ID: 1166492373

View in Genome Browser
Species Human (GRCh38)
Location 19:43270377-43270399
Sequence GCCATGTCCCGCGGGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 4, 1: 4, 2: 1, 3: 5, 4: 90}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166492373_1166492382 5 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492382 19:43270405-43270427 GAGACGCAGGAGGGGGAGCCTGG 0: 5
1: 4
2: 7
3: 73
4: 868
1166492373_1166492383 6 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492383 19:43270406-43270428 AGACGCAGGAGGGGGAGCCTGGG 0: 5
1: 4
2: 1
3: 45
4: 369
1166492373_1166492386 18 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492386 19:43270418-43270440 GGGAGCCTGGGACAGAGCAGGGG 0: 7
1: 3
2: 8
3: 89
4: 812
1166492373_1166492380 -3 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492380 19:43270397-43270419 GGCTCATTGAGACGCAGGAGGGG 0: 2
1: 3
2: 6
3: 3
4: 124
1166492373_1166492384 16 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492384 19:43270416-43270438 GGGGGAGCCTGGGACAGAGCAGG 0: 6
1: 4
2: 11
3: 83
4: 697
1166492373_1166492385 17 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492385 19:43270417-43270439 GGGGAGCCTGGGACAGAGCAGGG 0: 6
1: 4
2: 6
3: 84
4: 719
1166492373_1166492378 -5 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492378 19:43270395-43270417 ATGGCTCATTGAGACGCAGGAGG 0: 2
1: 3
2: 6
3: 4
4: 62
1166492373_1166492377 -8 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492377 19:43270392-43270414 GACATGGCTCATTGAGACGCAGG 0: 2
1: 4
2: 4
3: 7
4: 50
1166492373_1166492381 -2 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492381 19:43270398-43270420 GCTCATTGAGACGCAGGAGGGGG 0: 2
1: 3
2: 7
3: 15
4: 165
1166492373_1166492379 -4 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492379 19:43270396-43270418 TGGCTCATTGAGACGCAGGAGGG 0: 2
1: 3
2: 5
3: 10
4: 106
1166492373_1166492388 29 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC 0: 4
1: 4
2: 1
3: 5
4: 90
Right 1166492388 19:43270429-43270451 ACAGAGCAGGGGTTCAGAGCTGG 0: 9
1: 1
2: 2
3: 55
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166492373 Original CRISPR GCCATGTCCCGCGGGGTTCC TGG (reversed) Intergenic
900189828 1:1348680-1348702 GCGATGGCAGGCGGGGTTCCCGG - Intronic
905449509 1:38047318-38047340 GCCAGGACCCGCGGGAATCCTGG - Intergenic
907053605 1:51345411-51345433 GCTATGTCCCGCAGGGACCCTGG - Intergenic
914461885 1:147892370-147892392 GCCATGGCTCACGGAGTTCCAGG + Intergenic
1071520861 10:86330800-86330822 CCCATGTGCAGCGGGCTTCCTGG - Intronic
1076526429 10:131115265-131115287 GCCCTGCCCCGAGGGGCTCCAGG - Intronic
1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG + Intergenic
1077335527 11:2002117-2002139 GCCAGGTGCCGCAGGGTTCTCGG - Intergenic
1089329600 11:117680349-117680371 GCCATGTCCCTCAGGGCTACAGG - Intronic
1202818511 11_KI270721v1_random:57299-57321 GCCAGGTGCCGCAGGGTTCTCGG - Intergenic
1092123956 12:6063054-6063076 GTCCTGTCCTGCTGGGTTCCAGG - Exonic
1093057244 12:14567677-14567699 GCGATGACCCGCGGCGGTCCGGG - Exonic
1096622652 12:52874235-52874257 GCCGCGCCCCGCGGGCTTCCAGG - Intergenic
1096777821 12:53974645-53974667 GCGCTGCCCCGCGGGCTTCCCGG + Intronic
