ID: 1166490907

View in Genome Browser
Species Human (GRCh38)
Location 19:43259521-43259543
Sequence CAGAGAAATCACATATAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 4, 2: 4, 3: 15, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166490907_1166490912 -5 Left 1166490907 19:43259521-43259543 CCCCCCTATATGTGATTTCTCTG 0: 1
1: 4
2: 4
3: 15
4: 164
Right 1166490912 19:43259539-43259561 CTCTGCAGCTTCCATTTCTAAGG 0: 1
1: 6
2: 6
3: 71
4: 834
1166490907_1166490914 20 Left 1166490907 19:43259521-43259543 CCCCCCTATATGTGATTTCTCTG 0: 1
1: 4
2: 4
3: 15
4: 164
Right 1166490914 19:43259564-43259586 GTTCTAGAGATGAGTAATAATGG 0: 1
1: 7
2: 4
3: 16
4: 206
1166490907_1166490915 21 Left 1166490907 19:43259521-43259543 CCCCCCTATATGTGATTTCTCTG 0: 1
1: 4
2: 4
3: 15
4: 164
Right 1166490915 19:43259565-43259587 TTCTAGAGATGAGTAATAATGGG 0: 8
1: 3
2: 1
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166490907 Original CRISPR CAGAGAAATCACATATAGGG GGG (reversed) Intronic
902961062 1:19963054-19963076 CAGAGGAAACAGATATCGGGGGG - Intergenic
903063894 1:20687718-20687740 CAGAGAAATCTCAGATTTGGAGG + Exonic
905316812 1:37087495-37087517 CAGAGAAGTCAAATACAGGAGGG - Intergenic
907459384 1:54596274-54596296 CAGAGAGACCACAGACAGGGTGG - Intronic
911244056 1:95497294-95497316 CTGAGCAATCAAATACAGGGAGG + Intergenic
911436079 1:97859567-97859589 AAGAGAACTTACATATAGGGTGG - Intronic
912046243 1:105462082-105462104 CAGAGCACTCACATATAAGTAGG + Intergenic
912092010 1:106089948-106089970 CAGAAATATCACAAATATGGAGG - Intergenic
912783396 1:112574695-112574717 CAGATAAAAAACATAAAGGGAGG + Intronic
914459776 1:147872645-147872667 GAGGGAACTTACATATAGGGTGG - Intergenic
916273659 1:162970392-162970414 CACAGAAATCACATAAACAGTGG - Intergenic
916880534 1:169016043-169016065 CAGAGAAATCTAATAGAGTGGGG - Intergenic
918797066 1:188914047-188914069 CAGAGTAATGAAATATAGAGTGG - Intergenic
920204526 1:204282011-204282033 GAGAGAAATCACAAATCAGGGGG + Intronic
921479682 1:215649638-215649660 CAGATAACTTACATACAGGGAGG - Intronic
1063716290 10:8530229-8530251 CAGAGAAGTCACAGATAGAAGGG + Intergenic
1068457689 10:57279739-57279761 CAATGAGAACACATATAGGGAGG - Intergenic
1068740966 10:60470143-60470165 CAGAAAAATCACAGAAATGGTGG + Intronic
1068913601 10:62405081-62405103 CACTGAAATCACATTCAGGGAGG - Intronic
1069140792 10:64822430-64822452 AAGTGAAATCACAAATAAGGGGG - Intergenic
1069216336 10:65825935-65825957 TAAAGAAAGCACATATAGGCTGG + Intergenic
1070712741 10:78694924-78694946 CCAAGAAATCAGATATAGGCTGG + Intergenic
1071374530 10:84989032-84989054 CAGAGAAATGACATTTTCGGAGG + Intergenic
1071855553 10:89620787-89620809 CAGTGACATCACATATTGGCAGG - Intronic
1073189316 10:101639544-101639566 CTCAGGAATCACATATATGGAGG - Intronic
1076369692 10:129943981-129944003 CTCAGAAATCACGCATAGGGTGG - Intronic
