ID: 1166487962

View in Genome Browser
Species Human (GRCh38)
Location 19:43230026-43230048
Sequence CTGAAAAAGAATTCAGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 818
Summary {0: 1, 1: 7, 2: 11, 3: 80, 4: 719}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166487957_1166487962 29 Left 1166487957 19:43229974-43229996 CCCAAATAAAATGGCTCTGTTTG No data
Right 1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG 0: 1
1: 7
2: 11
3: 80
4: 719
1166487960_1166487962 -3 Left 1166487960 19:43230006-43230028 CCATTGTTCTTTGTCACACACTG 0: 1
1: 1
2: 4
3: 20
4: 292
Right 1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG 0: 1
1: 7
2: 11
3: 80
4: 719
1166487958_1166487962 28 Left 1166487958 19:43229975-43229997 CCAAATAAAATGGCTCTGTTTGG 0: 3
1: 1
2: 1
3: 19
4: 200
Right 1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG 0: 1
1: 7
2: 11
3: 80
4: 719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166487962 Original CRISPR CTGAAAAAGAATTCAGGACA TGG Intronic
901276266 1:7993528-7993550 ATGAAAAAGAGTTCGGGAGATGG - Intergenic
901889788 1:12252861-12252883 ATAAAAAAAAATTCAGGACTGGG + Intronic
902214478 1:14925364-14925386 CGGAAAAAGTATTCAGAACTTGG - Intronic
902999410 1:20254361-20254383 ATGAACAAGAATACAGGACGTGG + Intergenic
904755145 1:32764838-32764860 CTGGAAAAGAAGTCAGGTCGAGG - Intronic
905429882 1:37914062-37914084 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
906737418 1:48143953-48143975 CAGAAATAGAATTCAGAATATGG + Intergenic
906836443 1:49087255-49087277 CAGAAATAGAATTCAGAATATGG + Intronic
906993713 1:50766986-50767008 CAGAAACAGAATTCAGAATATGG + Intronic
907183319 1:52589771-52589793 CAGAAAAGGATTCCAGGACAAGG - Intergenic
907232283 1:53010915-53010937 CTGAAAAAGGAGTCAGCAAAAGG - Intronic
907321504 1:53605629-53605651 CTGAGAAATCCTTCAGGACAAGG + Intronic
908455309 1:64297681-64297703 CAGAAAAAGAATTCAAAATATGG + Intergenic
908818668 1:68059385-68059407 CACAAATAGAATTCAGAACATGG + Intergenic
909033848 1:70574292-70574314 CAGAAAAAAAATTCAGCCCAAGG - Intergenic
909153219 1:72035312-72035334 TTGAGAAAGAATTCAGGACACGG - Intronic
909264129 1:73535081-73535103 CTCAAAAATAATTCAGGAACAGG + Intergenic
909402081 1:75244878-75244900 CTGAGAAAGATTTCAGAAGAAGG - Intronic
909412903 1:75375029-75375051 CTGACATAGAATTCAGAATATGG + Intronic
909715315 1:78701057-78701079 CAGAAATAGAATTCAGAATATGG - Intergenic
909836582 1:80261858-80261880 CAGATAAAGAATTCAAAACATGG + Intergenic
909964580 1:81892236-81892258 GTGAAAAGTAATTCCGGACAAGG - Intronic
910126967 1:83853270-83853292 CTCTAAAAGAAATCAGGAAATGG + Intergenic
910199675 1:84686329-84686351 GTAAGAAATAATTCAGGACATGG + Intronic
910281439 1:85505904-85505926 CTATAGAAGAATTTAGGACATGG - Intronic
910437429 1:87219651-87219673 CTGAAAAAGACATCAAGGCAAGG - Intergenic
910563719 1:88619881-88619903 TAGAAATAGAATTCAGAACATGG + Intergenic
911070584 1:93828992-93829014 TTGAGAAAGAACTCAGGACATGG + Intronic
911360646 1:96872496-96872518 CAGAAAAAGAATTCAAAATATGG - Intergenic
911710388 1:101064814-101064836 CTCAAAAAAAATTAAGGACTTGG + Intergenic
911909019 1:103607966-103607988 ACTAAAAAGTATTCAGGACAAGG - Intergenic
911913900 1:103671495-103671517 ACTAAAAAGTATTCAGGACAAGG + Intronic
911936501 1:103981977-103981999 ATGAAAAATAATTGAAGACAAGG + Intergenic
912100189 1:106193975-106193997 CAGAAATAGAATTCAGAATATGG + Intergenic
912286138 1:108371675-108371697 CTTAATAAAAATACAGGACATGG - Intergenic
912587184 1:110777892-110777914 CAGAACATGAATTCAGGTCATGG - Intergenic
912639329 1:111330160-111330182 CAGAAATAGAATTCAGAATATGG - Intergenic
913123364 1:115762723-115762745 CTGAAAAAGAAGGCAAGAAAAGG - Intronic
913164915 1:116176314-116176336 CTAAAACAGAATTGAGGTCAGGG + Intergenic
914222415 1:145692737-145692759 AAGAAAAAGAATTCTGGACTGGG + Intronic
915815878 1:158963901-158963923 CAGAAATAGAATTCAGAATATGG + Intronic
916200712 1:162268767-162268789 CTAAAAAAGAAGTCAGTAGAAGG + Intronic
916247257 1:162701023-162701045 CTGATAAATAATTTAGGACTTGG + Intronic
916379113 1:164188870-164188892 TTGAATAAGAATTCGGCACAAGG + Intergenic
916621021 1:166497502-166497524 CTGAAAAAGAATTCAGAAAAAGG + Intergenic
917085259 1:171298559-171298581 CCAAGAAAGAATTCAGGACATGG + Intergenic
917149269 1:171927815-171927837 CAGAAATAGAATTCAGAATATGG - Intronic
917297697 1:173538947-173538969 CTGAAAAACTATGCAGGGCAGGG + Intronic
917403281 1:174676093-174676115 CTGAAAAGTAATTTAGGGCATGG + Intronic
918674340 1:187263464-187263486 GTGAAGGAGATTTCAGGACATGG + Intergenic
918736180 1:188066473-188066495 CAGAAAAAGAATTCAGAATTTGG - Intergenic
918907596 1:190518156-190518178 CTGAAAAAGAGGTGAGAACAAGG - Intergenic
919245793 1:194982143-194982165 CAGAAACAGAATTCAGAATATGG - Intergenic
919355620 1:196517437-196517459 CAGAAATAGAATTCAGAATATGG + Intronic
919453470 1:197798255-197798277 CAGAAACAGAATTCAGAATATGG - Intergenic
919471631 1:197986500-197986522 CTGAAACTGAATTAAGGAAAAGG + Intergenic
919483724 1:198120877-198120899 CTGTGAAAAAATTCAGGATATGG - Intergenic
919568327 1:199217536-199217558 CAGAAATAGAATTCAGAATATGG - Intergenic
921089902 1:211832184-211832206 CTGAAAATGAATTCTGGGCCTGG - Intergenic
921404437 1:214764117-214764139 CAGAAACAGAATTCAGAATATGG - Intergenic
921716882 1:218426291-218426313 CTGTAAAACAACTCAGGACTTGG - Intronic
922075360 1:222238351-222238373 CTGAAAGAGAGCCCAGGACAAGG - Intergenic
922384826 1:225072513-225072535 CTGAAGTAGAATTCAGAATATGG - Intronic
923107390 1:230865227-230865249 CAGGACAAGAATCCAGGACATGG + Intronic
923683018 1:236134412-236134434 CAGAAAAAGAATTCATTAAAAGG - Intergenic
1063340764 10:5261386-5261408 CTGCATGAGGATTCAGGACAGGG + Intergenic
1063433111 10:6008308-6008330 CCGAAAAAGGATTCAGCAAAGGG - Intergenic
1065212760 10:23420561-23420583 ATCAGAAAGAATTCAGGTCATGG + Intergenic
1065310644 10:24413184-24413206 CTCAAAAAGAATTAACTACAAGG - Intronic
1066102921 10:32133790-32133812 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1067400048 10:45964088-45964110 CTGACATTGAATTCAGGAAACGG - Intergenic
1068462850 10:57350345-57350367 CAGAAATAGAATTCAGAATATGG - Intergenic
1068821572 10:61382997-61383019 CAGAAAAAGAATTCATGAATTGG - Intergenic
1069211756 10:65770352-65770374 GGGAAAAAGCATTTAGGACAGGG - Intergenic
1069333963 10:67327201-67327223 CAGAAATAGAATTCAGAATATGG - Intronic
1069724437 10:70568093-70568115 CTGCAAAAGAATTCAGCCAAGGG - Exonic
1069805830 10:71124456-71124478 CAGAAATAGAATTCAGAATATGG - Intergenic
1070873330 10:79777863-79777885 CTGAAGAAGAATTGATGAAAGGG - Intergenic
1071191863 10:83109947-83109969 CAAAAATAGAATTCACGACATGG + Intergenic
1071454816 10:85837827-85837849 CAGAAATAGAATTCAGAATATGG + Intronic
1071524388 10:86349707-86349729 CTGAGAAAGAACACCGGACAAGG + Intronic
1071600641 10:86957215-86957237 CTGAAAAAGTAGTCTGGACTGGG - Intronic
1071611658 10:87037691-87037713 CAGAAATAGAATTCAGAATATGG - Intergenic
1071640258 10:87300014-87300036 CTGAAGAAGAATTGATGAAAGGG - Intergenic
1071654973 10:87437932-87437954 CTGAAGAAGAATTGATGAAAGGG + Intergenic
1071736321 10:88304360-88304382 CGGAAATAGAATTCAGAATATGG + Intronic
1071882048 10:89910368-89910390 CAGAAATAGAATTCAGGATACGG - Intergenic
1073637058 10:105209963-105209985 CTGAAAAACCTTTGAGGACACGG + Intronic
1073711293 10:106045776-106045798 CTGCAAAAGAATACAGCTCATGG + Intergenic
1073879073 10:107958945-107958967 CAGAAAGAGAATTCAGGGGATGG + Intergenic