1101037300 12:100717700-100717722 CCGATGTTCCGCGGGGTTTCGGG + Intronic
1103363231 12:120366369-120366391 GCCAAGTCCCACTGGGCTCCAGG + Intronic
1104582011 12:130017700-130017722 GCCACGCCCCGCGGTCTTCCTGG - Intergenic
1122719873 14:103716030-103716052 GCCCGGCCCCGCGGGCTTCCAGG + Intronic
1202851433 14_GL000225v1_random:22971-22993 TCCAGTTCCCGCGGGATTCCTGG + Intergenic
1202863556 14_GL000225v1_random:100541-100563 TCCAGTTCCCGCGGGATTCCTGG - Intergenic
1202865699 14_GL000225v1_random:115370-115392 TCCAGTTCCCGCGGGATTCCTGG - Intergenic
1123500692 15:20878359-20878381 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1123557937 15:21452052-21452074 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1123594166 15:21889333-21889355 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1129162216 15:73753158-73753180 GCCCTGCCCCGCCGGGCTCCCGG + Intergenic
1131258115 15:90874527-90874549 GCCATGTCCTGAGGGGGTGCGGG - Intronic
1202966288 15_KI270727v1_random:179224-179246 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1133008281 16:2896642-2896664 GTCATGTCCCTGGGGGTGCCCGG + Exonic
1139433875 16:66925340-66925362 GCCAGGTCCGGAGGGGTCCCGGG - Intronic
1142305091 16:89280303-89280325 GCCACGTCCAGCGGGGCTTCCGG + Exonic
1143483878 17:7242335-7242357 GCCCTGTCCAGCCCGGTTCCCGG - Exonic
1144772998 17:17770060-17770082 GCCTTGTACCGCCTGGTTCCAGG - Intronic
1151725352 17:75880694-75880716 TGCATGTCCCCCGGTGTTCCTGG + Intronic
1152562395 17:81085118-81085140 GCCATGACACGCTGGGCTCCAGG + Intronic
1152927032 17:83092120-83092142 GCCAGGCCCCGCAGGGTTCAGGG + Intronic
1154299649 18:13182036-13182058 GCCCTGTCCCGCTCGGTCCCAGG - Intergenic
1157338181 18:46756552-46756574 GCAATGACTCGCGGGGTTCCGGG + Exonic
1162847019 19:13400814-13400836 GCCATGGCCCCCTGGGTTCTAGG - Intronic
1164551109 19:29213048-29213070 GCCACGTCCCGCGGGGTGGCGGG - Exonic
1166432822 19:42741316-42741338 GCCATGTCCCCCGGGGTTCCTGG - Intronic
1166435930 19:42766543-42766565 GCCATCTCCCTTGGGGTTCCTGG - Intronic
1166445806 19:42856571-42856593 GCCATGTCCCACGGGGTTCCTGG - Intronic
1166448791 19:42880531-42880553 GCCATGTCCCGCAGGGTTCCTGG - Intronic
1166455677 19:42938030-42938052 GCCATGTCCCGCGGGTTTCCTGG - Intronic
1166465472 19:43027305-43027327 GTCATGTCCCGCGGGATTCCTGG - Intronic
1166471605 19:43083509-43083531 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166482749 19:43187325-43187347 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166485223 19:43206459-43206481 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166492373 19:43270377-43270399 GCCATGTCCCGCGGGGTTCCTGG - Intergenic
926198530 2:10777735-10777757 GCCAGGGACCCCGGGGTTCCCGG - Intronic
927850416 2:26495124-26495146 GCCTGGTCCCGCAGGGGTCCAGG + Intronic
932298219 2:70644307-70644329 TCCATGTCCTGCTGGGTTCTAGG + Intronic
932798097 2:74715391-74715413 GCCCTGAGCCGCGGGGCTCCAGG - Intergenic
937274100 2:120673176-120673198 CCCTTGGCCCTCGGGGTTCCAGG + Intergenic
1174442454 20:50566905-50566927 GCCATGTGCCACGGGATTTCTGG + Intronic
1175108498 20:56630358-56630380 GCCATGTTCCTCCAGGTTCCCGG + Intronic
1179179674 21:39034846-39034868 CCCATCTCCCCCGGAGTTCCAGG - Intergenic
