 CTGAGGAGGGAGCAGCAGCAGGG - Intronic
1151815693 17:76470380-76470402 GAGAGTGGGGAGCAGCAGGATGG + Intergenic
1151817958 17:76480790-76480812 CAGAAGACACAGCAGCAGGCAGG - Intronic
1151869046 17:76824187-76824209 CTGAAGAGGGAAATGCAGGATGG - Intergenic
1151925951 17:77196954-77196976 CAGCAGAGAGAGCTGCCGGAAGG - Intronic
1152278175 17:79370076-79370098 CAGAGCAGGGAGCATCAGGAAGG - Intronic
1152291446 17:79442190-79442212 CAGAAGAGAGAGGAGGAGGGAGG + Intronic
1152517999 17:80837333-80837355 CACACCAGGGAGCAGCAGGGGGG + Intronic
1152566689 17:81103479-81103501 CTGAAGTGGAAGCAGCAGGAAGG - Intronic
1153458111 18:5300852-5300874 CAGAAAAGGGAGTTCCAGGAAGG - Intergenic
1153471974 18:5456926-5456948 GAGAAGCTGGAGCAGCAGGGAGG + Intronic
1153778981 18:8477947-8477969 CAGCAGTGGAAGCAGCAGGAAGG + Intergenic
1153924098 18:9817909-9817931 CACTAGAGGTAGCAGCTGGATGG - Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154132709 18:11750705-11750727 CTGAGGTGGGAGCAGCAGGAGGG + Intronic
1154268536 18:12899485-12899507 GAGAGGAGGCAGCAGCAGAAGGG + Intronic
1155086884 18:22467597-22467619 CAGTTGCAGGAGCAGCAGGAGGG + Intergenic
1155354426 18:24937628-24937650 CATAACATGGAGCAGCAGGTCGG - Intergenic
1155545178 18:26907293-26907315 CAGAAGATGGAGTAGATGGATGG + Exonic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1156336563 18:36178115-36178137 CCGAGGAGGGAGAAACAGGAAGG - Intronic
1156445262 18:37231875-37231897 GAGATGAGGGAGCTGGAGGAGGG + Intronic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157759675 18:50251918-50251940 AACAAGAGGGAGCAGCAGGGAGG + Intronic
1157799166 18:50604984-50605006 GAGCAGAGGGTGCAGGAGGATGG + Intronic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159874952 18:73800626-73800648 CAGCAGAGGCAGCAGCTGGACGG + Intergenic
1159941192 18:74410292-74410314 CGGCAGAGGGAACCGCAGGAGGG - Intergenic
1159959551 18:74545034-74545056 CAGAAGCTGGAGGGGCAGGAAGG + Intronic
1160016107 18:75141853-75141875 CAGGAGAGCCTGCAGCAGGAAGG - Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160819835 19:1052671-1052693 GAGAAGGGGGAGGAGTAGGAGGG + Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160965635 19:1745934-1745956 GAGAAGGGGGAGTAGAAGGAAGG + Intergenic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161256842 19:3314501-3314523 GAGAAGAGAGAGAGGCAGGAGGG - Intergenic
1161350673 19:3789669-3789691 CAGAAGGGGTAGCCTCAGGAGGG + Intronic
1161557799 19:4954413-4954435 GAGGAGGAGGAGCAGCAGGAGGG + Exonic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161715492 19:5873948-5873970 CAGACCAGGTAGCAGCAGGAAGG + Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162028057 19:7905327-7905349 CAGGAGAGGGAGGGACAGGAGGG - Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162595946 19:11629370-11629392 CAGAAGCAGGAGGAGCAAGATGG + Intergenic
1162835485 19:13314490-13314512 CAGAAGGTGGAGGAGCAAGAGGG - Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163233750 19:16019687-16019709 AGGCAGAGGGAGGAGCAGGAAGG + Intergenic
1163358576 19:16830604-16830626 CCTAAGAGGGGGCAGCAGTATGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1164057393 19:21633291-21633313 CAGATGATCCAGCAGCAGGACGG + Intergenic
1165015870 19:32879614-32879636 GGGAATGGGGAGCAGCAGGACGG + Intronic
1165158786 19:33803880-33803902 CACAAGGGGGAGCATCAGGATGG - Intronic
1165255827 19:34576843-34576865 GAGTAGAGGCAGCAGCAGGGCGG + Intergenic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165702711 19:37950702-37950724 CAGCGGAGGGAGCAGCAGACGGG - Intronic
1166243023 19:41506913-41506935 CAGAGGGAGGAGCAGCAGCAGGG - Intergenic
1166416611 19:42599881-42599903 CAGAAGAGGGAGGTGCAGGGCGG + Intronic
1166422826 19:42652050-42652072 CAGAAGAGGGAGGTACAGGGTGG - Intronic
1166433081 19:42742525-42742547 AAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166446058 19:42857778-42857800 GAGAAGAGGGAGCAGCAGAGTGG + Intronic
1166453439 19:42919930-42919952 CAGAAGAGGGAGCAGCAGCGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166465718 19:43028515-43028537 AAGAAGACGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166764605 19:45245355-45245377 CAGCAGCGGGAACAGAAGGACGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167714241 19:51130924-51130946 CAGAAGAAGGCCCAGGAGGAGGG - Intronic
1167720139 19:51173803-51173825 GTAAGGAGGGAGCAGCAGGAAGG + Intergenic
1167785216 19:51630306-51630328 CAGCAGGGGCAGCAGCAGCAGGG + Intronic
1167787315 19:51646730-51646752 CAGCAGGGGCAGCAGCAGCAGGG + Exonic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168631117 19:57956922-57956944 CAGGAGCTGGGGCAGCAGGAGGG - Intergenic
924979712 2:208247-208269 CACGTGAGGGAACAGCAGGAAGG + Intergenic
925145912 2:1583275-1583297 CAGAAGAGTGACCAGCGGGAGGG - Intergenic
925302827 2:2829107-2829129 TAGCAGAGAGAGCAGCAGGCAGG + Intergenic
925578913 2:5389903-5389925 CAGAAGTGGGAACAGGAGCAGGG - Intergenic
925920304 2:8633494-8633516 CAGAAGACTGTGCAGCTGGAAGG - Intergenic
926212196 2:10879296-10879318 CAGCAGCTGGAGGAGCAGGAAGG - Intergenic
926289217 2:11515532-11515554 CAGCAGAGGAAGCAGCCAGATGG - Intergenic
926309218 2:11662329-11662351 CAGCAGAAGGAGCGGCAGAAGGG + Intronic