1073905804 10:108277903-108277925 CTGACAAACTATTCAGTACATGG - Intergenic
1074222164 10:111448652-111448674 AAGAAAAAGAATTCAGGCTAAGG - Intergenic
1074840618 10:117347081-117347103 TGGAGAAAGAATTCAGGACAGGG - Intronic
1075504786 10:123012173-123012195 CTGAACAAGAATTCACGTCAAGG - Intronic
1077553132 11:3211918-3211940 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1077984702 11:7340335-7340357 CAGAAATAGAATTCAGAATATGG - Intronic
1078124871 11:8551428-8551450 CTGATAAAGAATTCAGAATAAGG - Intronic
1078651407 11:13197282-13197304 ATGACAAAGAATTCAAAACATGG + Intergenic
1078816194 11:14824307-14824329 CAGAAATAGAATTCAGAATATGG + Intronic
1078870606 11:15340903-15340925 CAGAAATAGAATTCAGAATATGG - Intergenic
1078993387 11:16671312-16671334 CAGAAATAGAATTCAGAATATGG + Intronic
1079229241 11:18635096-18635118 CTCCAAAAGAAGTCAGGACTAGG - Intergenic
1079868645 11:25767189-25767211 CTGAAAAAGATTTGAGGAGAAGG - Intergenic
1079957229 11:26880490-26880512 CTGAAAAGTCATTCAGGACCAGG - Intergenic
1080000604 11:27344889-27344911 TTGAAAAAGAATTGAAGACCTGG + Intronic
1080749092 11:35136314-35136336 ATGCACAAGAATACAGGACAAGG - Intergenic
1080860479 11:36146123-36146145 CTGAATAAGAATTTAGGTCTTGG - Intronic
1080918106 11:36680611-36680633 TTGAAAAAGAATTCAGGACACGG - Intergenic
1081010496 11:37805603-37805625 CTGAGAAAAAATTCAAGCCAAGG + Intergenic
1081343814 11:41957888-41957910 CAGAAATAGAATTCAGGATATGG + Intergenic
1081401281 11:42645941-42645963 ATGAAAAAGAATTCTGAAAATGG + Intergenic
1082692519 11:56323726-56323748 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1083008308 11:59369284-59369306 CAGAAATAGAATTCAGAATATGG + Intergenic
1084044839 11:66562563-66562585 CTGGAAAAAAAATCAGGACCAGG + Intronic
1084450878 11:69236350-69236372 AAGAAAAAGAATTCAATACATGG - Intergenic
1084925712 11:72509917-72509939 CAGATACAGAATTCAGAACATGG - Intergenic
1085135246 11:74081350-74081372 CTGAAGAAGGAATAAGGACATGG - Intronic
1085569934 11:77550506-77550528 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1086303735 11:85458410-85458432 CAGAAATAGAATTCAGAATATGG - Intronic
1086569014 11:88262042-88262064 CAGAAATAGAATTCAGAATATGG - Intergenic
1086670589 11:89541522-89541544 CTGAAAAAAAAATCAGTATATGG - Intergenic
1087309839 11:96528500-96528522 CAGAAATAGAATTCAGAATACGG + Intergenic
1087503605 11:98992784-98992806 CTTAAAAAGAATTCAAAATAAGG - Intergenic
1087561382 11:99795395-99795417 CAGAAAAACAATTCAGAATATGG - Intronic
1089207520 11:116776524-116776546 CTGAAAGATAATTCAAGAGAAGG + Intergenic
1090162375 11:124509554-124509576 CAGAAATAGAATTCAGAATATGG - Intergenic
1090387993 11:126367532-126367554 CAGAACAAGCATTCAGGACCTGG - Intronic
1090390734 11:126385714-126385736 TTAAAAGTGAATTCAGGACAGGG + Intronic
1090437022 11:126695580-126695602 CTCACAAAGGTTTCAGGACAAGG - Intronic
1090515106 11:127416581-127416603 ATGATAAAGAAATCAGGAGATGG - Intergenic
1090626044 11:128609820-128609842 CTGAAAGAGAATTCAGACCTTGG + Intergenic
1090842273 11:130501389-130501411 CTAAAAAAGAATTAAGTACTTGG - Intergenic
1090913340 11:131141064-131141086 ATGAAGAAGAATTCAGGCCAGGG + Intergenic
1091528105 12:1326515-1326537 TTGATAAAGAATGCTGGACAAGG - Intronic
1092024537 12:5229908-5229930 GTTAACAAGAATTCTGGACAGGG - Intergenic
1092680527 12:10974811-10974833 CAGAAATAGAATTCAGAATATGG + Intronic
1093017488 12:14169798-14169820 TTGAAAAAGAAATCAGCCCATGG + Intergenic
1093060608 12:14599019-14599041 CAGAAATAGAATTCAGAATATGG - Intergenic
1093388160 12:18583884-18583906 CAGAAATAGAATTAAGGATATGG + Intronic
1093931106 12:24955945-24955967 AAGAAAAAAAATTAAGGACATGG - Intergenic
1094015458 12:25857834-25857856 GAGATAAAGAATTCAGGAGATGG + Intergenic
1094246549 12:28302994-28303016 CTGAAAAGGAATCAAGGAAATGG + Intronic
1094796537 12:33979659-33979681 CTGTAAAAGACTTCAGGAAAGGG + Intergenic
1095091637 12:38113013-38113035 CTGAAAGAGAATTCTGAATAGGG + Intergenic
1095824195 12:46515047-46515069 CAGAAATAGAATTCAGAATATGG - Intergenic
1095836019 12:46639209-46639231 CAGAAATAGAATTCAGAATATGG + Intergenic
1095838250 12:46662521-46662543 CACAAACAGAATTCAGGACTTGG - Intergenic
1095969115 12:47889516-47889538 ATGAACAAGAACTCAAGACAGGG + Intronic
1096887980 12:54736529-54736551 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1097384389 12:58932185-58932207 AGGAAATAGAATTCAGGACTAGG - Intergenic
1097589563 12:61557553-61557575 CTGAACAGGAATTCAGAATATGG - Intergenic
1097629471 12:62042526-62042548 CTAGAACAGAATTCAGGGCAAGG - Intronic
1097732438 12:63144586-63144608 CTGAAAAAGTATTCCGGGAAGGG - Exonic
1097797466 12:63879308-63879330 CTTAAAAAGAACAAAGGACAGGG - Intronic
1098385320 12:69912404-69912426 ATGAAAAAGAGTTCTGGAGATGG - Intronic
1099498138 12:83378156-83378178 CAGAAATAGAATTCAGAATATGG - Intergenic
1099858226 12:88197153-88197175 CTTAAAAAAAATACAGGATATGG - Exonic
1100227113 12:92569949-92569971 CTGAACATGATTTCAGGACAGGG + Intergenic
1100795292 12:98175830-98175852 CTGAAAAAGAAGCCAGTATAGGG - Intergenic
1101023904 12:100582111-100582133 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1101220525 12:102634314-102634336 CTGTAAAACATTTTAGGACATGG - Intergenic
1101480577 12:105092728-105092750 CCGAGAAAGAATTCAAAACATGG - Intergenic
1102138897 12:110598258-110598280 ATGAAAAAGAATTCTGGAGATGG + Intergenic
1102807780 12:115797030-115797052 CTGGCTAAGAATTGAGGACAGGG + Intergenic
1102944268 12:116971852-116971874 GTGAAAAACAATTCATGACAAGG - Intronic
1102973778 12:117191302-117191324 CTGAAATAGAATCCAAGACAAGG - Intergenic
1103350862 12:120282634-120282656 CTGAAAAAGAAATCAGCCTACGG + Intergenic
1104351156 12:128045036-128045058 CCGAGAAAGAATTCAGGACAAGG + Intergenic
1105300027 13:19125045-19125067 CTGCATAAGAGATCAGGACAAGG - Intergenic
1105396579 13:20042519-20042541 CAGAAATAGAATTCAGAATATGG - Intronic
1105842470 13:24266672-24266694 CTGTAAAAGGATTAAGCACAGGG - Intronic
1106282930 13:28292529-28292551 CTAAAAAAGCACGCAGGACATGG + Exonic
1106560518 13:30841541-30841563 CTGTAAAGGAGTTCAGGAAATGG + Intergenic
1106725005 13:32475283-32475305 TTGAGAAAGAATTCAGGACATGG + Intronic
1106921314 13:34566702-34566724 TTGTCAAAGAATTCATGACAAGG + Intergenic
1107229470 13:38090869-38090891 CTGAGAAAGAGTTCAGGACATGG + Intergenic
1107729039 13:43329614-43329636 TTGAAAAAGAATACAAGAAATGG - Intronic
1107776765 13:43852151-43852173 CAGAAATAGAATTCAGAATATGG + Intronic
1107965049 13:45590243-45590265 CTGAATGAGAATTCAGGCCTTGG + Intronic
1108105707 13:47006437-47006459 CTTAAAAACAATTTAAGACAAGG - Intergenic
1108397047 13:49999449-49999471 CCAAGAAAGAATTCAGGACATGG - Intronic
1108795461 13:54024495-54024517 CCGAAATAGAATTCAGGATATGG + Intergenic
1109203827 13:59459897-59459919 CTGAAAAAGGATGCAGGGGAAGG + Intergenic
1109422532 13:62132055-62132077 CTGAAAAAGAGGTCAGCAAAGGG - Intergenic
1109674288 13:65653652-65653674 CTGAGAAAGCATTTAGGAAACGG - Intergenic
1109913077 13:68942560-68942582 CTGAAAAAGAATTCAGAAACAGG + Intergenic
1109916807 13:68999745-68999767 CAGAAATAGAATTCAGAATATGG - Intergenic
1110328939 13:74249411-74249433 CTGAAAAAGAATTCAGAGCTGGG + Intergenic
1110602529 13:77391272-77391294 TTGAAAAAGTATTTTGGACATGG - Intergenic
1110954345 13:81535214-81535236 CAGAAATAGAATTCAGAATATGG + Intergenic
1110975817 13:81832807-81832829 CCAAGAAAGAATTCAGGACATGG + Intergenic
1111474987 13:88733800-88733822 CTGAAAAATGATGCAGGACATGG - Intergenic
1111526279 13:89475683-89475705 CAGAAAAAGAATTCAGAATATGG - Intergenic