1180087932 21:45516368-45516390 GCCAGGTTCCGAGGGGTTCTTGG - Intronic
1181535090 22:23537680-23537702 GCAAAGTCCCGCTGGGTCCCGGG - Intergenic
1183765963 22:39875339-39875361 GCCACGTCCCGCGGGGTGGCGGG + Intronic
1184123869 22:42472904-42472926 GCCATGGCCAGGGCGGTTCCTGG - Intergenic
1184232084 22:43163641-43163663 GCCCTGTCCCCCGGGGGCCCAGG + Intergenic
1185004755 22:48269119-48269141 GCTATGTCCCGCAGTGTTCACGG + Intergenic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
949145082 3:690588-690610 GCCATGGACCGCTGGGATCCTGG + Intergenic
950696024 3:14701807-14701829 GCCATGTCTCCCCGGGTTCCAGG - Intronic
953679672 3:45029958-45029980 GCCATGTGCACCTGGGTTCCAGG + Intronic
963733067 3:148991420-148991442 GCGGTGGCCCGCGGGGCTCCGGG - Exonic
965611988 3:170554201-170554223 GCCATGCCCAGCATGGTTCCCGG - Intronic
1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG + Intronic
1006496364 6:34426123-34426145 GCCAGGACCCGCGGGGAGCCTGG + Intronic
1018628674 6:165804625-165804647 GCCAAGGCCCCCGGGTTTCCAGG - Intronic
1019217357 6:170452405-170452427 GCCCTGTCCTGCAGGGTTTCTGG - Intergenic
1026900399 7:74033799-74033821 CCCATGCCCCACGGGGCTCCCGG + Intronic
1026930307 7:74219977-74219999 GCCATGTCCGCCAGGGGTCCTGG - Exonic
1028969222 7:96838644-96838666 GCTATGTCCAGTCGGGTTCCTGG - Intergenic
1029737446 7:102472630-102472652 GCCCCATCCCGCGGGCTTCCGGG + Intronic
1035792215 8:2317366-2317388 GCCCTGTTCCTCCGGGTTCCAGG - Intergenic
1035800590 8:2404339-2404361 GCCCTGTTCCTCCGGGTTCCAGG + Intergenic
1037674347 8:21041227-21041249 GCCATGGCCCGCAGCTTTCCAGG + Intergenic
1038618418 8:29116969-29116991 GCCATGCACCGCGGAGTCCCAGG + Exonic
1040071854 8:43195166-43195188 CCCATGCCCCGAGGTGTTCCAGG - Intronic
1049436868 8:142590462-142590484 GCCATGTCGCCCATGGTTCCTGG + Intergenic
1049668308 8:143858648-143858670 GCCAGGTCCCGCAGGGTCTCGGG + Exonic
1049668724 8:143860247-143860269 GCCAGGTCCCGCAGGGTCTCGGG + Exonic
1049669139 8:143861849-143861871 GCCAGGTCCCGCAGGGTCTCGGG + Exonic
1049669554 8:143863451-143863473 GCCAGGTCCCGCAGGGTCTCGGG + Exonic
1049669964 8:143865044-143865066 GCCAGGTCCCGCAGGGTCTCGGG + Exonic
1050807409 9:9698487-9698509 GGCATGTCCCATGGGTTTCCTGG - Intronic
1053586464 9:39464225-39464247 GCCGGGCCCCGCGGGGTTGCGGG - Intergenic
1054579842 9:66901008-66901030 GCCGGGCCCCGCGGGGTTGCGGG + Intronic
1057274473 9:93669099-93669121 CCCAGGTCCCGCAGGGTTGCTGG - Intronic
1059191564 9:112332915-112332937 GCCAAGTCCCGCGGCGGCCCTGG + Exonic
1060588924 9:124803855-124803877 GCCATGTCCCCCTGCCTTCCTGG - Intronic
1062164200 9:135098511-135098533 GCCACGTCCCGCAGGGTACTGGG - Intronic
1203736303 Un_GL000216v2:142841-142863 TCCAGTTCCCGCGGGATTCCTGG + Intergenic
1203738638 Un_GL000216v2:160788-160810 TCCAGTTCCCGCGGGATTCCTGG + Intergenic
1203740769 Un_GL000216v2:175471-175493 TCCAGTTCCCGCGGGATTCCTGG + Intergenic
1190126367 X:47709064-47709086 GCCATCTCCTGCTGGGTTACTGG + Intergenic
1192450347 X:71240845-71240867 GCCATGTCCCTCAGGGTGACAGG - Exonic
1195099301 X:101539231-101539253 ACCATGTCCCACAGGGTTGCAGG - Intergenic
1201175475 Y:11306526-11306548 TCCAGTTCCCGCGGGATTCCTGG + Intergenic
1201176747 Y:11314528-11314550 TCCAGTTCCCGCGGGATTCCTGG + Intergenic