926314057 2:11696793-11696815 CAGAGCATGAAGCAGCAGGAAGG - Intronic
926422097 2:12709938-12709960 GAGAACAGGGAGTGGCAGGAAGG + Intergenic
926442457 2:12904095-12904117 AAGTAGAGGGAACAGCAAGAAGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926796665 2:16625269-16625291 CAGCAGGGGCAGCAGCAAGAGGG + Intronic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927669408 2:25056616-25056638 CAGAAGAGGGAAAAACAGCAGGG + Intronic
927766116 2:25809887-25809909 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
927853543 2:26514306-26514328 AAGAAGCGGGAGCAAAAGGAGGG - Intronic
927874055 2:26642630-26642652 GAGAACAGGGCGGAGCAGGATGG + Intergenic
927879400 2:26679986-26680008 GAGAAGCTGGAGGAGCAGGAGGG + Intergenic
927932760 2:27055841-27055863 CAGAAACAGGAGCATCAGGAGGG - Exonic
928593599 2:32840405-32840427 CCAAAGAGGCAGCAGCAGGAAGG + Intergenic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
928970383 2:37021984-37022006 AAGAAGAAAGAACAGCAGGAAGG - Intronic
929072652 2:38049243-38049265 AAGAAAAGGGAGTAGAAGGAAGG + Intronic
929534927 2:42775670-42775692 CAGCAGAGGGTGCAGGAGAAAGG - Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930601863 2:53453051-53453073 CAGAAAGGAGAGCAGCAGGATGG + Intergenic
931196748 2:60058997-60059019 AAGAAGAGGAAGTACCAGGATGG + Intergenic
931687957 2:64810692-64810714 CAGATGAGGATGCAGCAAGAAGG + Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931929169 2:67109754-67109776 CAGAAGAGAAGGCAGCATGATGG - Intergenic
932090082 2:68798753-68798775 CAGAAAAGGGGGAAGCAGAATGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932491654 2:72126778-72126800 CAGAAGAGGAAACTTCAGGAAGG + Intergenic
933154107 2:78952170-78952192 GAGGAGAGGGAGCAGAATGAAGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
934564337 2:95330126-95330148 GAGAAGAGGCAGGAGCAGGAAGG + Intronic
934739242 2:96707232-96707254 CAAAAGTGGTGGCAGCAGGAGGG + Exonic
935104087 2:100023525-100023547 CAGAAGAGGGAGAAACAGCAAGG + Intronic
935198580 2:100836150-100836172 CATAAACGGTAGCAGCAGGAAGG - Intronic
935446862 2:103166478-103166500 CAGGGGAGGGGGCCGCAGGAGGG + Intergenic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
935953554 2:108352541-108352563 CAGAGGAGAAAGCACCAGGAGGG + Intergenic
936015851 2:108958552-108958574 CAGTAGAGAGGGCAGAAGGACGG + Intronic
936248010 2:110845262-110845284 CAGAAGGGAGAGGAGCAAGAGGG + Intronic
936266964 2:111018225-111018247 CGGAGGAGGGAGCAGCGGGGAGG + Intronic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936349617 2:111702869-111702891 TAGAAGAGAGATCAGGAGGAGGG - Intergenic
936618711 2:114073527-114073549 GGGAAGAGGGAGGAGCAGCAGGG + Intergenic
936956927 2:118031761-118031783 CAGAAGAGGAGGGAGCAGGAAGG + Intergenic
937025185 2:118691813-118691835 CAGAAAAGGGACCAGTTGGAGGG + Intergenic
937312740 2:120912017-120912039 CAGTAGGGGGACCAGGAGGAGGG - Intronic
937343200 2:121104980-121105002 CAGCAGGAGGAGCAGCAGGCCGG + Intergenic
937381338 2:121380237-121380259 TATATGAGGGAGCAGCAGGACGG + Intronic
937552319 2:123108925-123108947 AGGGAGAGGGAGGAGCAGGATGG - Intergenic
938116667 2:128607060-128607082 GAGAAGTGGGAGCTGCTGGAGGG - Intergenic
938768468 2:134479825-134479847 GAGAAGTGGAAGCAGCAGGGTGG - Intronic
939566048 2:143787796-143787818 CAGAAGAGAGAGCAGCACAGTGG + Intergenic
940322586 2:152392554-152392576 CAGATGAGGATGCAGCAAGAGGG - Intronic
940416286 2:153425170-153425192 AAGAAGAGGTAGGAGCAGGAAGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
940815211 2:158290150-158290172 CAGGAGAGGGAGCTGAAGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941605815 2:167595124-167595146 CAGGAGAGGATGCAGCAGGCTGG + Intergenic
941653666 2:168120560-168120582 CAGAAATGGGAACAGCAGCAGGG + Intronic
942204961 2:173610940-173610962 AAGAAGAGAGGGCAGCTGGATGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942599810 2:177629228-177629250 CAGCAGAGAGAGCAACGGGAAGG - Exonic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943891343 2:193290407-193290429 CGGTAGAGGAAGCAGCAGAAAGG - Intergenic
944077951 2:195753247-195753269 GAGATGTGGGAGCAGAAGGAAGG + Intronic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
945040353 2:205738771-205738793 GAGGAGAGGGAGCAGCAGGCTGG + Intronic
945420000 2:209623284-209623306 TAAAAAAGGCAGCAGCAGGATGG + Intronic
945816346 2:214609508-214609530 CAGAAGAGGAGGGAGCAGGGTGG - Intergenic
945864437 2:215161184-215161206 GAGTAGAGGAAGCAGCAGAAAGG + Intergenic
946148553 2:217748923-217748945 AAGAGGAGGAGGCAGCAGGAAGG - Intronic
946372892 2:219291155-219291177 CAGAAGCAGAGGCAGCAGGAGGG + Intronic
946961460 2:224989807-224989829 GAGTAGAGGTAGCAGTAGGAGGG - Intronic
947066954 2:226237807-226237829 AAAAAGGGGGAGCAGGAGGAAGG + Intergenic
947470946 2:230400753-230400775 CATCAGTGGTAGCAGCAGGAGGG - Intronic
947488398 2:230573127-230573149 CAGAGGGAGGAGCAGCAGCAGGG + Intergenic
947572796 2:231249163-231249185 AAGTAGAGACAGCAGCAGGATGG - Intronic
947708217 2:232293460-232293482 CAGAGGAGGGACAGGCAGGAAGG + Intronic
947821747 2:233076421-233076443 TAGGACAGGGAGCAGAAGGATGG + Intronic
947980592 2:234405412-234405434 CAGAAGAGCGAGCACCTGGCAGG + Intergenic