1078447710 11:11416974-11416996 CAGAGGAGTCACATAGAGGAAGG - Intronic
1080935990 11:36864077-36864099 CAGAGGAATATCATATAAGGAGG - Intergenic
1082965675 11:58964185-58964207 CAGAGAAATTAAATATATTGGGG + Intronic
1083402556 11:62434092-62434114 CACAGAAACCACACAGAGGGAGG - Intronic
1085656358 11:78318740-78318762 CAGGGCAATCACTTAAAGGGAGG + Intronic
1086776631 11:90843256-90843278 CAAAGAAATCACATCTGAGGTGG - Intergenic
1087337009 11:96856646-96856668 CACAGAAAACAGATATAGGCAGG + Intergenic
1087847588 11:102990928-102990950 CAGAGAAATCACCTGTTTGGTGG - Intergenic
1088768380 11:113008277-113008299 CAGAATAATCACAGATAGGGGGG + Intronic
1090176964 11:124658749-124658771 CAGAGAAGTCACATGGAAGGAGG + Intronic
1091876767 12:3941175-3941197 CAGAGAAACCACTTTTAGAGTGG - Intergenic
1098756932 12:74375807-74375829 TAGAGAACTCACATTTATGGAGG + Intergenic
1099272322 12:80526128-80526150 CAGAGAAAGCACAGATAGGATGG - Intronic
1101170487 12:102087521-102087543 GAGAGAAATCACATTTAGCAGGG + Intronic
1101864248 12:108508330-108508352 CAGAGAAATCAGAGAAGGGGAGG + Intergenic
1104106238 12:125662295-125662317 CAGAGACATTAAATATACGGTGG - Exonic
1104265331 12:127226943-127226965 TATAGAAATCCCATAGAGGGTGG + Intergenic
1105925790 13:25006695-25006717 CAAAGAAATGACAAATAGGCCGG + Intergenic
1106544116 13:30715571-30715593 CAGGGACATCACTTATGGGGTGG + Intronic
1107096957 13:36547496-36547518 CAGAGAAAGGACCTATAGGTTGG - Intergenic
1112081074 13:95971249-95971271 CAGAGACATTATATATAGAGAGG - Intronic
1112298939 13:98213091-98213113 CACAGGAATCACATATAGGGAGG - Intronic
1114730523 14:24988117-24988139 TAGAGAAATCACATAATGCGGGG + Intronic
1115103808 14:29735725-29735747 GAGAGAAATGAAATATAGAGGGG - Intronic
1115574414 14:34696553-34696575 CAGAGATGTCACATATAATGGGG - Intergenic
1116942803 14:50807895-50807917 TAGAGAAATCACATATACTTTGG - Intronic
1117742372 14:58832143-58832165 CAGAGAGATGACACATGGGGAGG - Intergenic
1118453766 14:65927292-65927314 CAGAGAAATGAAATCTAGGATGG - Intergenic
1120425983 14:84349086-84349108 CAGTGAAATCTCAGATAAGGAGG + Intergenic
1124819123 15:33026225-33026247 CAGAGAAATTGAATAAAGGGAGG + Intronic
1125639150 15:41215110-41215132 CAGAGAAAACATCTCTAGGGAGG - Intronic
1127075426 15:55320777-55320799 AAGAGAAACCACAGATAAGGGGG + Intronic
1127765800 15:62184906-62184928 CAGAGTAATCAAATGTTGGGAGG - Intergenic
1133091194 16:3405029-3405051 CAAAGATATAAGATATAGGGTGG - Intronic
1137699332 16:50485016-50485038 CACAGAAATCAGCTTTAGGGTGG + Intergenic
1140238065 16:73176427-73176449 CAGTGTACTCACATAAAGGGAGG - Intergenic
1143771104 17:9169506-9169528 CAGAGAACTCACATCCAGGGAGG - Intronic
1143808951 17:9454777-9454799 AAGCGAAACCACATATAAGGGGG + Intronic
1146772653 17:35582968-35582990 CAAAGAAAGCACATAGATGGAGG + Intronic
1148964507 17:51423328-51423350 CAAAGAGCTCACATATAGGAGGG - Intergenic