1112091180 13:96085766-96085788 ATGACAAAGAATTCATGGCAGGG - Intergenic
1112226938 13:97549003-97549025 CTGAAAAAGGATCCATGAGAAGG - Intergenic
1113108208 13:106793728-106793750 TTGAAAAAGAAGACTGGACATGG - Intergenic
1113227031 13:108169935-108169957 CAGAAATAGAATTCAGAATATGG + Intergenic
1113267910 13:108639823-108639845 TTGAAAAAGACTTCAGTACCAGG + Intronic
1113424314 13:110195383-110195405 ATGAAATAGTATACAGGACAGGG - Intronic
1113535532 13:111063311-111063333 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1114234827 14:20814609-20814631 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1114759896 14:25302154-25302176 CAGAAATAGAATTCAGAATATGG + Intergenic
1115118614 14:29912414-29912436 CTGAAAAATAATGCAAGTCAGGG - Intronic
1115756372 14:36529925-36529947 CAGAAAAAGACTTCAGAACATGG - Intergenic
1115757068 14:36539401-36539423 CTGAAGGAGAATTCAGGGGAAGG + Intergenic
1115868765 14:37777577-37777599 CAGAAACAGAATTCAGAAAATGG - Intronic
1116230882 14:42215339-42215361 CTAAAAAAGAACTTAGGACTTGG - Intergenic
1116782552 14:49251780-49251802 CAGAAATAGAATTCAGAATATGG + Intergenic
1116959253 14:50953070-50953092 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1117055731 14:51910442-51910464 GAGAAAAGGAATTCAGGATATGG + Intronic
1117237223 14:53790964-53790986 CTGACAAATACTTCAAGACAGGG + Intergenic
1117403579 14:55379951-55379973 AACAAAAAGAATTCAGGGCAGGG + Intronic
1118448668 14:65876775-65876797 CAGAAATAGAATTCAGAATATGG - Intergenic
1118540234 14:66814825-66814847 CAGAAATAGAATTCAGAATATGG + Intronic
1118793692 14:69119941-69119963 CTGTAAAAGCATTCAGAATAGGG + Intronic
1118957773 14:70498410-70498432 CAGAAATAGAATTCAGAATATGG + Intergenic
1119014184 14:71031991-71032013 CCAAGAAAGAATTCAAGACACGG + Intronic
1119137838 14:72236997-72237019 CTGAGAAAAAAATCAGAACATGG - Intronic
1119559749 14:75580588-75580610 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1120098281 14:80414416-80414438 CTGCAAAATAATTCAGAAAAGGG + Intergenic
1120498218 14:85262197-85262219 CTGAATCAGCATTCAGTACATGG - Intergenic
1121222482 14:92296967-92296989 TAGAAAAACAATACAGGACATGG + Intergenic
1122903524 14:104791792-104791814 TGGAAAAAGAAGTCAGGAGAGGG + Intronic
1123875614 15:24621265-24621287 CAGAAATAGAATTCAGAACATGG - Intergenic
1123991412 15:25686254-25686276 CAGAAAAACAATTAAGAACATGG + Intronic
1124071584 15:26398387-26398409 CTGAATAATAATTCAGTATATGG + Intergenic
1124077921 15:26462999-26463021 CAGAAAGAGAATTAAGGATATGG + Intergenic
1125198375 15:37074893-37074915 ATGAAAAAGAACTCACTACAAGG + Intronic
1125207657 15:37173002-37173024 TTAAAAAAAAATTCAGGCCATGG - Intergenic
1125712324 15:41796891-41796913 ATTAAAAAGAATTCTGGTCATGG - Intronic
1126233618 15:46355576-46355598 CAGAAATAGAATTCAGAATATGG + Intergenic
1126506017 15:49405724-49405746 CAGAAATAGAATTCAGAATATGG - Intronic
1126519859 15:49580651-49580673 CAGGCAAAGAATTCAGAACATGG + Intronic
1126766637 15:52017219-52017241 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1127032709 15:54881460-54881482 TTGAAAAATAATACAGGAAATGG - Intergenic
1127382717 15:58443761-58443783 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1127527653 15:59809639-59809661 CTCAAAAACAATTCAGGTCCTGG - Intergenic
1129443700 15:75601219-75601241 CTGAAATAGAAATTAGAACAAGG + Intronic
1130843007 15:87719320-87719342 CTGGAAAAGAACTTAGGAGAAGG - Intergenic
1131195262 15:90350310-90350332 CTGGAACAGAGTTCAGGACCTGG - Intergenic
1131597681 15:93814318-93814340 CAGAAATAGAATTCAGAATATGG + Intergenic
1131720257 15:95160529-95160551 CAGGAAAAGAAAGCAGGACATGG + Intergenic
1131737997 15:95354885-95354907 CTGAATAAGAAGACAGGGCAGGG + Intergenic
1131751552 15:95513611-95513633 CAGAAAAAAATTTCATGACATGG + Intergenic
1131771323 15:95741059-95741081 CAGAAAAAGAATTCACACCAAGG + Intergenic
1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG + Intergenic
1133556234 16:6908719-6908741 GTGAACAAGGATTGAGGACAAGG - Intronic
1133679708 16:8109367-8109389 CCAAGAAAGAATTCATGACACGG + Intergenic
1133807190 16:9134610-9134632 TTGAAAAATATTTCAAGACATGG + Intergenic
1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG + Intronic
1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136521681 16:30800770-30800792 TTGAAAAAGAATTCATGGCCGGG - Intergenic
1137980985 16:53069366-53069388 ATGAAAAAGAGTTCTGGAGATGG - Intronic
1138409065 16:56823474-56823496 CTGAAAACCAACTCAGGGCAGGG + Intronic
1138726544 16:59146606-59146628 CTGAAAAATACTTGAGGATAGGG + Intergenic
1138883775 16:61050159-61050181 CAGAAATAGAATTCAGAATATGG - Intergenic
1139167190 16:64581039-64581061 TTGAGAAAGAATTCAGGACACGG - Intergenic
1139745551 16:69071402-69071424 CAGAAAAAGGACTCTGGACACGG - Intronic
1139886593 16:70212679-70212701 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1140017991 16:71206590-71206612 CAGAAATAGAATTCAGAATATGG + Intronic
1140160385 16:72485019-72485041 CTAAAAAAGAATTCATGGCCGGG - Intergenic
1140240607 16:73196472-73196494 CTGAAAAATAATTCTGAACTGGG + Intergenic
1140793401 16:78413361-78413383 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1141514734 16:84536260-84536282 CGGAGAAAGAATTCAGGACACGG - Intronic
1142600162 17:1049973-1049995 TTGAAAAGGAATTCTGGTCAAGG - Intronic
1143048382 17:4101233-4101255 CTGAGAACGAATACAGGAAACGG + Intronic
1144177411 17:12720422-12720444 TCGAGAAAGAATTCAGGACAGGG - Intronic
1144483966 17:15649857-15649879 CACAAAAAGCATTCAGCACATGG + Intronic
1146083156 17:29801493-29801515 CTGGAAAAGAATATAGGAGAGGG - Intronic
1146232884 17:31129887-31129909 CAGAAACAGAATTCAGAATATGG - Intronic
1147368452 17:39974781-39974803 TCGAAAAAGAAATCAGGAAATGG + Intronic
1148937031 17:51171522-51171544 CTGAAAAAGAAATCAGCCTATGG + Exonic
1149587567 17:57802892-57802914 TTGCAAAAGAATTCACAACAAGG + Intergenic
1149756807 17:59193388-59193410 CTGAGAAAGCATTCAATACATGG + Intronic
1149867805 17:60160459-60160481 GAGAAAGAGAATTCAGGGCAGGG + Intronic
1150115591 17:62546175-62546197 CTACAAAAGAAATTAGGACATGG - Intronic
1150171265 17:62997938-62997960 ATGACAGAGAATTCAGAACATGG + Intergenic
1150239451 17:63620657-63620679 AAGAAAAAGAAAACAGGACAAGG + Intergenic
1150635557 17:66910945-66910967 CGGAAAAAGAACTCAGGTCTGGG + Intergenic
1150997432 17:70334801-70334823 CTGAAGTCAAATTCAGGACATGG - Intergenic
1151204592 17:72496862-72496884 CTGATAAAATATTGAGGACAGGG + Intergenic
1152163240 17:78682829-78682851 CTGAAAATGAATGCACGCCAAGG - Intronic
1152510185 17:80781446-80781468 CCGAAAAGGAACTCAGGAAAAGG + Intronic
1153094451 18:1384280-1384302 CAGAAATAGAATTCAGAACATGG + Intergenic
1153110731 18:1583340-1583362 TTGAAAAAGAATTTTGGAAATGG - Intergenic
1153776576 18:8459401-8459423 ATTAAAAAGAAATAAGGACAGGG - Intergenic
1153785499 18:8530215-8530237 CAGAAACAGAATTCAGAATATGG + Intergenic
1154220320 18:12447284-12447306 CTGAACAAGAAACCAGGACACGG + Exonic
1154473305 18:14725556-14725578 CTGATGAAGAAATCAGGAAATGG - Intergenic
1155807825 18:30193885-30193907 ATGAAAGACAATTCAGGACTGGG - Intergenic
1155855776 18:30832571-30832593 CTGAAAAAAAATCAAAGACAAGG + Intergenic
1156022006 18:32610241-32610263 CTGAAAAACACATCAGGACATGG + Intergenic
1156396092 18:36701095-36701117 CAGAACAAGCATTCAGTACATGG + Intronic
1156505470 18:37587882-37587904 CTGAAAAAGAAACCTGGAAATGG + Intergenic
1156900217 18:42291921-42291943 ATAAAAAAGAATTAAGGACTGGG + Intergenic
1157447658 18:47757391-47757413 AAAAAAAAGAATTCAGGAAAAGG + Intergenic