948181329 2:235983196-235983218 CAGCAAGGGGAGCTGCAGGAGGG + Intronic
948661287 2:239508110-239508132 CAGAAGAGGAAGCAGAAAGGGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1169198338 20:3695085-3695107 CAGGAGAGTGGGGAGCAGGAGGG - Intronic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1169425630 20:5495145-5495167 CAGGAGGAGGAGCAGCAGGGAGG + Intergenic
1170639357 20:18138034-18138056 CAGCAGTGGGACCAGCAGGTCGG + Exonic
1170927079 20:20734511-20734533 TAAAAGAGGAAGCAGCAGGCAGG - Intergenic
1170940432 20:20844164-20844186 CAGAAGGGGGAGCCACAGGACGG + Intergenic
1171040596 20:21758932-21758954 AAAGAGAGTGAGCAGCAGGAAGG - Intergenic
1171228737 20:23464884-23464906 CAGTAGAGGAGGCAGCAGAAGGG - Intergenic
1171336961 20:24393678-24393700 GAGAAGAGGGAAGAACAGGAGGG + Intergenic
1172123424 20:32611541-32611563 CAGGAGAGGGGGCAGCAGCATGG - Intergenic
1173156505 20:40616916-40616938 CAGCTGAAGGAGCAGAAGGAAGG - Intergenic
1173202804 20:40966580-40966602 CAGATGAGGGGACAGCAGCAGGG - Intergenic
1173255187 20:41389550-41389572 AAGAAGAGGAACGAGCAGGAGGG - Intergenic
1173499013 20:43539027-43539049 GAACAGAGAGAGCAGCAGGAAGG + Intronic
1173611371 20:44370748-44370770 CAGTAGGGTGAGCAGCTGGATGG + Intronic
1173664656 20:44755517-44755539 CAGAAGAGGGGCAGGCAGGAGGG + Intronic
1173727071 20:45305538-45305560 CTGAAGAAGGAGCAGCAACACGG + Exonic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173941347 20:46913795-46913817 CAGTGGAGGGAGGAGCAGGTTGG + Intronic
1174684868 20:52445003-52445025 GGGAAGAGGGAACAGCAGAATGG - Intergenic
1175032615 20:55970825-55970847 CACAAGAGGAAGCTCCAGGAGGG - Intergenic
1175073396 20:56353622-56353644 GAGAAGCAGGAGCAGCAGGAGGG - Intergenic
1175156649 20:56976093-56976115 CAGATGAGGGAGGAGCATGGAGG + Intergenic
1175520534 20:59599884-59599906 CAAGGGAGGAAGCAGCAGGATGG - Intronic
1175564017 20:59958558-59958580 CTGAAAAGGGAGGAGCAAGATGG + Exonic
1175754858 20:61523021-61523043 GAGCAGAGGAAGGAGCAGGAGGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175948933 20:62572111-62572133 AAAAAGAGAGAGCAACAGGAGGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178136082 21:29629301-29629323 AAGAAGAGGGAGTGGCAGAAAGG + Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178819315 21:35961017-35961039 CAAAAGACTAAGCAGCAGGATGG - Intronic
1178864555 21:36317128-36317150 CAGAGGGGGGAGTAGCAAGATGG - Intergenic
1179050488 21:37884903-37884925 CAGAAGGTTGAGAAGCAGGAGGG - Intronic
1179066455 21:38029061-38029083 CAGAAGAGTGACTATCAGGATGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179293707 21:40042303-40042325 CAGATGAGGGAGGACCAGGAAGG + Intronic
1179545660 21:42111055-42111077 CAGAAGAGGGGGCAGCAATGTGG + Exonic
1180157678 21:45986038-45986060 GGAAAGTGGGAGCAGCAGGAAGG - Intronic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1180989780 22:19928561-19928583 CAGAAGTGGGGGAAGCCGGAAGG + Intronic
1181308147 22:21928516-21928538 CAGCTGAAGGAGCAGCAGGTGGG + Intronic
1181485570 22:23229707-23229729 GAGAAGAGGGAGCTGGAGAAGGG - Intronic
1181693769 22:24582605-24582627 TAGGAGAGGGAGCAGCATGCAGG + Intronic
1181732839 22:24859936-24859958 CAGAGGAGGGGGCAGAAGCAGGG - Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1182097316 22:27634756-27634778 CAGCCGAGGGACCATCAGGAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182410216 22:30178946-30178968 CAGCAGAGGGACCTGCAAGAGGG - Intergenic
1182521321 22:30885985-30886007 CAGCAGAGGGGGCAGCTAGATGG + Intronic
1182718012 22:32375645-32375667 CAGGAGAGGGGGTATCAGGAGGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182936677 22:34229399-34229421 CAGATGAGGGAGCTGGAAGAGGG - Intergenic
1183466647 22:37983603-37983625 GTCAAGAAGGAGCAGCAGGACGG - Exonic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183721305 22:39563070-39563092 CGGAAGAGGGAGCAGATAGAGGG + Intergenic
1183980999 22:41540184-41540206 CGGAAGGGGGATCAGCAGGCTGG - Intronic
1184090899 22:42292577-42292599 CAGAAGAGTGGGCAGCACGGTGG + Intronic
1184097304 22:42323452-42323474 CAGCTGAGGGAACAGGAGGACGG + Intronic
1184291899 22:43501825-43501847 AAGATGAGGGAGGAGGAGGAGGG - Intronic
1184474079 22:44711325-44711347 AGGCAGAGGGAACAGCAGGATGG + Intronic
1184513024 22:44944056-44944078 CCGAAGGTGGAGCAGCAGGAGGG - Intronic
1184692070 22:46121966-46121988 CAGCAGAGGGAACAGCAGCCAGG + Intergenic
1184767393 22:46578751-46578773 CGGAAGGGTGTGCAGCAGGAAGG - Intronic
1184889034 22:47368355-47368377 CAGAAGAGGGAGGCTCAGAAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185127074 22:49017269-49017291 CAGAAGGGGATGGAGCAGGAAGG + Intergenic
1185176876 22:49332878-49332900 GAGAAGAGGCTGCAGCAGGTGGG + Intergenic
1185206171 22:49540405-49540427 CAGGAGGGAAAGCAGCAGGAAGG - Intronic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
1185334674 22:50266188-50266210 CAGGAGAGGGAGCTGCTGGCTGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949743507 3:7263412-7263434 CAGCAGTGGCAGCAGCAGCATGG + Intronic
949935016 3:9109857-9109879 CAGGAGAGGGAGGAGCAGGTAGG + Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950522701 3:13506024-13506046 CAGCAGAGGGAGCATTAGGGAGG - Exonic
