ID: 1166492373

View in Genome Browser
Species Human (GRCh38)
Location 19:43270377-43270399
Sequence GCCATGTCCCGCGGGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166492373_1166492379 -4 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492379 19:43270396-43270418 TGGCTCATTGAGACGCAGGAGGG No data
1166492373_1166492383 6 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492383 19:43270406-43270428 AGACGCAGGAGGGGGAGCCTGGG No data
1166492373_1166492386 18 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492386 19:43270418-43270440 GGGAGCCTGGGACAGAGCAGGGG No data
1166492373_1166492384 16 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492384 19:43270416-43270438 GGGGGAGCCTGGGACAGAGCAGG No data
1166492373_1166492380 -3 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492380 19:43270397-43270419 GGCTCATTGAGACGCAGGAGGGG No data
1166492373_1166492381 -2 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492381 19:43270398-43270420 GCTCATTGAGACGCAGGAGGGGG No data
1166492373_1166492382 5 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492382 19:43270405-43270427 GAGACGCAGGAGGGGGAGCCTGG No data
1166492373_1166492377 -8 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492377 19:43270392-43270414 GACATGGCTCATTGAGACGCAGG No data
1166492373_1166492378 -5 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492378 19:43270395-43270417 ATGGCTCATTGAGACGCAGGAGG No data
1166492373_1166492388 29 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492388 19:43270429-43270451 ACAGAGCAGGGGTTCAGAGCTGG No data
1166492373_1166492385 17 Left 1166492373 19:43270377-43270399 CCAGGAACCCCGCGGGACATGGC No data
Right 1166492385 19:43270417-43270439 GGGGAGCCTGGGACAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166492373 Original CRISPR GCCATGTCCCGCGGGGTTCC TGG (reversed) Intergenic