1157627779 18:49065714-49065736 CTGAAAAAAAATTAAAAACAGGG + Intronic
1157891082 18:51418576-51418598 TCAAGAAAGAATTCAGGACACGG - Intergenic
1157902199 18:51529400-51529422 CTGAAAAATAATTCTGTTCATGG + Intergenic
1158095624 18:53767102-53767124 CAGAAAGAGAATTCAGAACATGG + Intergenic
1158235109 18:55303546-55303568 CTAACAAAGAATTCTGGAAAAGG - Intronic
1158337319 18:56426872-56426894 CAGAAATAGAATTCAGAATATGG + Intergenic
1158669754 18:59464140-59464162 CTTAAAAAGTAGTCAGGGCATGG + Intronic
1158897670 18:61930310-61930332 CAGAAAAAAAATTAAGAACATGG - Intergenic
1159130454 18:64275416-64275438 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1159359259 18:67380439-67380461 CAGAAATAGAATTCAGAGCATGG - Intergenic
1159782524 18:72676260-72676282 CTGAAAATGACTTCAGAGCAAGG + Intergenic
1164259266 19:23554943-23554965 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1164942881 19:32265253-32265275 CTGAAGCAGAATTGAGGAAAGGG - Intergenic
1166411387 19:42557679-42557701 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1166439002 19:42794175-42794197 CTGAGAAAGAATTCGGGACATGG + Intronic
1166474004 19:43104947-43104969 ACTAGAAAGAATTCAGGACATGG + Intronic
1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG + Intronic
1166494782 19:43291891-43291913 CTGAGAAAGAATTCAGGACATGG + Intergenic
1166667116 19:44687199-44687221 TTGCAAAAGAAATCAAGACATGG + Intergenic
1167423644 19:49418139-49418161 CTGAAAAACACTGCAGGCCATGG + Intergenic
1167901704 19:52627203-52627225 CTGAAAAAGAAGTCAGCAAAAGG - Intronic
1168209539 19:54880527-54880549 CAGAAATAGAATTCAGAATATGG - Intronic
1168617646 19:57851366-57851388 TTGGAAAAGAATTCAGTTCATGG - Intronic
924963943 2:58414-58436 CTGGACAAGAATTCAGGCAAAGG + Intergenic
925323265 2:2993570-2993592 CTGAGAAAGAATTCAGGATGCGG - Intergenic
925647074 2:6046098-6046120 CAGAAATAGAATTCAGAATATGG + Intergenic
925795570 2:7538955-7538977 CAGAAAAAGAATTCAGAAGGTGG - Intergenic
927565216 2:24105629-24105651 CAGAAATAGAATTCAGAATATGG + Intronic
927829687 2:26338750-26338772 CTGAAAAAGACTGCCGGATACGG - Intronic
928462039 2:31484290-31484312 CAGAAATAGAATTCAGAATATGG - Intergenic
928877015 2:36052106-36052128 CAGAAATAGAATTCAGAATATGG - Intergenic
928986547 2:37188028-37188050 CTGAAAAATAATTTATAACATGG + Intronic
929373192 2:41251642-41251664 CTGTCATAGAAATCAGGACAAGG - Intergenic
929530227 2:42746142-42746164 CAGACAAAGATTTCAAGACAAGG - Intronic
930229555 2:48828894-48828916 CAGAAATAGAATTCAGAATATGG + Intergenic
930586094 2:53268461-53268483 CAGAAATAGAATTCAGAATATGG + Intergenic
930652210 2:53973690-53973712 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
930866956 2:56131198-56131220 CTGAGAAACAGTTCAGGGCAGGG + Intergenic
931053989 2:58447928-58447950 ATGAAGAAGAATGAAGGACAGGG - Intergenic
931270710 2:60699985-60700007 CTGAAGAAGAATCCAGGGGAAGG - Intergenic
931309859 2:61067389-61067411 CTAAAATGGAATTCAGGGCAAGG - Intronic
931488979 2:62724447-62724469 CAGAAATAGAATTCAGTATATGG - Intronic
932512155 2:72303661-72303683 CAGAAATAGAATTCAGAATATGG - Intronic
933755572 2:85635653-85635675 CTGAAAAGGCATACAGAACAAGG - Intronic
933882635 2:86685793-86685815 CAGACAAAGAATTTAGCACAAGG - Intronic
934537821 2:95150848-95150870 CTGAAAAAGAGGACAGGACCTGG - Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934893175 2:98088210-98088232 CTGAAAAAGAAGTCTGGGCTAGG - Intronic
934979208 2:98826394-98826416 CTGAAAATGCAGCCAGGACAGGG + Intronic
935180778 2:100689443-100689465 CTGCAAAAGAAAGAAGGACAGGG + Intergenic
935456813 2:103279117-103279139 CTGAAAAAGAATACAGTTGAAGG + Intergenic
935556355 2:104513598-104513620 CTGAGAAAGAAGTCAGGAGTGGG - Intergenic
935693197 2:105748225-105748247 ATGAGTAAGAACTCAGGACACGG - Intronic
936170237 2:110164571-110164593 CTGAAACAGGGTTCAGGGCATGG - Exonic
936487550 2:112939245-112939267 CTGAAAAGGAATTTAGGGAAAGG + Intergenic
936817887 2:116482249-116482271 CTGAAGAAGTATTCAGTACATGG + Intergenic
937410606 2:121671376-121671398 TTAAAAAAAAATACAGGACATGG + Intergenic
937483266 2:122286345-122286367 CTGCAAAAGAATTCAAAATAGGG - Intergenic
937521123 2:122713091-122713113 CAGAAATAGAATTCAGAATATGG + Intergenic
938016623 2:127872669-127872691 CTGAAAAATCCTTCAAGACAAGG + Intronic
938747287 2:134291563-134291585 CTGGAAAAGCATTCATGACAAGG + Intronic
939089177 2:137758412-137758434 CAGAAATAGAATTCAGAATATGG + Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
939768909 2:146289974-146289996 CTGAAAACCAGTTCAGGCCATGG - Intergenic
940456817 2:153912381-153912403 CAGAAATAGAATTCAGAATAAGG - Intronic
940545929 2:155085275-155085297 CTGGCAAAGATTTCATGACAAGG - Intergenic
940565520 2:155355902-155355924 CAGATAAAGAATTCAGGATATGG - Intergenic
940784866 2:157970951-157970973 CTGAAAAAGAATTCAGAAGGAGG - Intronic
941141381 2:161787880-161787902 CTGATAAGGAATTCAAGATACGG - Intronic
941527733 2:166627709-166627731 CAGAAATAGAATTCAGAATATGG - Intergenic
941557779 2:167004668-167004690 CAGAAACAGAATTCAGGTCATGG + Intronic
941566525 2:167115336-167115358 CAGAAATAGAATTCAGAATATGG - Intronic
942081799 2:172406878-172406900 CTGAAAAAAAATTCATGTAAGGG + Intergenic
942291672 2:174478508-174478530 CTAAAAAAGAAGGCTGGACATGG - Intronic
942405366 2:175647884-175647906 CAGAAATAGAATTCAGAATATGG + Intergenic
942626092 2:177902338-177902360 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
943128964 2:183833216-183833238 CTGAATAAGCATTATGGACAGGG - Intergenic
943152927 2:184137603-184137625 CAGAAACAGAATTCAGGATACGG - Intergenic
943455734 2:188104178-188104200 CAGAAATAGAATTCAGAATATGG + Intergenic
943611788 2:190043667-190043689 CAGAAATAGAATTCAGAACATGG - Intronic
944145514 2:196503484-196503506 CAGAAAAAGAACTAGGGACAAGG + Intronic
944821405 2:203435878-203435900 CTGAAAAATATTTCAGGTAATGG - Exonic
944876543 2:203968174-203968196 CTGAAAGAACATTGAGGACATGG - Intergenic
945366402 2:208959884-208959906 CAGAAATAGAATTCAGAATATGG + Intergenic
945573826 2:211504632-211504654 CAGATAAAGAATTCAAGATATGG + Intronic
945682763 2:212933999-212934021 CTGAAAAAAATGTCAGGAAATGG + Intergenic
945971098 2:216233033-216233055 CAGAAAAACAATTCAGGATATGG - Intergenic
946299978 2:218817018-218817040 CTGAAAAAGAGATCAGAATAAGG + Intergenic
946406387 2:219494102-219494124 CTGCAGAAGAAACCAGGACAGGG + Intronic
946424715 2:219587604-219587626 GCAAAAAAGAATTCAGGGCAAGG + Intergenic
946479758 2:220043365-220043387 CTGATAAAGAAGTCATCACAAGG - Intergenic
946804952 2:223462692-223462714 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
947455216 2:230248007-230248029 CAGAAAAAGAAACCAAGACAAGG + Exonic
947455754 2:230252458-230252480 CAGAAAAAGAAACCAAGACAAGG + Intronic
947684287 2:232068743-232068765 ATAAAAAAAATTTCAGGACAAGG - Intronic
949054166 2:241915982-241916004 CAGAAATAGAATTCAGAATATGG + Intergenic
1169577713 20:6984064-6984086 CAGAAATAGAATTCAGAATATGG + Intergenic
1170037202 20:12002235-12002257 ATGAGAAAGATTTCAGGACTTGG + Intergenic
1170050900 20:12144445-12144467 CAGACATAGAATTCAGAACATGG - Intergenic
1171064247 20:21997671-21997693 CAAAAAAATAATTCAGGACCAGG + Intergenic
1171081616 20:22192061-22192083 CAGAAATAGAATTCAGAATATGG + Intergenic
1171464307 20:25317079-25317101 CTGGAGAAGAAAACAGGACATGG + Intronic
1173711887 20:45165138-45165160 CAGAAATAGAATTCAGAATATGG + Intergenic
1174123005 20:48281191-48281213 CAGAAAAGGAATTTAGGAAATGG + Intergenic