950525850 3:13522799-13522821 AAGAAGAGGGAGTAGCAGGATGG - Intergenic
950810210 3:15643925-15643947 AAGAAGAGGAAGCAAAAGGAAGG + Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953347049 3:42184979-42185001 CAGCAGCAGGAGCTGCAGGAAGG - Intronic
953475354 3:43201377-43201399 GAAAAGAGGGAGGAGCAGAATGG - Intergenic
954317965 3:49811548-49811570 CAGAAGAGGAAGCAGAAGCCTGG + Intronic
954876456 3:53805930-53805952 AAGATGAGGGAGGAGGAGGAGGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955235267 3:57133747-57133769 CAGCAGATGGAACAGCAGGTAGG + Intronic
955461718 3:59190173-59190195 GGGTAGAGGAAGCAGCAGGAAGG - Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956489520 3:69755857-69755879 CAGGAGGAGGAGCAGCAGTAAGG - Intronic
956540878 3:70338389-70338411 CAGAAGAGTTAACAGCAGGCAGG + Intergenic
957348491 3:78992900-78992922 CAGAAGCTGAAGCAGCAGTAAGG + Intronic
957359975 3:79142471-79142493 AAGCAGAGGGTGCAGAAGGAAGG - Intronic
957376767 3:79368684-79368706 GAGAGGAAGGAGCAGCAGCAGGG - Intronic
958473257 3:94548890-94548912 CAGAAGTGGGACCACCATGAGGG - Intergenic
959528728 3:107408064-107408086 CAGAAGAGATATCAGCAAGATGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960954536 3:123022615-123022637 CAGGAGAGAAAGCAGAAGGAGGG - Intronic
961020559 3:123502901-123502923 CAGGAGTGAGAGCAGCAGGGTGG + Intronic
961316166 3:126037188-126037210 CAAGAGAGGGAGCAGGAGAAGGG - Intronic
961366220 3:126401669-126401691 CGGGAGAGGGAGCAGCAGGTGGG + Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961491752 3:127261271-127261293 AAGAGCAGGGAGGAGCAGGAGGG - Intergenic
961673819 3:128552903-128552925 CACTGGATGGAGCAGCAGGAAGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
962403811 3:135083293-135083315 CAGAGGAGAAAGCAGCAGGGGGG + Intronic
962713494 3:138107388-138107410 CAGGAGATGATGCAGCAGGAAGG + Intronic
962716939 3:138134529-138134551 CAGAAAGGGGTGCAGAAGGAAGG - Intergenic
963009040 3:140752321-140752343 TAGAAGAGAGACCAGAAGGAAGG + Intergenic
963271167 3:143287083-143287105 CACAAGTGGGACCAGAAGGAAGG - Intronic
963612666 3:147491366-147491388 GAGAAAAGGAAGCAGCAGCAAGG - Intronic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
966731711 3:183156944-183156966 CAGAGGAGAGAGGAACAGGAGGG + Intronic
966908556 3:184544703-184544725 TAGGAGGGGGAGGAGCAGGAGGG - Intronic
967260615 3:187638242-187638264 AAGATGAGAGAGCAGCAGAAGGG + Intergenic
967446682 3:189575126-189575148 CAGAAGAGTGAGCAGGAAAAGGG + Intergenic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
967691497 3:192479297-192479319 CAAAAGACAGAGCAGTAGGATGG + Intronic
967924717 3:194637207-194637229 CAGGAGAGTGAGCAGCAGGTGGG - Intergenic
968494994 4:910520-910542 TAGCAGAGAGGGCAGCAGGAGGG - Intronic
968594803 4:1476827-1476849 GAGAAGAGGCACCAGCAAGATGG + Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969158670 4:5235952-5235974 CACATGGGGGACCAGCAGGAGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969699717 4:8761500-8761522 TGGAAGAGAGAGCAGCTGGAGGG - Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970324882 4:14913273-14913295 GAGGAGGGGGAGCATCAGGAAGG + Intergenic
970658722 4:18260709-18260731 CAGTAGAGAAAGCAGCAGAAAGG - Intergenic
971178095 4:24300952-24300974 CAGATGAGAGAGCAGAAGGATGG + Intergenic
971194876 4:24463041-24463063 AAGTCGAGGGAGCTGCAGGAGGG - Intergenic
971239768 4:24877781-24877803 CAGGAGAGTGAGCAGAGGGAAGG - Intronic
971901096 4:32658682-32658704 CGGTAGAGGAAGCAGCAGAAAGG - Intergenic
972144852 4:36010605-36010627 CTGATGAGGGAGCAGCAGGATGG - Intronic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972198162 4:36679309-36679331 CAGAAGAGGGACCTGCTGGGAGG - Intergenic
972539600 4:40027934-40027956 AAGCTTAGGGAGCAGCAGGAAGG - Intergenic
973169587 4:47122857-47122879 CAGTAGAGGGAGCTAGAGGAAGG - Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974543934 4:63275671-63275693 CAGAAATGGCAGCAGCATGACGG - Intergenic
975045530 4:69798925-69798947 CAGAGGAGGGTGGAGCAAGATGG + Intergenic
975469303 4:74747002-74747024 CAGAATAGTGAGCAGAAAGAGGG + Intronic
976072755 4:81260605-81260627 CAGTAGGGGGAGCTGCAGGGAGG - Intergenic
977780153 4:100971469-100971491 CAGGAGAGGAGGCAGCAAGAAGG - Intergenic
978030481 4:103936334-103936356 CAGGAGAGGGTGGAGCAAGATGG + Intergenic
978339784 4:107710062-107710084 CTGAAGTGGGTGCAGAAGGAAGG - Intronic
978490066 4:109302788-109302810 CAGCAGCGGGAGCGGCAGGCCGG - Intergenic
979675842 4:123409639-123409661 GAGAAGAGGGAAGAGCGGGAGGG + Intergenic
980101116 4:128542542-128542564 CAGGTGAGGAAGCAGCAAGAAGG - Intergenic
980879300 4:138693218-138693240 AGGAAGAGAGAGCAGCAGGCAGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981924496 4:150123373-150123395 GAGATGAGGGAGCAGCTGGTTGG + Intronic
982024067 4:151234514-151234536 TTAAGGAGGGAGCAGCAGGAAGG - Intronic
982028637 4:151277192-151277214 CAGCAGAAGGAGCAGCGTGAAGG - Exonic
982198677 4:152938681-152938703 CAGAAGAGGTGGGGGCAGGAAGG - Intronic
982206978 4:153004233-153004255 CAGAAGAGAGAGCTCCAGCAGGG + Intergenic
982243169 4:153321038-153321060 CAGGTGAGGAAACAGCAGGAAGG - Intronic
982321123 4:154078381-154078403 CAGGAGAGGGATCAACAGAAGGG + Intergenic