1150174538 17:63037436-63037458 AAGAGAAATCACAGATAAGGGGG + Intronic
1150420657 17:65032292-65032314 GAGAGAAAGGACAGATAGGGTGG - Intronic
1151449074 17:74186391-74186413 TAAGGAAATCACATATATGGGGG + Intergenic
1152644978 17:81464726-81464748 AACAGAAATCAGATATAGGTTGG - Exonic
1153239547 18:3018025-3018047 CATATAAAACACATATAGGCCGG + Intergenic
1155837823 18:30609136-30609158 CAAAGAACTGACATATAGTGTGG - Intergenic
1157177377 18:45463946-45463968 CAGAAAAATTAGAAATAGGGTGG - Intronic
1157485157 18:48081578-48081600 TAAAGAAATCACTTAGAGGGAGG - Intronic
1161921599 19:7270300-7270322 GAGAGAAATGAAATATAGTGTGG - Intronic
1164787009 19:30941510-30941532 CAGAGAAATCACTAGGAGGGAGG - Intergenic
1165555396 19:36626922-36626944 ATGAGAAAACACATATAGAGGGG + Exonic
1166406137 19:42523168-42523190 CAGAGAAAACACACCTAGTGGGG - Intronic
1166419741 19:42627112-42627134 CAGAGAAAACACACCTAGGAGGG - Intronic
1166431350 19:42730442-42730464 CAGAGAAATCACATCTATGGGGG - Intronic
1166451793 19:42908236-42908258 CAGAGAAATCACATCTAGGGGGG - Intronic
1166454238 19:42927102-42927124 CAGAGAAATCACATCTAGGGGGG - Intronic
1166464032 19:43016431-43016453 CAGAGAAATCACATCTAGGGGGG - Intronic
1166470186 19:43073014-43073036 CAGAGAAATCACATCTAGGGGGG - Intronic
1166483790 19:43195659-43195681 CAGAGAAATCTCATCTAGGGGGG - Intronic
1166490907 19:43259521-43259543 CAGAGAAATCACATATAGGGGGG - Intronic
929727019 2:44440283-44440305 CAGGGAAATCACACAAAGAGTGG + Intronic
929879659 2:45824766-45824788 CAGAAAACTCACATAAAGGGAGG - Intronic
931578540 2:63746970-63746992 GAGAGACATCACATGTAGGCAGG - Intronic
932146668 2:69326027-69326049 CACAAAAATCACATATTGAGTGG + Exonic
935848894 2:107197660-107197682 CAGAGAGGTCACACACAGGGAGG - Intergenic
936686726 2:114836405-114836427 GGGAGAAATCACATTTCGGGAGG + Intronic
937792580 2:125978165-125978187 CATAAAAATCACATAGAGAGTGG + Intergenic
940475747 2:154160092-154160114 CAGATAAATCAAATAAAGGCTGG - Intronic
944273627 2:197810109-197810131 CAGCCAAATCACATCTCGGGAGG - Intronic
946157436 2:217816252-217816274 CAAAGAAAACACAAAAAGGGAGG + Intronic
1169576293 20:6965641-6965663 CAAAGAGATCAGATATAGAGAGG - Intergenic
1169783598 20:9334773-9334795 CAAAGAAGTCAAATATAGGAGGG + Intronic
1171027366 20:21643048-21643070 CAGAGAAATGAAATACAGGCAGG + Intergenic
1171083305 20:22210878-22210900 CAGAGACATCAGGTACAGGGTGG - Intergenic
1171112474 20:22496657-22496679 CAGAGAAAACTCATCTATGGTGG + Intergenic
1181502421 22:23324401-23324423 CAGAGAAATCACATCTGAGGAGG - Intergenic
949679206 3:6493372-6493394 TAGAAAAATCACATATAAGGTGG + Intergenic
950356469 3:12414097-12414119 CAGATAAATCACTTACATGGAGG + Intronic
950558880 3:13710666-13710688 CAGAGAACCCCCATATAAGGGGG + Intergenic
951812062 3:26711725-26711747 CAGAGGGATACCATATAGGGAGG + Intergenic
952471904 3:33663696-33663718 GAAAGAAGTCACATATAGGTAGG + Intronic