1174229702 20:49035673-49035695 CTGAAAAAGAAATAAGGCCTTGG - Exonic
1174387663 20:50197004-50197026 CTGAGAAAGAACTCAGGAGGGGG - Intergenic
1174585773 20:51606979-51607001 CTAAAAAAGGATTCTGGGCATGG + Intronic
1174676437 20:52361396-52361418 TTGAAAAAAAATTCAGGGCTGGG - Intergenic
1174745472 20:53057851-53057873 CTAAATAAGATTTGAGGACATGG + Intronic
1175584235 20:60125146-60125168 GAGAAAGAGAATTCAGGCCATGG + Intergenic
1176136959 20:63527736-63527758 CAGAACAAGAATTAATGACATGG - Intergenic
1176801179 21:13432310-13432332 CTGATGAAGAAATCAGGAAATGG + Intergenic
1176969506 21:15249418-15249440 CTGAGATAGAATTCAGGGAAAGG + Intergenic
1177174678 21:17690790-17690812 GTAAGAAAGAATCCAGGACAAGG - Intergenic
1177579005 21:22994902-22994924 CAGAAAAAGAATTCAGAAGGTGG + Intergenic
1177933442 21:27315008-27315030 CAGAGAAAAAATTCAGGACATGG - Intergenic
1178335840 21:31742351-31742373 GTAAAAGAGAATTCAGGGCAAGG - Intergenic
1178494241 21:33073230-33073252 CTTAAGGAGAAGTCAGGACAGGG + Intergenic
1178740284 21:35193694-35193716 ATGAAAAAGACTTGAGGAGAAGG - Intronic
1181019460 22:20091489-20091511 CTGTGAAAAAATTCAGGACTTGG + Exonic
1181144236 22:20832873-20832895 CAGAAATAGAATTCAGAATATGG - Intronic
1181721335 22:24777014-24777036 CTGTCAAAGAAAACAGGACAGGG + Intergenic
1182846690 22:33437061-33437083 CTGCATAAGAATTCTGGCCACGG + Intronic
1182949712 22:34362104-34362126 GTGGAGAAGAATTCAGGACAAGG + Intergenic
949214944 3:1555077-1555099 CAGAAAAAAAATTCAGAAGAAGG - Intergenic
949377470 3:3406070-3406092 CAGAAAAAGAATTCAGGAGGTGG + Intergenic
949434202 3:4010330-4010352 CTGAACTGGAATTCAGCACACGG + Intronic
949774714 3:7619753-7619775 CTGATAAAGAAGTTGGGACAAGG + Intronic
949972552 3:9422095-9422117 CTGAAAAAGAAACCAGGCCTAGG + Intronic
950503804 3:13380842-13380864 ATGAAAAATAACCCAGGACAAGG - Intronic
950599098 3:14016420-14016442 CTGAAAAATAATTCAGAAGGTGG - Intronic
950600873 3:14034665-14034687 CAGAAAAAGAATTCAGAATATGG - Intronic
951168017 3:19506131-19506153 CAGAAATAGAATTCAGAATATGG - Intronic
951197166 3:19837054-19837076 CAGAAAAAGAATTCAGAATATGG + Intergenic
952454855 3:33463575-33463597 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
952606700 3:35155576-35155598 CAGAAAAAGGATTCAGAATATGG + Intergenic
952651026 3:35726781-35726803 CTGAAAAAGAGTTGGGGCCAAGG - Intronic
952984764 3:38769534-38769556 CAGATAAAGAATTCAGGGCTGGG - Intronic
953104390 3:39861509-39861531 CAGAAATAGAATTCAGAACATGG + Intronic
953857562 3:46511766-46511788 CTGAATAAGAATTTAGGAAAGGG - Intergenic
954480502 3:50795966-50795988 CAGAAATATAATTCAGAACATGG - Intronic
954522472 3:51241900-51241922 CAGAAATAGAATTCAGAATATGG - Intronic
955107866 3:55916867-55916889 CTGGAATAGTATTTAGGACAGGG + Intronic
955548725 3:60059622-60059644 CTGAGAAAGAATTCAGCTGAGGG - Intronic
955681270 3:61504703-61504725 CAGAAATAGAATTCAGAATATGG - Intergenic
956114815 3:65907667-65907689 CTGAATGAGAATTCAGAACTGGG - Intronic
956371946 3:68572089-68572111 CAGAAATAGAATTCAGAATATGG + Intergenic
957023131 3:75146937-75146959 CTGACTAAGAAATGAGGACATGG - Intergenic
957394160 3:79618616-79618638 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
958148373 3:89657400-89657422 CTGAAATAGAATTCAGAATATGG - Intergenic
958739646 3:98053496-98053518 CTGAAAAAGAATTCTGAGAAGGG + Intergenic
959113242 3:102146660-102146682 CTGGCAAAGATTTCATGACAAGG - Intronic
959265660 3:104134095-104134117 TGCAGAAAGAATTCAGGACAGGG - Intergenic
959295798 3:104532138-104532160 CAGAAACAGAATTCAGAATATGG + Intergenic
959439305 3:106357605-106357627 CAGAAATAGAATTCAGAATATGG - Intergenic
959452286 3:106518331-106518353 CAGAAACAGAATTCAGAATATGG + Intergenic
960012711 3:112850454-112850476 CAGAAAAAGAATTCAGAATATGG + Intergenic
960215436 3:115030034-115030056 ATGAAAAATAATTAAGGACCTGG + Intronic
960343033 3:116498182-116498204 CAGAAATAGAATTCAGAATATGG + Intronic
960352453 3:116609975-116609997 GGGAAAAAAAATTCTGGACAAGG + Intronic
960564653 3:119120389-119120411 CTGAGAAAGAATTCAGAACATGG + Intronic
960688209 3:120314733-120314755 CAGAAATAGAATTCAGAATATGG + Intergenic
960785656 3:121370984-121371006 CAGAAATAGAATTCAGAATATGG - Intronic
961343755 3:126247660-126247682 CTGAAAAAGAAGTCAGCAAAGGG - Intergenic
962228308 3:133635252-133635274 CTCAAAAAGAAATAAGTACAAGG - Intronic
962667564 3:137670453-137670475 GTAGAAAAGAATTCAGGAAAAGG + Intergenic
963989332 3:151635108-151635130 CAGAAAAATAAGTCAGGGCATGG + Intergenic
964047009 3:152340768-152340790 CTGAAGAAGAATCCAGCAGAAGG + Exonic
964142863 3:153422988-153423010 CAGAAACAGAATTCAGAATATGG + Intergenic
964467675 3:157015119-157015141 CTGAAAGAAATTTCAGGTCATGG + Intronic
964910303 3:161772885-161772907 CAGAAAAAGAAATGAGGGCATGG - Intergenic
964930878 3:162020623-162020645 CTGAAGATGAACTCAGGACTGGG + Intergenic
964940379 3:162153511-162153533 CTGAAAAAGGAATCAGCAAAGGG + Intergenic
965009228 3:163064133-163064155 CAGAAACAGAATTCAGAATATGG + Intergenic
965317916 3:167213207-167213229 CAGAAATAGAATTCAGAATATGG + Intergenic
966521790 3:180881555-180881577 CTGAGAAAGAATTCAGGACATGG - Intronic
966630190 3:182064335-182064357 CTAAAAAAAAACTCAGGCCAAGG - Intergenic
966631953 3:182086118-182086140 ATTAAAAATAATTCAGGACCAGG + Intergenic
967761999 3:193236538-193236560 TTGAGAAAGAATCCAGGACTTGG + Intergenic
967854856 3:194109592-194109614 CAAAAAAGGAATGCAGGACAAGG + Intergenic
968412159 4:399703-399725 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
969514192 4:7637433-7637455 CTGAAACAGAATTTTAGACAGGG + Intronic
970180337 4:13384879-13384901 CAGAAAAAGAATTCAGAATATGG + Intronic
970397582 4:15684921-15684943 CTGGGAGAGAATTCAGGACCTGG - Intronic
970530272 4:16974694-16974716 CTAAAACAGAAAGCAGGACATGG - Intergenic
970787491 4:19816548-19816570 CTGAAAAAGAATTGAGGTCTTGG - Intergenic
970817511 4:20175231-20175253 CTGAAAAGGCATTGTGGACAAGG + Intergenic
970983654 4:22130137-22130159 AAGAAAAAGAATTCAGGAGGAGG + Intergenic
971605189 4:28650364-28650386 CAGAAATAGAATTCAGAATATGG - Intergenic
971919289 4:32915630-32915652 CTGAAAACTCATTCAGGCCATGG - Intergenic
972269956 4:37501733-37501755 CAGAAATAGAATTCAGGATATGG - Intronic
972305145 4:37823705-37823727 CTGGAAAAAATTGCAGGACATGG - Intergenic
972828140 4:42785544-42785566 CAGAAACAGAATTCAGAATATGG - Intergenic
973334316 4:48940844-48940866 CTGAAACAGGATTCAGGAAAGGG - Intergenic
973632975 4:52836610-52836632 CTCAAAAAGAATCCAGAGCATGG + Intergenic
973821316 4:54664185-54664207 CTGAAAAAAACTACAGTACAAGG + Intronic
973853747 4:54988258-54988280 TAGAAAAACAATTCAGGATATGG + Intergenic
974226164 4:59048218-59048240 TTGAAAAAAAATACAGGATATGG + Intergenic
974240240 4:59237447-59237469 CAGAAATAGAATTCAGAATATGG - Intergenic
974557849 4:63475070-63475092 ATGAAAAAGACTTCAACACAAGG - Intergenic
974983455 4:68990299-68990321 CTGACAAGGAAATGAGGACAAGG + Intergenic
975017158 4:69436682-69436704 CTGATAAGGAAATGAGGACAAGG - Intergenic
975763176 4:77637543-77637565 CTGAAAAATAAATCAAGAAAAGG - Intergenic
975974707 4:80081599-80081621 TTGAAGAAGAATTCTGGTCAGGG + Intronic
975999739 4:80359799-80359821 CAGAAATAGAATTCAGAATACGG - Intronic
976606360 4:86987133-86987155 CTGATAAGAAATTCAGGATAAGG - Intronic
976768070 4:88619157-88619179 CGTGAAAAGAATTCAAGACATGG - Intronic
976948342 4:90798452-90798474 CAGAAATAGAATTCAGAATATGG - Intronic
977015882 4:91693023-91693045 ATGGAAAAGTATTGAGGACATGG - Intergenic
977393999 4:96449656-96449678 ATGAAATAGAATTCAGAATATGG - Intergenic