982776259 4:159444555-159444577 CAGAAGAGGCAGCATCAAGCAGG - Intergenic
983449681 4:167894949-167894971 GGGCAGAGGAAGCAGCAGGAAGG + Intergenic
983906348 4:173186537-173186559 AAGAAGAAGGAACAGAAGGAAGG - Intronic
984179504 4:176464314-176464336 CAGATGTGGGAGCAGGAGGATGG + Intergenic
984561932 4:181281088-181281110 CAGAAGGGGTGGAAGCAGGAAGG + Intergenic
984797062 4:183671462-183671484 CAGAAGCAGGAGCAGCAGTTGGG - Intronic
985093816 4:186392041-186392063 CAGAAGAGGCTGCAGAAGAAAGG + Intergenic
985558759 5:570938-570960 GAGACGTGGGAACAGCAGGAGGG - Intergenic
985721926 5:1493989-1494011 CAGAGGAGGAAGAGGCAGGAAGG + Intronic
985774549 5:1833977-1833999 GAGAAGAGGGAGCAGCCGGGAGG - Intergenic
986004846 5:3659094-3659116 CACAAGAGTGAGCAGAAGGGTGG + Intergenic
986299329 5:6466029-6466051 AGGAAGAGGGAGGGGCAGGAAGG - Intronic
986396093 5:7332252-7332274 CAAAATTGGCAGCAGCAGGATGG + Intergenic
986576708 5:9220604-9220626 GAGAAGAGTGGGCAGAAGGAAGG + Intronic
986788147 5:11134124-11134146 CTGAGGAGGGAGCAGGAGAAAGG + Intronic
986986488 5:13506325-13506347 CAGAGGAGAGAGAATCAGGAGGG + Intergenic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
988718322 5:33850746-33850768 CAGCCCAGGGACCAGCAGGATGG - Intronic
989273426 5:39558626-39558648 TAGTAGAGGAAGCAGCAGAACGG + Intergenic
990232880 5:53734093-53734115 CAGGAGAGGCTGCAGCAGGTTGG + Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991022205 5:61991468-61991490 AACATGAGGGAGTAGCAGGAGGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991244047 5:64490001-64490023 CAGCAGTGGCAGCAGCATGAAGG - Intergenic
993691578 5:91007436-91007458 CACAAGAGGCAGTAGCAGGATGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995001949 5:107143878-107143900 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995002079 5:107145408-107145430 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995531222 5:113093764-113093786 CAGATGAGTGACAAGCAGGAAGG + Intronic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
996632694 5:125654412-125654434 CAGAAGAGGGAGTTTCAGAAAGG + Intergenic
996790090 5:127283036-127283058 CAGAAGAGAGGGCAGCTGGGAGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997239473 5:132295829-132295851 CAGAGGAGGGACTAGCAGCAGGG - Intronic
997351491 5:133234388-133234410 CAGAGGAGGGATGGGCAGGAGGG + Intronic
997383043 5:133450982-133451004 CAGAGGAGGGAGAGGCATGATGG + Intronic
997634403 5:135394317-135394339 CAGAAGAGGGAGCACATTGATGG - Intronic
999657428 5:153824587-153824609 CTGAAGAGAGAGCTGCAGCAAGG + Intergenic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1002131705 5:177086427-177086449 CAAATGAGGGAGCAGAAGGAAGG + Intergenic
1002169302 5:177366462-177366484 AGGAAGAGGGTGCTGCAGGAAGG - Intronic
1002290020 5:178194159-178194181 CAGAGGAGGCAGCAGCGGGTGGG - Intergenic
1002848415 6:969204-969226 CAGAAGGATGAGCTGCAGGAAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004169813 6:13287270-13287292 CAGAAGTGGGACCAGCAGCTCGG - Exonic
1004184792 6:13412704-13412726 AAGAGGAGGGAGCAGAAGGCAGG - Intronic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005944971 6:30588902-30588924 GACAAGAGGGACAAGCAGGAGGG - Intronic
1005982490 6:30847074-30847096 CAGAAAAGGAAGCATCAAGACGG + Intergenic
1006012472 6:31054346-31054368 GAGAAGCAGGAGCAGCAGAAGGG - Intergenic
1006287431 6:33107242-33107264 CTGAACAGTGTGCAGCAGGAGGG + Intergenic
1006305982 6:33219051-33219073 CAGAAGGGGAAGTGGCAGGAGGG - Intergenic
1006361047 6:33587344-33587366 AAGGAAGGGGAGCAGCAGGATGG - Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1007019738 6:38507503-38507525 CAGAAGGGAGAGCAGTTGGATGG - Intronic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007785511 6:44277143-44277165 CAGTGGAGGGAGCGGCAGAAAGG - Exonic
1008254202 6:49276259-49276281 CCAAAGAGTGAGCAGCAGCAAGG - Intergenic
1009323633 6:62322338-62322360 AAGCAGAGGGAAGAGCAGGAGGG - Intergenic
1009464533 6:63953386-63953408 CAGATGTTGGAGGAGCAGGAGGG - Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010024239 6:71197231-71197253 TAGAAGAGGGAAAGGCAGGAGGG + Intergenic
1011698925 6:89937389-89937411 CAGAGGAGGGAACTGCAGAAGGG - Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011757749 6:90521720-90521742 CAGTAGAGGGAGCCGCAGAGGGG - Intronic
1011957325 6:93039086-93039108 CAGAAGAGGTAACAGTAGCATGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012477740 6:99633436-99633458 CTGATGAGGGTGCGGCAGGAGGG + Intergenic
1012800505 6:103820757-103820779 AAGAAAAGGGAAGAGCAGGAAGG + Intergenic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1013474502 6:110495030-110495052 GAGAATTGGAAGCAGCAGGATGG - Intergenic
1013840469 6:114386598-114386620 GAGAAGAGGGAGGAGAAAGAAGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015786231 6:136923129-136923151 CAGGAGAGGGGGCGACAGGAAGG - Intronic
1015929308 6:138341305-138341327 CTGAAGAGGAAGCAGCTGGTTGG + Exonic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016125372 6:140395766-140395788 TACAACAGTGAGCAGCAGGAGGG - Intergenic
1017328825 6:153171860-153171882 GGGAAGAGGGAGCCACAGGATGG + Intergenic
1017511701 6:155119897-155119919 CAGAAGAGAGACTAGCAGAACGG - Intronic