953862701 3:46558625-46558647 CAGGGAGATCACAGAGAGGGAGG - Intronic
954830372 3:53416373-53416395 TAGAGAAATCTCAAAGAGGGTGG + Intergenic
955713874 3:61808439-61808461 CAGATAAATCATATGTAGGTGGG + Intronic
958555311 3:95667212-95667234 AAGAGAAACCACATCTGGGGCGG - Intergenic
958985352 3:100774345-100774367 CAGAGTAAACACATGTGGGGTGG + Intronic
959551279 3:107661669-107661691 CAGAGAAATCACAGACAGGGAGG - Intronic
961106822 3:124249679-124249701 CAGGAAGCTCACATATAGGGTGG - Intronic
963272683 3:143301379-143301401 CAGAGAAATCAGCAAGAGGGCGG + Intronic
963762267 3:149295716-149295738 AAGAGAAAACACATAATGGGAGG - Intergenic
966052029 3:175630232-175630254 CAGAGAAATGAAATATATAGAGG + Intronic
966480730 3:180405502-180405524 CACTGTAATCTCATATAGGGAGG + Intergenic
970211469 4:13714532-13714554 CAAAGAAAACTCATATAGGGAGG + Intergenic
970288855 4:14549933-14549955 CAGAGAAATGAAGGATAGGGAGG - Intergenic
972696729 4:41453860-41453882 CAGAGAAATGAGATAAATGGAGG - Intronic
973203531 4:47532734-47532756 CAGTGTAGTCACAAATAGGGAGG - Intronic
973919253 4:55668215-55668237 CAGAGAAATTACATATCAGCAGG - Intergenic
976732342 4:88276722-88276744 CAGGGTAATCACATCTAGCGAGG - Intronic
977650773 4:99466667-99466689 CAGAAAAACCACATTTAGGCTGG + Intergenic
978697672 4:111602090-111602112 CAGAAAAATTACATATAGGTTGG + Intergenic
978905901 4:114005108-114005130 CAGAGATATAAGATATAAGGTGG - Intergenic
978973558 4:114840410-114840432 CAAAGAAATCAGATCTAGTGTGG + Intronic
979704691 4:123708382-123708404 AAGCGAAATCACACATAAGGGGG + Intergenic
980971233 4:139569033-139569055 CACAAATATCAGATATAGGGGGG - Intronic
982637773 4:157918682-157918704 GAGAGAAATCACAGAAAGTGGGG - Intergenic
986441775 5:7789403-7789425 CAGGGAAATCAGCTATATGGAGG - Intronic
986548760 5:8929101-8929123 CAGAAGAATCAAATCTAGGGTGG - Intergenic
987138970 5:14926404-14926426 CAGAAAAATGACATATTTGGAGG - Intergenic
988897573 5:35694260-35694282 GAGAGAAAACACACATAGGGAGG - Intronic
989204868 5:38800423-38800445 CAGAGACATCACATAGTGGGTGG - Intergenic
993044788 5:82854778-82854800 CAGATAAAGGACATGTAGGGTGG + Intergenic
993839394 5:92858363-92858385 CAGATAAATCAGAACTAGGGAGG + Intergenic
994346066 5:98687921-98687943 CAGACAAATCACAAGTAAGGAGG + Intergenic
995868023 5:116713315-116713337 CTGAGAAATCATATACAAGGAGG - Intergenic
997211946 5:132082023-132082045 CAGAGAGACCACACATAAGGAGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1000654739 5:163862849-163862871 CAGAGAAAGCACATCTAGTTCGG + Intergenic
1001944734 5:175769827-175769849 CAGATAAATCGCATATATGCTGG - Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1005368129 6:25100233-25100255 CAGAGAAGTCAGATAGATGGTGG + Intergenic
1007152127 6:39704218-39704240 CTGAGCAATCACATATACTGGGG + Intronic
1008680834 6:53870228-53870250 CCGAGAAATCACATGAATGGTGG - Intronic