977482359 4:97594165-97594187 CAGAAATAGAATTCAGAATAAGG + Intronic
977819958 4:101459583-101459605 CAGAAATAGAATTCAGAATATGG + Intronic
978208355 4:106105924-106105946 CAGAAACAGAATTCAGAATATGG + Intronic
978238224 4:106486534-106486556 CAGAAAGAGAATTCAGAATATGG - Intergenic
978356083 4:107876040-107876062 CTGAAAAATTATTAAGGAGAAGG - Intronic
979704146 4:123700880-123700902 ATGAAAAAGAATGCATGAGATGG - Intergenic
979937352 4:126714955-126714977 TTGAGAAATAATTCAGGACACGG + Intergenic
980257509 4:130401873-130401895 CTGAAATAGAATTCAGAATATGG - Intergenic
980555491 4:134398180-134398202 CTGGCAAAGATTTCATGACAAGG - Intergenic
980593136 4:134917346-134917368 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
980685199 4:136219149-136219171 CAGAAACAGAATTCAGAATATGG - Intergenic
980966256 4:139524336-139524358 TTCAAAAAGAATTCAGTTCAGGG + Intronic
981063124 4:140448676-140448698 CAGAAATAAAATTCAGGATATGG - Intronic
981627519 4:146776265-146776287 CAGAAATAGAATTCAGAATATGG - Intronic
982474795 4:155836858-155836880 CTGAAATGAAAATCAGGACAGGG + Intronic
982499233 4:156132037-156132059 CAGAAATAGAATTCAGAATATGG + Intergenic
982697557 4:158620641-158620663 GCGAAAAAGATTTCAGAACAAGG + Intronic
982804510 4:159747811-159747833 CTGACAAAAAATTCAAGAAAAGG - Intergenic
983270584 4:165557135-165557157 CCGAGAAAGAATTTAGGACATGG + Intergenic
983487808 4:168352686-168352708 CAGAAATAGAATTCAGAACATGG - Intergenic
983547159 4:168976452-168976474 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
983773611 4:171579082-171579104 CTGAAAAACAAATCATGATAAGG + Intergenic
983898535 4:173107354-173107376 CTGAAAATGAATTCTGAAGAAGG + Intergenic
984144325 4:176043314-176043336 CAGAAATAGAATTCAGAATATGG - Intergenic
984192999 4:176626386-176626408 CCAAGAAAGAATTCAGAACATGG - Intergenic
984580036 4:181501117-181501139 CAGAAAATGACTTCAGGACTTGG + Intergenic
984933075 4:184865465-184865487 ATGAAAAAGAATCCAATACAAGG - Intergenic
985223996 4:187739228-187739250 CAGAAAAAGAATTCAAAGCATGG + Intergenic
986654861 5:10000728-10000750 CAGAAATAGAATTCAGAATATGG + Intergenic
986877957 5:12133358-12133380 CAGAAATAGAATTCAGAATATGG + Intergenic
986918904 5:12661387-12661409 TAGAGAAAGAATTCAGGACATGG + Intergenic
987263863 5:16230960-16230982 CTAAAAAAGAATTCAAAACATGG + Intergenic
988196495 5:28012208-28012230 TTGAGAAAGAATCCAGGACATGG - Intergenic
988196859 5:28015337-28015359 TCGAGAAAGAATTCAGGACATGG - Intergenic
988336533 5:29914812-29914834 CAGAAATAGAATTCAGAATATGG + Intergenic
988348736 5:30072864-30072886 CAGAAATAGAATTCAGAATAAGG + Intergenic
988618984 5:32803155-32803177 CTGAGAAAGAATTCAGGACATGG - Intergenic
988865120 5:35325525-35325547 CAAAAATAGAATTCAGCACATGG + Intergenic
988936129 5:36084403-36084425 CAGAAATAGAATTCAGAATATGG + Intergenic
989591236 5:43114917-43114939 CTGGGAAAGAAGGCAGGACAGGG - Intronic
989693525 5:44172135-44172157 CAGAAGTAGAATTCAGGATAGGG + Intergenic
990321585 5:54634749-54634771 TTAAAAAAAAATTCATGACAAGG + Intergenic
990564575 5:57016543-57016565 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
990796054 5:59542182-59542204 CTGGAAAAGAAATCAGAACTTGG - Intronic
991161154 5:63504879-63504901 CAGAAATAGAACTCAGGATATGG - Intergenic
991209359 5:64086713-64086735 CAGATATAGAATTCAGGATATGG - Intergenic
991388349 5:66115233-66115255 ATGAAAAAGAATACAGAAGAAGG - Intergenic
991641207 5:68755208-68755230 CTGAAAAAAATTTAGGGACAGGG + Intergenic
992607936 5:78480153-78480175 CTGAAAAATAAATCAGGATTTGG - Intergenic
993306183 5:86278435-86278457 CTTAATAAAAATACAGGACATGG - Intergenic
993634229 5:90325245-90325267 CAGAAATAGAATTCAGAATATGG - Intergenic
993793537 5:92237101-92237123 CAGAAATAGAATTCAGAATATGG - Intergenic
994190317 5:96861985-96862007 TTGAAAAAAAAATCAAGACAAGG + Intronic
994229699 5:97299012-97299034 CTGAGAAAGAATTCAGGACACGG + Intergenic
994242637 5:97443258-97443280 CAGAAATAGAATTCAGAATATGG - Intergenic
994325524 5:98441226-98441248 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
994359001 5:98828566-98828588 CAGAAATAGAATTCAGAATATGG + Intergenic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
994597832 5:101861357-101861379 CAGAAATAGAATTCAGAATATGG + Intergenic
994642947 5:102433241-102433263 CTGAAATAGAATTCAGAATATGG - Intronic
994768205 5:103949482-103949504 CTGAAAGAGAACTCAGTGCAAGG - Intergenic
994970629 5:106731794-106731816 CAGAAATAGAATTCAGAATATGG + Intergenic
995029165 5:107460274-107460296 CTAAAAATGAATTTAAGACATGG + Intronic
995168318 5:109074780-109074802 CTGAAAAATGATTCATGCCAAGG - Intronic
995691507 5:114830733-114830755 CAGAAATAGAATTCAGAATATGG + Intergenic
996166979 5:120236264-120236286 CAGAAACAGAATTCAGAATATGG - Intergenic
996402711 5:123080537-123080559 TTGAAACAGCCTTCAGGACATGG - Intergenic
996555240 5:124771609-124771631 CTGAAAGAGAATGCAGCAAATGG - Intergenic
996663289 5:126028397-126028419 CAGAAATAGAATTCAGAATATGG + Intergenic
996677807 5:126196594-126196616 ATGATAAGGAATTCAGGAAAAGG + Intergenic
997182103 5:131840824-131840846 CAGAAATAGAATTCAGAATATGG - Intronic
997545409 5:134702303-134702325 ATGAAAAAGAATGCTGGGCATGG - Intronic
998304681 5:141062114-141062136 CAGAAGAAGAATTGAGGAAATGG + Intergenic
998874578 5:146586396-146586418 CTGAAAAAGAAATGAGGCCTGGG + Intronic
999226529 5:150029729-150029751 CTGACAAAGAACACATGACAGGG - Intronic
999315566 5:150581738-150581760 CTGAAAAAGAATACAGCAGGAGG + Intergenic
1000913225 5:167047251-167047273 CTGAAAAGGAATCCAGGAAAGGG - Intergenic
1001559282 5:172658846-172658868 CTGAAAAAGAATTGGGGGTAGGG - Intronic
1001560139 5:172663664-172663686 CTGACCAAGAATTGAGGCCAGGG - Intronic
1002386842 5:178874712-178874734 CAGAAACAGAACTCAGAACATGG - Intronic
1003561599 6:7185206-7185228 CACAAAAAGAATTAAGGATATGG - Intronic
1006149627 6:31979759-31979781 CTGAAATAGAATTCAGTTCTTGG + Intronic
1006746063 6:36342839-36342861 CTCACTAAGACTTCAGGACAGGG + Intergenic
1006878813 6:37321496-37321518 CTGAAAAAGAATTCCTCCCAGGG + Intronic
1006992384 6:38226429-38226451 CTGCAAAAGGAGTCAGGAAATGG + Intronic
1007152845 6:39711646-39711668 CTTAGAAAAAATTCAGGACTGGG - Intronic
1007237233 6:40399395-40399417 AAGAAAGAGAATTCAGTACAGGG - Intronic
1007572213 6:42901099-42901121 CTGGGAAAAAATTCAGGACCTGG - Intergenic
1008258823 6:49339600-49339622 TTGAGAAATAATTCAGGACATGG - Intergenic
1008720396 6:54342661-54342683 CTAAAAAGGACTTCAGGACTGGG - Intronic
1008978883 6:57460047-57460069 CTGAAAAAGCATGGAGAACAAGG - Intronic
1009004708 6:57769722-57769744 CTGAAAAATAATTCAGAATTTGG - Intergenic
1009051443 6:58281690-58281712 CTAAAAAAGAAAACATGACATGG + Intergenic
1009167019 6:60353036-60353058 CTGAAAAAGCATGGAGAACAAGG - Intergenic
1009657864 6:66569111-66569133 CCGAGAAAGAATTCAGGACTTGG + Intergenic
1009769435 6:68126405-68126427 CAGAAATAGAATTCAGAATAGGG - Intergenic
1009787780 6:68360660-68360682 CTGAAAGAGAATGGAGGACACGG - Intergenic
1009820957 6:68800537-68800559 CTACAAAAATATTCAGGACAAGG + Intronic
1010210192 6:73356666-73356688 CTGAAAAAAAATTTAAGAAAAGG - Intergenic
1010295654 6:74193653-74193675 CAGAAATAGAATTCAGAATATGG - Intergenic
1010466038 6:76167413-76167435 CAGAAATAGAATTCAGAATATGG + Intergenic
1010495631 6:76531687-76531709 CAGAAATAGAATTCAGAATATGG - Intergenic
1010822756 6:80434634-80434656 CTGAAAAAGAATTCTACAAAGGG - Intergenic
1011241491 6:85276207-85276229 CTGGCAAAGATTTCATGACAAGG - Intergenic