1017641033 6:156494180-156494202 CAGAGGAGGGAGCTGAAAGAGGG + Intergenic
1018021336 6:159764110-159764132 AAGAAGAAGAAGCAGCAGCAGGG + Intronic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018491834 6:164301979-164302001 CCAAAGAGTGAGCAGCAGCAAGG - Intergenic
1018870441 6:167778514-167778536 CAGAAGAGGCTGGAGCAGGCAGG - Intergenic
1018906617 6:168079530-168079552 GGGAAGATGGAGCAGCAGCAGGG + Intronic
1018943694 6:168329495-168329517 CAGAAGAGGGCACAGCATGGAGG - Intergenic
1018943719 6:168329597-168329619 CAGAAGAGGGCACAGCATGGAGG - Intergenic
1019351811 7:557552-557574 CAGAGGAGGGAGAAACAGGATGG + Intronic
1019615202 7:1956269-1956291 CAGAAGTGGTGGCAGCTGGAGGG + Intronic
1019727961 7:2613352-2613374 CAGCAGAGGCACCAGCTGGAGGG + Exonic
1019756947 7:2777619-2777641 CATGTGAGGAAGCAGCAGGAAGG + Intronic
1019896869 7:3989662-3989684 CAGAAAAGTGAGCAGCACCAGGG - Intronic
1019936431 7:4261272-4261294 CAGATGAGGGAGCAGCTGGCAGG + Intronic
1019940216 7:4283597-4283619 CAGCAGTGGCAGCCGCAGGAAGG - Intergenic
1019940553 7:4285883-4285905 CAGCAGTGGCAGCAGCAGGAAGG - Intergenic
1020430599 7:8113020-8113042 CAGATAAGGCAGCAGCAGGAAGG - Intergenic
1021313246 7:19117433-19117455 CGGAGGAGAGAGCAGGAGGACGG + Exonic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021905229 7:25326735-25326757 CAAAAGAGTTTGCAGCAGGATGG + Intergenic
1022760237 7:33341199-33341221 GGGAAGAGAGAGCAGTAGGAGGG + Intronic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1022976839 7:35566474-35566496 CTGCAGAGTGAGCAGCAGCATGG + Intergenic
1022977037 7:35568153-35568175 CAGAAGAGGGACCAGCTGTTTGG - Intergenic
1023131753 7:37010494-37010516 CAGAAGAGGGATCAGGGTGATGG + Intronic
1023362003 7:39426567-39426589 AAGAAGAGGGAGGAAGAGGAGGG - Intronic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023794845 7:43783020-43783042 CTGTAGAGGGAGCTCCAGGAAGG + Intronic
1023822393 7:43987530-43987552 GGGAAGAGGAAGCAGCAGGCAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026401827 7:70021682-70021704 CAGATTGAGGAGCAGCAGGAAGG - Intronic
1026496342 7:70906917-70906939 CAGACCAGGAAGCAGCAGGTTGG - Intergenic
1026702629 7:72660398-72660420 CAAAAAAAGGAGCAGCAGCATGG + Intronic
1026734915 7:72943233-72943255 CAGCAGCGGGAGCAGCAGCTCGG + Exonic
1026785248 7:73298148-73298170 CAGCAGCGGGAGCAGCAGCTCGG + Intergenic
1027044880 7:74984606-74984628 CAGCAGTGAGAGGAGCAGGAAGG - Intronic
1027108826 7:75421776-75421798 CAGCAGCGGGAGCAGCAGCTCGG - Exonic
1027287332 7:76660471-76660493 CAGGTGTGGGAACAGCAGGAAGG - Intergenic
1027432179 7:78125709-78125731 CAGAAGATGGACCAGCAATAAGG - Exonic
1027956178 7:84881485-84881507 CCAAAGAGTGAGCAGCAGCAAGG - Intergenic
1028136020 7:87223748-87223770 GGGAAGAGGGAGGAGAAGGATGG - Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1029034932 7:97509438-97509460 TGGAGGAGTGAGCAGCAGGAGGG - Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029362639 7:100098465-100098487 CAAAAGAGGGAAGTGCAGGAGGG - Intronic
1029387976 7:100256311-100256333 CAGCAGTGAGAGGAGCAGGAAGG + Intronic
1029446326 7:100614933-100614955 CGGGAGTGGGAGCAGCAGGAAGG - Exonic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1029750656 7:102540945-102540967 GGGAAGAGGAAGCAGCAGGCAGG - Intronic
1029768611 7:102640056-102640078 GGGAAGAGGAAGCAGCAGGCAGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030573258 7:111253385-111253407 CAGAAGAGTGAGCATTAGGGAGG + Intronic
1030661139 7:112220961-112220983 CAGAAGAGTGTGCAGTTGGAAGG - Intronic
1031053789 7:116972128-116972150 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
1031202874 7:118712860-118712882 CAGAAGAGGGAGGAACAGAAGGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031877866 7:127162416-127162438 CAGAAGAGAAAGCAGCAGAAAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032498645 7:132382210-132382232 GAGAAGAGGAAGCAGGAAGAGGG + Intronic
1032669383 7:134069354-134069376 GAGAAGAGGGAGGAGGAAGAAGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1033586702 7:142779674-142779696 GAGGAGAGGAAGCAGAAGGAGGG - Intergenic
1033620825 7:143060805-143060827 GAGAAGAGCGAGTAGCAGGAAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034435290 7:151060225-151060247 CAGAAGAGGGAGCAGCTGGGTGG + Intronic
1034498086 7:151433794-151433816 CAGGACAGGGGACAGCAGGATGG - Intronic
1034563538 7:151896441-151896463 CAGAGGAGGCCGCAGAAGGAAGG + Intergenic
1034842903 7:154416141-154416163 CAGAACAGGACGGAGCAGGATGG - Intronic
1034859063 7:154580871-154580893 CAGAAGAAAGAGCAGCAAAAAGG + Intronic
1034866543 7:154647202-154647224 CTGAAGAGGGAACCTCAGGATGG + Intronic
1034901632 7:154911277-154911299 CACAAGGGTGAGCACCAGGAGGG - Intergenic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035721583 8:1797081-1797103 GAGAAGAGGTAGCTGCTGGAGGG - Intergenic
1036549879 8:9806449-9806471 CAGATGTTGGAGGAGCAGGAGGG - Intergenic
1037188848 8:16097965-16097987 CAATAGATGGAGCAGCAGCATGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1037954384 8:23042744-23042766 GAGAAGATGGAGCAACAGCAGGG - Intronic
1038145109 8:24888247-24888269 CAGAAGGGTGAGCAGCAGTTAGG + Intergenic