1008850839 6:56019292-56019314 CAAAAATATCATATATAGGGTGG + Intergenic
1010036527 6:71331564-71331586 CAGAGAAGCCACATAAAGTGTGG - Intergenic
1010115968 6:72311712-72311734 AATAAAAATCACATTTAGGGAGG + Intronic
1012518937 6:100097065-100097087 CAGAGAAATTCTACATAGGGAGG - Intergenic
1013624170 6:111920441-111920463 CAGAGAAAGGACATACAGGATGG - Intergenic
1014291260 6:119561333-119561355 AAGTGAAATCACAGATAAGGAGG - Intergenic
1015734992 6:136389547-136389569 GAGGGAAATCAAATATAGGCAGG + Intronic
1016591245 6:145746081-145746103 CAGAGAAAGAAAATATGGGGTGG - Intergenic
1016735466 6:147474007-147474029 CAGACAAACCACAGATTGGGAGG + Intergenic
1018030873 6:159840505-159840527 CAGAGAATACACTTCTAGGGGGG - Intergenic
1018641249 6:165906659-165906681 CAGAGAATGCACACATGGGGAGG + Intronic
1021485401 7:21162283-21162305 CACAGAAACCACAAATATGGAGG + Intergenic
1023855651 7:44182000-44182022 CCAAGGAATCACAGATAGGGTGG + Intronic
1031236105 7:119179800-119179822 AAGAGAAATCACATAGAGAAAGG - Intergenic
1032507298 7:132445268-132445290 TCGAGAAATCACATAGAAGGAGG - Intronic
1032881212 7:136092508-136092530 AAGAGAGAGCACATGTAGGGAGG + Intergenic
1035330552 7:158094284-158094306 CAGAAAAAACACAGATGGGGTGG - Intronic
1036093836 8:5701263-5701285 CAAAGAAATCAGATAAAGAGAGG - Intergenic
1036294653 8:7526255-7526277 CAGAGAGATCACAGTGAGGGAGG - Intergenic
1036327909 8:7794736-7794758 CAGAGAGATCACAGTGAGGGAGG + Intergenic
1038490232 8:27965434-27965456 CAGAGCAGGCACATAGAGGGAGG - Intronic
1039166452 8:34686759-34686781 AAAAGCAATCACAAATAGGGTGG + Intergenic
1044762355 8:95534816-95534838 TAGAGAAGTCACATTTTGGGGGG + Intergenic
1048629823 8:136230299-136230321 CAGAGAAATCTCCTTTAGGTGGG + Intergenic
1050080785 9:1913689-1913711 CAGGGAAATCAGATAAAAGGTGG - Intergenic
1051389090 9:16544095-16544117 CAGAAAATTGACATAAAGGGGGG - Intronic
1054733158 9:68722008-68722030 CTGAGAAATCACTTCTAGGGAGG - Intronic
1057003154 9:91531523-91531545 GAGAGAAAGCATATATAGGGTGG + Intergenic
1057237714 9:93378443-93378465 CAAAGCAACCACATATATGGGGG - Intergenic
1058858352 9:109088975-109088997 CAGAAGAACCACATATAGGCCGG + Intronic
1061271289 9:129544860-129544882 CAGAGAAACCCCATATGCGGTGG + Intergenic
1187208442 X:17205350-17205372 CAGAGAGATGAAATATAGTGGGG - Intergenic
1188578784 X:31685311-31685333 CAGGACATTCACATATAGGGTGG + Intronic
1189993772 X:46619658-46619680 CAGAGCAATTACATTTGGGGAGG + Intronic
1190851704 X:54250666-54250688 CAGAAAAATAAGATATAGGAAGG + Intronic
1192990835 X:76454420-76454442 CAGAGAATTCATAGGTAGGGTGG - Intergenic
1194966241 X:100291694-100291716 CAGAGAAAACACATTTAAAGGGG + Exonic
1197331435 X:125158020-125158042 CAGAGACATCAAATTTATGGCGG + Intergenic
1200312636 X:155094504-155094526 CCAAGAAATCACATAAAGGGAGG + Intronic
1200380152 X:155828533-155828555 AAGAGAACACACATAGAGGGTGG - Intergenic