1011326429 6:86153410-86153432 CTGAAAAAGAATTTTGGATGTGG + Intergenic
1011887897 6:92120341-92120363 CTTAAAAAGACTTCAGGATTTGG + Intergenic
1012143490 6:95652061-95652083 CTGCAAAATAATTCAGGATAAGG + Intergenic
1012203314 6:96433482-96433504 CTAAAAAAAAATACAGGATATGG - Intergenic
1012422000 6:99075856-99075878 CAGGAAAAGTATTCAAGACAGGG + Intergenic
1012450770 6:99350501-99350523 CTGAAAAAGGATTCGGGCCGTGG + Intergenic
1012452395 6:99366405-99366427 CTGAAGAAGAGGTCAGGGCATGG + Intergenic
1012490581 6:99779253-99779275 CAGAAATAGAATTCAGTATATGG - Intergenic
1013727270 6:113114243-113114265 CAGAAACAGAATTCAGAATATGG + Intergenic
1013738054 6:113249804-113249826 CAGAAATAGAATTCAGAATATGG + Intergenic
1014115605 6:117664863-117664885 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1014337947 6:120161565-120161587 CTTACAAAGAATTCATGAAATGG - Intergenic
1015197397 6:130538150-130538172 CAGAAATAGAATTCAGAATATGG + Intergenic
1015222050 6:130814978-130815000 CAGAAAAATAAAGCAGGACAAGG - Intergenic
1015246978 6:131085753-131085775 CAGAAATAGAATTCAGAATATGG + Intergenic
1015357941 6:132301927-132301949 CTGAACCAGAATGCAGGAAAGGG + Intronic
1015488507 6:133799450-133799472 CAGAAATAGAATTCAGAATATGG - Intergenic
1016104492 6:140145616-140145638 CCAAAAAAGAATTCAGGACATGG + Intergenic
1016310104 6:142725023-142725045 CTGAGGAAGAATTGAGGAGAAGG + Intergenic
1016526534 6:145007616-145007638 CAGAGAAGGAAGTCAGGACAGGG - Intergenic
1016950922 6:149578671-149578693 CTGAAACAGCATTGAGGTCAGGG + Intronic
1017156418 6:151326026-151326048 CTGAAGAAAAACTCAGTACACGG - Intronic
1017212657 6:151874257-151874279 CTGAAAAAAAATTAAAGTCAAGG - Intronic
1017495698 6:154981322-154981344 GTGAAAAATAACTCAGGCCAAGG + Intronic
1017994397 6:159520045-159520067 CAGAAATAGAATTCAGAATATGG - Intergenic
1018041844 6:159931477-159931499 ATGAAAAAGAGTTCTGGAGATGG + Intergenic
1018157128 6:160995626-160995648 TTGATAAAGAATTCATGATAAGG + Intronic
1018544566 6:164920379-164920401 CTGTTTAAGAAGTCAGGACATGG + Intergenic
1018921228 6:168177201-168177223 CTGACAAATAATACAGGAAAAGG + Intergenic
1020072660 7:5237726-5237748 CAGAAACAGAAATCAGCACAGGG - Intergenic
1020382148 7:7558119-7558141 CAGAAACAGAATTCAGAATATGG + Intergenic
1020580663 7:9995859-9995881 ATGAGAAAGAATGCAGGAGAAGG + Intergenic
1020735887 7:11949191-11949213 CAGAAATAGAATTCAGAATATGG - Intergenic
1020896712 7:13949754-13949776 CTGAAACACATTTAAGGACAGGG + Intronic
1020993377 7:15230641-15230663 CTGAAAAAGACTTCTGCACAAGG - Intronic
1021287015 7:18793138-18793160 CTGAAAAGGCCTTCTGGACATGG - Intronic
1021435443 7:20608875-20608897 ATGAAAAAGAATTAAGAGCAGGG - Intergenic
1022338278 7:29443904-29443926 TAGAACAAGAATTCAGGAAAAGG + Intronic
1022490413 7:30813348-30813370 CTCACACAGAATTCAGGACCTGG - Intronic
1022754442 7:33270377-33270399 CAGAAATAGAATTCAGAATATGG + Intronic
1023123431 7:36932292-36932314 ATGAAAATCAATTCAGGACTGGG + Intronic
1023886246 7:44359310-44359332 CAGAAATAGAATTCAGAATATGG - Intergenic
1024034517 7:45495861-45495883 CAGAAAACTAGTTCAGGACATGG - Intergenic
1027627362 7:80563159-80563181 CAGAAGTAGAATTCAGAACATGG - Intronic
1028177313 7:87673686-87673708 GTGACATAGAATTCAGAACATGG - Intronic
1028858007 7:95613688-95613710 CAGAAATAGAATTCAGAATATGG + Intergenic
1028904374 7:96136626-96136648 CTGATAAAGAAGTCAGGGCCAGG + Intronic
1029876596 7:103760575-103760597 CTGAAAATGAATTCAGGAGGTGG + Intronic
1030167263 7:106567727-106567749 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1030374851 7:108743791-108743813 CAGAAATAGAATTCAGAATATGG - Intergenic
1030400818 7:109047727-109047749 CTGAAAAAGAATTCCAAAAAGGG + Intergenic
1031039631 7:116826063-116826085 CAGAAATAGAATTCAGAATATGG - Intronic
1031438072 7:121757390-121757412 CTGAAAATGAATGCAATACATGG + Intergenic
1031702840 7:124945977-124945999 CAGAAATAGAATTCAGAAAATGG + Intergenic
1031953379 7:127915412-127915434 CAGTAAAAGAACTCAGGAGAGGG - Intronic
1032045319 7:128601880-128601902 CTACAAAAGAAATCAGGGCATGG - Intergenic
1032440913 7:131942361-131942383 CTGAAAAAAAATTGAAGGCAGGG + Intergenic
1032775516 7:135109160-135109182 CAGAAATAGAATTCAGAATATGG - Intronic
1033612910 7:142983487-142983509 CAGAAATAGAATTCAGAATATGG - Intergenic
1033943766 7:146688423-146688445 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1034714144 7:153223631-153223653 CAGAAATAGAACTCAGAACAGGG - Intergenic
1035703707 8:1657878-1657900 CCGAGAAAGAATTTACGACATGG + Intronic
1035818038 8:2562007-2562029 CAGAAAAAGAATTCAGGACACGG + Intergenic
1035879092 8:3224404-3224426 CTGAACAAGTGTTCAGGAAATGG + Intronic
1036538447 8:9676306-9676328 CTAAAAAAGAATTCTGGGCCAGG - Intronic
1037399742 8:18483333-18483355 GTGAAAAGGTAGTCAGGACAAGG - Intergenic
1038562702 8:28594431-28594453 CTGAAAAATAATACAGCATACGG - Intergenic
1038848989 8:31255667-31255689 GTGAAAAAGAAGGCAGGAGAAGG + Intergenic
1038985453 8:32804167-32804189 CTGAATTAGGAGTCAGGACAGGG - Intergenic
1039102559 8:33957022-33957044 CAGAAATAGAATTCAGAATACGG - Intergenic
1039138917 8:34360622-34360644 CAGAAACAGAATTCAGAATATGG - Intergenic
1040801752 8:51350062-51350084 CCGAGAAAAAATTCAGGACACGG + Intronic
1040944084 8:52864010-52864032 CAGAAATAGAATTCAGAATATGG - Intergenic
1041611514 8:59855265-59855287 CAGAAAAAAAATTCAGGATATGG + Intergenic
1041693380 8:60712547-60712569 CTGCTAAATAATACAGGACATGG - Intronic
1042108515 8:65355055-65355077 CAGAAATAGAATTCAGAAAATGG - Intergenic
1042764628 8:72307946-72307968 CAGAAACAGAATTCAGAATATGG - Intergenic
1042883136 8:73516624-73516646 CTAAAAAGGAATTTTGGACATGG + Intronic
1043281026 8:78466250-78466272 CAGAAATAGAATTCAGAATATGG + Intergenic
1043287841 8:78557529-78557551 GTGTAAAAGAACTCAGAACATGG + Intronic
1043528224 8:81119835-81119857 CTGACAAAAAATTCAGGACATGG + Intergenic
1043727385 8:83628468-83628490 CAGAAATAGAATTCAGAATATGG - Intergenic
1043727703 8:83630688-83630710 CAGAAATAGAATTCAGAATATGG + Intergenic
1043738484 8:83776265-83776287 CAGAAAAAGAATTCAGAATATGG + Intergenic
1043935965 8:86142676-86142698 CTAAAAAAGAATTCCAGAAAAGG - Intronic
1044034465 8:87283155-87283177 TTTAAAAAGAATTCATTACATGG - Intronic
1044136440 8:88591947-88591969 TCGAGAAAGAATTCAGGACAGGG + Intergenic
1044162315 8:88935180-88935202 CAGAAATAGAATTCAGAAAATGG - Intergenic
1044642818 8:94402722-94402744 CTGAAAAACAGTTCTGAACATGG - Intronic
1045458747 8:102408572-102408594 TTGAGGAATAATTCAGGACAAGG + Intronic
1046255427 8:111690818-111690840 CTGAAAAAAAATTGAGCAGATGG - Intergenic
1046550550 8:115710261-115710283 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1046766315 8:118074044-118074066 CGGACAAAGAATTAAGGAAAAGG + Intronic
1046895281 8:119464674-119464696 CAGAAATAGAATTCAGAATATGG + Intergenic
1047029988 8:120866153-120866175 CTGGAACAGAATCTAGGACATGG + Intergenic
1047159457 8:122361301-122361323 CAGAAATAGAATTCAGAATATGG - Intergenic
1047354673 8:124109060-124109082 CTGAGAAAAAATTCAGGATATGG + Intronic
1047902961 8:129443736-129443758 CTCAAGAAGAATACAGGAAAAGG - Intergenic
1047908406 8:129498500-129498522 ATGAAAAACAAATGAGGACAAGG + Intergenic
1047924261 8:129667323-129667345 ATCAAAAAGAATTCAGGGCCAGG + Intergenic
1048742546 8:137578064-137578086 CTGAAAACAAATTTTGGACATGG + Intergenic
1049128268 8:140811579-140811601 CAGAAATAGAATTCAGAACATGG + Intronic
1049172069 8:141167614-141167636 CTTAAAGACAACTCAGGACAGGG - Intronic