1038293966 8:26274039-26274061 AAGAAGAGGTGGCAGGAGGAAGG - Intergenic
1038459516 8:27704036-27704058 AGGAAGAGGAAGCAGAAGGAAGG + Intergenic
1038692600 8:29776396-29776418 GAGAAGAGGGAGCTCAAGGAAGG - Intergenic
1039445770 8:37630654-37630676 TTGCAGAGGGAGCAGCAGGCAGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039870345 8:41540473-41540495 CAGAAGAGGGAGCAGGTTGGAGG + Intronic
1039971346 8:42324057-42324079 GAGGAGAGGGAGCAACAAGAAGG + Intronic
1040014624 8:42690408-42690430 CCAAAGAGTGAGCAGCAGCAAGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041241876 8:55855159-55855181 GAGAAGGGGGAGAAGAAGGAAGG - Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041878081 8:62712898-62712920 TGGTAGAGGGAGCAGCAGAAAGG - Intronic
1042772584 8:72395443-72395465 CCAAAGAGTGAGCAGCAGCAAGG - Intergenic
1043243424 8:77966212-77966234 AAAAAGAGAGAGAAGCAGGAAGG + Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044066294 8:87703914-87703936 AAGATGAGGGAAGAGCAGGAAGG + Intergenic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044534781 8:93345975-93345997 CCAAAGAGTGAGCAGCAGCAAGG - Intergenic
1044800168 8:95945590-95945612 CAGAAGAGGGATGAACAGGCCGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044950110 8:97427644-97427666 CAGGAGAGGTGGCAGTAGGAAGG + Intergenic
1045231391 8:100310128-100310150 AAGAAGTGGGAGGAGGAGGAGGG - Intronic
1045335158 8:101195180-101195202 CAGCTGAGGGAGGAGTAGGAAGG - Intronic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045747485 8:105440678-105440700 GAGAAGATGCAGGAGCAGGAGGG + Intronic
1045839996 8:106568580-106568602 AGGAAAAGGGAACAGCAGGAGGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046384049 8:113486236-113486258 AAGAGGAGGGAAGAGCAGGAAGG - Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1046942779 8:119947184-119947206 CCGGAGAGGTAGCGGCAGGAGGG - Intronic
1047597547 8:126394129-126394151 CAGAAGAGGGAGCGATAGGATGG + Intergenic
1048356495 8:133658069-133658091 CAGAAGTGGGGGCATCAGGAGGG - Intergenic
1048787835 8:138069686-138069708 CAGAAGATGGAGGAGACGGAGGG + Intergenic
1049356717 8:142192779-142192801 TAGAACAGGGAGGAGCAGAAGGG + Intergenic
1049415574 8:142493351-142493373 CAGGGGCGGGGGCAGCAGGACGG + Intronic
1049492359 8:142912185-142912207 CTGAAGGGGGAGCAGCAGCCTGG + Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049592916 8:143470664-143470686 CAGGACCGGGTGCAGCAGGAGGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1049804136 8:144531301-144531323 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804161 8:144531419-144531441 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804187 8:144531537-144531559 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804201 8:144531596-144531618 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804215 8:144531655-144531677 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804228 8:144531714-144531736 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804242 8:144531773-144531795 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804268 8:144531891-144531913 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804282 8:144531950-144531972 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804295 8:144532009-144532031 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804308 8:144532068-144532090 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1049985247 9:944446-944468 CAAAGGAGGGAGGAGCAAGAGGG - Intronic
1050153191 9:2638006-2638028 CAAAAGAGGGAGTAGCGGAATGG - Intronic
1050433112 9:5582061-5582083 CAGAAGCGGGGGTAGGAGGAGGG + Intergenic
1051121192 9:13754070-13754092 GAGGAGAGGGAGGAGCAGAAAGG + Intergenic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051428605 9:16959871-16959893 AAACAGAGGGAGAAGCAGGAGGG - Intergenic
1051549618 9:18314675-18314697 CGAAAGAGTGAGCAGCAGCAAGG + Intergenic
1051555267 9:18375674-18375696 CCAAAGAGTGAGCAGCAGCAAGG + Intergenic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052825483 9:33171015-33171037 CAGAAGAGGGCGCCATAGGAGGG - Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053232695 9:36424340-36424362 CAGAAGAGGAAGCACCACGATGG + Intronic
1053472696 9:38358199-38358221 CAGAAGAGGCAGCATCAAGCAGG - Intergenic
1053624905 9:39859648-39859670 CCGAAGAGTGAGCAGTAGCAAGG + Intergenic
1053879965 9:42583580-42583602 CCGAAGAGTGAGCAGTAGCAAGG - Intergenic
1054218992 9:62391050-62391072 CCGAAGAGTGAGCAGTAGCAAGG - Intergenic
1054231725 9:62518119-62518141 CCGAAGAGTGAGCAGTAGCAAGG + Intergenic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055272458 9:74576494-74576516 CAAAAGAGGGCCCAGTAGGAGGG + Intronic
1055616878 9:78082233-78082255 CAGAAGGGGGAACAGCAAAAGGG - Intergenic
1055861507 9:80755518-80755540 CACAAGAGGGAGCTGAAGTAGGG + Intergenic
1056094076 9:83233025-83233047 CAGAGTATGGAACAGCAGGAGGG - Intergenic
1056781481 9:89554385-89554407 CAGAAGAGGGAGCAGAGGCTGGG - Intergenic