1049189102 8:141276741-141276763 CTGAAAGAGACCACAGGACATGG + Intronic
1049370786 8:142264929-142264951 CAGAAGAAAAATGCAGGACAGGG - Intronic
1049506905 8:143007562-143007584 CAGAAATAGAATTCAGAATATGG - Intergenic
1049601295 8:143508919-143508941 CTGGAAAAGAATTTGGGAAATGG - Intronic
1049859009 8:144884545-144884567 TTTGAAAAGAATTCAGGACCGGG - Intronic
1050694778 9:8266552-8266574 CTGGAAAAGCTTTCAGCACAAGG + Intergenic
1050811543 9:9754163-9754185 GTGAAACAGAATTAATGACAAGG + Intronic
1050856227 9:10360547-10360569 GTGAGAAAGAAGTCACGACATGG + Intronic
1051313795 9:15807191-15807213 CAGAAATAGAATTCAGAATATGG - Intronic
1051832585 9:21296680-21296702 CAGAAATAGAATTCAGAATATGG + Intergenic
1051946892 9:22580421-22580443 CAGACAAAGAATTAAGAACAGGG - Intergenic
1052028207 9:23598476-23598498 TTCAAAAAGATGTCAGGACATGG + Intergenic
1052173461 9:25428724-25428746 CAGAAATAGAATTCAGAATATGG + Intergenic
1052290811 9:26838004-26838026 GAGAAAGAGAATTCAGGAAATGG + Intergenic
1052301234 9:26954975-26954997 ATGAAAAAGAAATGGGGACAGGG + Intronic
1052311487 9:27073864-27073886 CAGAAATAGAATTCAGAATATGG - Intergenic
1052425901 9:28304123-28304145 CAGAAAAAGAATTCATCAGAAGG - Intronic
1052703137 9:31961321-31961343 CAGAAATAGAATTCAGAATATGG + Intergenic
1053383425 9:37667712-37667734 TTGAAAAAGAAATAAGCACAGGG - Intronic
1054742822 9:68826017-68826039 CTGAGAATGGATTCAGGAAATGG - Intronic
1054855368 9:69893405-69893427 CAGAAAGAGAATCCAGAACAGGG + Intronic
1055168387 9:73224261-73224283 CAGAAATAGAATTCAGAATATGG + Intergenic
1056142216 9:83693706-83693728 CTCAAAAACAATTGAGAACAGGG - Intronic
1056618616 9:88191151-88191173 CTGAGAAAGCTTTCAGGCCATGG - Intergenic
1056843818 9:90019993-90020015 GAAAAAAAGAATTCAGGACTTGG + Intergenic
1056974978 9:91244708-91244730 CTGGAACAGGATACAGGACAGGG - Intronic
1057392410 9:94650808-94650830 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1057638427 9:96794397-96794419 CAGAAATAGAATTCAGAATATGG - Intergenic
1057715563 9:97492690-97492712 TAGAAAAGGAACTCAGGACATGG - Intronic
1058136298 9:101311084-101311106 CTGATAAAAAATACAGGAAAAGG - Intronic
1058203488 9:102072892-102072914 TTGAAAAGGAATTCAGGCCAAGG - Intergenic
1058315127 9:103555158-103555180 CAGAAATAGAATTCAGAATATGG + Intergenic
1059034131 9:110735035-110735057 CAGAAAAATAAATCAGGAAAAGG + Intronic
1059868767 9:118546904-118546926 CAGAAATAGAATTCAGAATATGG + Intergenic
1060336729 9:122730711-122730733 CAGAAATAGAATTCAGAATATGG + Intergenic
1060673029 9:125486919-125486941 CTGAAGAAAAATGCAGGATACGG - Intronic
1061039798 9:128133719-128133741 CATAAAAAGAATTCTGGAGATGG - Intergenic
1185515638 X:697068-697090 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1185552163 X:991801-991823 CTGAGAAATAATTGAGGACAGGG - Intergenic
1187607684 X:20904761-20904783 CAGAAATAGAATTCAGCATATGG - Intergenic
1187641190 X:21292115-21292137 CAGAAATAGAATTCAGAATATGG - Intergenic
1188289622 X:28371473-28371495 CAGAAATAGAATTCAGAATATGG - Intergenic
1188327425 X:28822760-28822782 CAGAAGAAGAAATAAGGACAAGG + Intronic
1188555132 X:31402648-31402670 CTGAAAAAGAATTGAACAGAAGG + Intronic
1188833973 X:34933723-34933745 CAGAAACAGAATTCAGAATATGG + Intergenic
1188835516 X:34949232-34949254 CAGAAAAAGAATTCAGAATATGG + Intergenic
1188963500 X:36522811-36522833 CAGAAATAGAATTCAGAATATGG - Intergenic
1189532460 X:41901039-41901061 CTGATAAAGAATTCAAGGCCAGG - Intronic
1190960143 X:55238566-55238588 CAGAAAAACAATTTAGGAAAGGG - Intronic
1191072384 X:56414837-56414859 CTGAAAAGTAATTCAGGAGCAGG - Intergenic
1191217637 X:57950497-57950519 CAGAAATAGAATTCAGAATATGG - Intergenic
1191774197 X:64794446-64794468 GTGACAAAGAATTCAAAACATGG + Intergenic
1191933715 X:66403976-66403998 CAGAAAAGGAATTCAGAATATGG - Intergenic
1192060678 X:67822504-67822526 ACGAAAAAGAGTCCAGGACAAGG + Intergenic
1192067547 X:67902818-67902840 CAGAAATAGAATTCAGAATATGG - Intergenic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1192305821 X:69958479-69958501 CTGAGAAAGAGCTCAGAACAAGG + Intronic
1192390422 X:70720711-70720733 ATGAAAAATAATTCAAGAAAAGG - Intronic
1192840753 X:74853095-74853117 TTGAGAAAGAATTCAAGACATGG + Intronic
1193089979 X:77483258-77483280 CAGAAATAGAATTCAGAATATGG + Intergenic
1193162438 X:78242253-78242275 CAGAAATAGAATTCAGAATATGG + Intergenic
1193250925 X:79289749-79289771 CAGAAATAGAATTCAGAATATGG + Intergenic
1193482775 X:82047556-82047578 CAGAAATAGAATTCAGAATATGG + Intergenic
1193536797 X:82727085-82727107 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1193537622 X:82732837-82732859 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1193580897 X:83261075-83261097 CAGAAACAGAATTCAGAATATGG + Intergenic
1193607366 X:83584600-83584622 CAGAAATAGAATTCAGAATATGG + Intergenic
1193711975 X:84892099-84892121 CAGAAGAAGAATTCAGAATATGG - Intergenic
1193736284 X:85160349-85160371 CAGAAATAGAATTCAGAATATGG + Intergenic
1193752621 X:85365230-85365252 CAGAAATAGAATTCAGAATATGG - Intronic
1193854355 X:86580402-86580424 CAGAAATAGAATTCAGAATATGG + Intronic
1193859054 X:86641118-86641140 CAGAAATAGAATTCAGAATATGG + Intronic
1193951467 X:87805787-87805809 CTTAAAAAGAAAACAGGAAAAGG - Intergenic
1194055189 X:89123313-89123335 TTGAAAAAGAGGACAGGACAAGG - Intergenic
1194632083 X:96297055-96297077 CAGAAATAGAATTCAGAATATGG + Intergenic
1194664006 X:96656852-96656874 CAGAAATAGAATTCAGAATATGG + Intergenic
1194838535 X:98712253-98712275 CAGAAACAGAATTCAGTATATGG - Intergenic
1194874797 X:99173601-99173623 CAGAAACAGAATTCAGAATATGG + Intergenic
1194982115 X:100451178-100451200 CAGAAATAGAATTCAGAATATGG + Intergenic
1195002045 X:100651270-100651292 AAGAAAAAGAAGTCAGGAAAAGG + Intronic
1195473382 X:105258902-105258924 CAGAAATAGAATTCAGAATATGG - Intronic
1195567723 X:106362558-106362580 CAGAAATAGAATTCAGAATATGG - Intergenic
1195879388 X:109576499-109576521 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1196222013 X:113122490-113122512 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1196287421 X:113898543-113898565 CTGAGAAAAAATTCGGGACATGG + Intergenic
1197092954 X:122559974-122559996 CAGAAATAGAATTCAGAATATGG + Intergenic
1197094977 X:122583185-122583207 CTGAAACAGAAGTCAGAGCAGGG + Intergenic
1197842817 X:130768181-130768203 ATGAAAAAGAAGACAGGATAGGG + Intronic
1198580069 X:138053741-138053763 CTGGCAAAGATTTCATGACAAGG + Intergenic
1198705538 X:139444242-139444264 CAGAAGTAGAATTCAGGATATGG + Intergenic
1198995801 X:142572272-142572294 CAGAAATAGAATTCAGAATATGG + Intergenic
1199192349 X:144984978-144985000 CAGAAAAAGAAAACAGGAAAAGG + Intergenic
1199707035 X:150436696-150436718 CAGAAATAGAATTCAGAATATGG - Intronic
1199863966 X:151826474-151826496 CTGAAAAGGAATTCAGACAAAGG - Intergenic
1199950687 X:152703555-152703577 CTCTAAAGGAATTCAGAACAGGG - Intergenic
1199958995 X:152764906-152764928 CTCTAAAGGAATTCAGAACAGGG + Intergenic
1201240278 Y:11952216-11952238 CTGAAAAAGGAGTCAGCACAGGG + Intergenic
1201294239 Y:12450122-12450144 CTGAGAAAGAATTCAGGACACGG - Intergenic
1201484245 Y:14475353-14475375 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1202054559 Y:20815872-20815894 CAGAAACAGAATTCAGAATATGG + Intergenic
1202281654 Y:23197234-23197256 CTGAAAAAGTATTCATCATAAGG + Intronic
1202284237 Y:23221285-23221307 CTGAAAAAGTATTCATCATAAGG - Intronic
1202433326 Y:24811619-24811641 CTGAAAAAGTATTCATCATAAGG + Intronic
1202435913 Y:24835671-24835693 CTGAAAAAGTATTCATCATAAGG - Intronic