1057123040 9:92594356-92594378 CAGAAGTGGAAGCAGCAGCTGGG - Intronic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057513957 9:95705094-95705116 CAGCAGAGGGAGCTGCACCATGG + Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1058623299 9:106906065-106906087 GGGTAGAGGAAGCAGCAGGAAGG - Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059463734 9:114452178-114452200 CAGAAGATACAGCAGCATGAGGG - Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1060148733 9:121272975-121272997 GGGAGGAGGGAGGAGCAGGAGGG - Intronic
1060298195 9:122357208-122357230 CAGAAGAGGGACCACCAGACTGG - Intergenic
1060426468 9:123510765-123510787 CAGAAGGTGGAGGAGCAGAAAGG + Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060936148 9:127517343-127517365 CAGGAGAGAGGGCAGCAGGGAGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061212984 9:129204096-129204118 CAGATGTGGCAGGAGCAGGAAGG + Intergenic
1061237540 9:129351511-129351533 CAGAAGAGGGCGGAAGAGGAAGG + Intergenic
1061374482 9:130215907-130215929 GAGAAGAGGGAGCAGGATGTGGG - Intronic
1061614312 9:131769526-131769548 GGGAAGAGGGAGCAGCCTGAGGG + Intergenic
1061779390 9:132986856-132986878 AAGAAGAGGCTGCTGCAGGAGGG - Intronic
1061853442 9:133429117-133429139 CAGGAGTGGGCGCAGCGGGATGG - Intronic
1061926442 9:133808268-133808290 CAGAGGGTGGGGCAGCAGGAGGG + Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062128689 9:134880859-134880881 CAGGAAAGAGAGCAGCAGGGTGG - Exonic
1062162875 9:135089358-135089380 CAGTAGGGCCAGCAGCAGGATGG + Intronic
1062192721 9:135256089-135256111 GGGAAGAGGGGGCAGCGGGAGGG - Intergenic
1062405786 9:136395598-136395620 CAGAACCGGGAGCAGCAGGTGGG - Exonic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1185621959 X:1455469-1455491 CAGGAGCGGGAGAGGCAGGAAGG - Intergenic
1185826769 X:3258779-3258801 CAGAAATGGGAGAGGCAGGAAGG - Intergenic
1185895407 X:3854163-3854185 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185900524 X:3892587-3892609 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185905640 X:3931018-3931040 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186152401 X:6689547-6689569 CACAAGAGGGTGCAGCAAGAAGG - Intergenic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187447625 X:19373005-19373027 CAGGAGGGAGAGCAGAAGGAGGG + Intronic
1187464049 X:19513296-19513318 CAGAGGTGGCACCAGCAGGAAGG + Intronic
1187981779 X:24765065-24765087 CAGGTGAGGGAGCAGCAGGTAGG - Intronic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188743156 X:33810653-33810675 CAGTAGTGGCAGCAGCAGGCTGG + Intergenic
1189139400 X:38585823-38585845 AAGAAGAGGGAGCAACAGAGAGG - Intronic
1189558046 X:42165715-42165737 CAGCAGTGGCAGCAGCAGCACGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190029016 X:46953909-46953931 CAGGAGAGGGAGGAGGAGAAAGG - Intronic
1190093753 X:47462532-47462554 CAGAACAAGGATCAGCTGGAGGG - Intronic
1190113211 X:47608619-47608641 GAGGAGAGGGAGCAACAGGAGGG + Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190247355 X:48699429-48699451 CAGAAGGGGGAGTGGCAGGATGG + Intronic
1190301974 X:49062341-49062363 CAGGGGAGGAGGCAGCAGGAGGG - Intronic
1190335193 X:49257797-49257819 CAGAACAGTGAGGATCAGGATGG - Intronic
1190596671 X:52059261-52059283 AACAAGGAGGAGCAGCAGGATGG + Intergenic
1190612153 X:52194812-52194834 AACAAGGAGGAGCAGCAGGATGG - Intergenic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1190929598 X:54936007-54936029 AACAAGGAGGAGCAGCAGGATGG - Intronic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192191781 X:68995532-68995554 GTGAGGAGGTAGCAGCAGGAAGG - Intergenic
1192265381 X:69533952-69533974 CAGAAGAGGCGCCAGCAGCAGGG + Intergenic
1192914610 X:75638760-75638782 GGGTAGAGGGAGCAGCAGAAAGG - Intergenic
1192995240 X:76505957-76505979 GAGTAGAAGGAGCAGCAGAAAGG - Intergenic
1193062667 X:77223010-77223032 GAGTAGAGGAAGCAGCAGAAAGG + Intergenic
1193413751 X:81196868-81196890 CAGAAGAGGGAGGAGCAACGGGG - Intronic
1194327649 X:92540281-92540303 AAGAGGAGGGAAAAGCAGGAAGG - Intronic
1194605597 X:95974760-95974782 GGGTAGAGGGAGCAGCAGAAAGG + Intergenic
1194820712 X:98503272-98503294 CAGCAGAGGGAACAGCATGTGGG - Intergenic
1194986390 X:100494434-100494456 CAAAAAAGGGAGCAGCTGGTGGG + Intergenic
1195556205 X:106227896-106227918 CAGAAGGGGTAGCAGAAGAAGGG - Intergenic
1195667358 X:107443290-107443312 CAGCAGGGGGGACAGCAGGAAGG + Intergenic
1195939527 X:110156542-110156564 GAGAAGAGGGCGCAGAAGGAAGG + Intronic
1196833414 X:119793765-119793787 CAGAAGAGGGAACTGCAACAGGG + Intergenic
1197017060 X:121637536-121637558 CATGTGAGGGTGCAGCAGGAAGG - Intergenic
1197336175 X:125211703-125211725 CAAAAGAGGGGACAGCTGGAGGG - Intergenic
1197579159 X:128260340-128260362 TAGATGAGGGAGGAGTAGGAAGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199208293 X:145174920-145174942 CATATGAGGGCGCAGCAAGAGGG + Intergenic
1199612713 X:149631682-149631704 CAGTAGCGGGAGCAGCAGCGTGG - Exonic
1199743444 X:150757075-150757097 GGGATGAGGGAGCAGGAGGATGG - Intronic
1200069003 X:153518607-153518629 CAGAAGGGCCAGCAGAAGGAAGG - Intronic
1200128357 X:153828793-153828815 CCGAAAAGGAAGCAGGAGGATGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200397197 X:155998246-155998268 CAGAAGAGGAGCCAGGAGGATGG + Intronic
1200636360 Y:5659499-5659521 AAGAGGAGGGAAAAGCAGGAAGG - Intronic
1200960124 Y:8988850-8988872 CAAAAGAGTGAGCAGCAGCAAGG - Intergenic